Literature DB >> 22865912

Nitric oxide-activated calcium/calmodulin-dependent protein kinase regulates the abscisic acid-induced antioxidant defence in maize.

Fangfang Ma1, Rui Lu, Huiying Liu, Ben Shi, Jianhua Zhang, Mingpu Tan, Aying Zhang, Mingyi Jiang.   

Abstract

Nitric oxide (NO), hydrogen peroxide (H2O2), and calcium (Ca2+)/calmodulin (CaM) are all required for abscisic acid (ABA)-induced antioxidant defence. Ca2+/CaM-dependent protein kinase (CCaMK) is a strong candidate for the decoder of Ca2+ signals. However, whether CCaMK is involved in ABA-induced antioxidant defence is unknown. The results of the present study show that exogenous and endogenous ABA induced increases in the activity of ZmCCaMK and the expression of ZmCCaMK in leaves of maize. Subcellular localization analysis showed that ZmCCaMK is located in the nucleus, the cytoplasm, and the plasma membrane. The transient expression of ZmCCaMK and the RNA interference (RNAi) silencing of ZmCCaMK analysis in maize protoplasts revealed that ZmCCaMK is required for ABA-induced antioxidant defence. Moreover, treatment with the NO donor sodium nitroprusside (SNP) induced the activation of ZmCCaMK and the expression of ZmCCaMK. Pre-treatments with an NO scavenger and inhibitor blocked the ABA-induced increases in the activity and the transcript level of ZmCCaMK. Conversely, RNAi silencing of ZmCCaMK in maize protoplasts did not affect the ABA-induced NO production, which was further confirmed using a mutant of OsCCaMK, the homologous gene of ZmCCaMK in rice. Moreover, H2O2 was also required for the ABA activation of ZmCCaMK, and pre-treatments with an NO scavenger and inhibitor inhibited the H2O2-induced increase in the activity of ZmCCaMK. Taken together, the data clearly suggest that ZmCCaMK is required for ABA-induced antioxidant defence, and H2O2-dependent NO production plays an important role in the ABA-induced activation of ZmCCaMK.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22865912      PMCID: PMC3427994          DOI: 10.1093/jxb/ers161

Source DB:  PubMed          Journal:  J Exp Bot        ISSN: 0022-0957            Impact factor:   6.992


Introduction

Plants are subjected to various biotic and abiotic stresses during their growth and development and have evolved various mechanisms to adapt to these stresses. The phytohormone abscisic acid (ABA) represents a key signal to regulate plant responses to biotic and abiotic stresses (Zhu, 2002; Cutler ). ABA can enhance the antioxidant defence system to protect cells and subcellular systems from the damage caused by excess reactive oxygen species (ROS) (Jiang and Zhang, 2001; Park ; Neill ). Previous studies have shown that hydrogen peroxide (H2O2), nitric oxide (NO), calcium (Ca2+)/calmodulin (CaM), and mitogen-activated protein kinase (MAPK) are required for ABA-induced up-regulation of the expression and the activities of antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and glutathione reductase (GR) in plants (Jiang and Zhang, 2002; Zhang , 2007; Sang ; Zhang ). However, the detailed mechanisms of ABA-induced antioxidant defence remain unclear. Ca2+ is a ubiquitous and pivotal second messenger in the signal transduction networks (Pei ; Dodd ; Kim ; Kudla ). Various stimuli, such as salinity, drought, cold, heat shock, mechanical disturbances, ABA, H2O2, and pathogen elicitors, trigger changes in the cytosolic Ca2+ concentration, and the transient Ca2+ elevations are recognized by several Ca2+ sensors such as CaM and CaM-like protein (CML), calcium-dependent protein kinase (CDPK), calcineurin B-like protein (CBL), and Ca2+/CaM-dependent protein kinase (CCaMK) (Harmon ; Luan ; Yang and Poovaiah, 2003; Zhang and Lu, 2003; Harper ; Bouché ; Harper and Harmon, 2005; Yano ; DeFalco ). These Ca2+ sensors convert the Ca2+ signals into various physiological responses. CCaMK is a strong candidate for the decoder of Ca2+ spiking. A CCaMK structure includes a serine/threonine kinase domain, a CaM-binding domain, and three EF-hand motifs, similar to the visinin-like domain (Patil ; Takezawa ). Many studies have shown that CCaMK is a common symbiosis signalling pathway component and regulates both arbuscular mycorrhiza (AM) and rhizobial symbioses in legumes and non-legumes (Lévy ; Godfroy ; Tirichine ; Chen , 2008; Capoen ; Hayashi ; Kang ). CCaMK was also suggested to play roles in meiosis and mitosis (Patil ; Poovaiah ; Yang and Poovaiah, 2003). In addition to its development-related roles, CCaMK may also be involved in abiotic stress responses. The wheat CCaMK gene TaCCaMK was down-regulated by ABA, as well as NaCl and polyethylene glycol (PEG) treatments in wheat seedling roots (Yang ). Overexpressing TaCCaMK in Arabidopsis reduced their sensitivity to ABA treatment during seed germination and enhanced the seed germination rate under high-salt conditions. These results suggest that TaCCaMK is a negative regulator of ABA signalling involved in abiotic stress responses in wheat. Previous studies have shown that Ca2+/CaM is required for ABA-induced antioxidant defence, and the cross-talk between Ca2+/CaM and H2O2 and NO plays a pivotal role in the ABA signalling in leaves of maize seedlings (Jiang and Zhang, 2003; Sang ). However, it is unknown whether Ca2+/CaM-mediated up-regulation in the antioxidant defence is through the action of CCaMK activated by Ca2+/CaM in ABA signalling and, if so, what the relationship between ZmCCaMK and H2O2 and NO in ABA signalling is. In this study, the role of CCaMK in ABA-induced up-regulation in the expression of antioxidant genes such as SOD4, encoding a cytosolic isoform of SOD, cAPX, encoding a cytosolic isoform of APX, the total activities of antioxidant enzymes SOD and APX in leaves of maize plants, and the relationship between CCaMK and H2O2 and NO were investigated. By combining pharmacological and biochemical analysis with a genetic approach, evidence is provided to show that ZmCCaMK is required for ABA-induced antioxidant defence, and H2O2-induced NO production plays an important role in the activation of ZmCCaMK in ABA signalling.

Materials and methods

Plant materials and treatments

Maize (Zea mays L. cv. Nongda 108; from Nanjing Agricultural Uni versity, China), rice (Oryza sativa) cultivar Nipponbare, and the rice mutant line NF8513 were used in this study. In the mutant experiments, Nipponbare was used as the wild-type control. Seeds of maize were sown in trays of sand, and rice plants were grown hydroponically with a nutrient solution in a light chamber at a temperature of 22–28 °C, with a photosynthetically active radiation of 200 µmol m–2 s–1 and a photoperiod of 14/10h (light/dark), and watered daily. For protoplast isolation, maize plants were grown at 25 °C under dark conditions. When the second leaves were fully expanded, they were collected and used for investigations. The plants were excised at the base of the stem and placed in distilled water for 1h to eliminate wound stress. After treatment, the cut ends of the stems were placed in beakers wrapped with aluminium foil containing 100 µM ABA, 10% PEG, 100 µM sodium nitroprusside (SNP), or 10mM H2O2 solution for various times at 25 °C, with a continuous light intensity of 200 µmol m–2 s–1. In order to study the effects of various inhibitors or scavengers, the detached plants were pre-treated with 200 µΜ N-(6-aminohexyl)-5-chloro-1-naphthalene sulphonamide hydrochloride (W7), 100 µΜ trifluoperazine (TFP), 5mM EGTA, 5mM LaCl3, 10mM dimethylthiourea (DMTU), 200U of catalase (CAT), 100 µM diphenyleneiodonium (DPI), 200 µM 2-4-carboxyphenyl-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO), and 200 µM N G-nitro-l-Arg methyl ester (l-NAME) for 4h, then exposed to 100 µM ABA or 10mM H2O2 treatment for various times under the same conditions as described above. Detached plants were treated with distilled water under the same conditions for the whole period and served as controls for the above. For fluridone treatment, the seeds soaking in 80 µM fluridone for 14h were sown in trays of sand. After treatments of detached maize plants, the second leaves were sampled and immediately frozen under liquid N2 for further analysis.

Antibody production and immunoprecipitation kinase activity assay

The peptides for ZmCCaMK-C (GDITEPGKLDEVFD) corresponding to the C-terminus of ZmCCaMK were synthesized and conjugated to the keyhole limpet haemocyanin carrier. The ZmCCaMK polyclonal antibody was raised in rabbits and purified by affinity chromatography. Protein was extracted from maize leaves or protoplasts as described previously (Zhang ). Protein content was determined according to the method of Bradford (1976) with bovine serum albumin (BSA) as standard. For immunocomplex kinase assay, protein extract (200 µg) was incubated with anti-ZmCCaMK antibody (7.5 µg) in an immunoprecipitation buffer as described previously (Zhang ). Kinase activity in the immunocomplex was determined by an in-gel kinase assay using histone S-III as the substrate (Takezawa ; Zhang ). The immunocomplex was incubated in reaction buffer [25mM Tris, pH 7.5, 5mM MgCl2, 1mM dithiothreitol (DTT), 2.5mM CaCl2, 2 µM CaM, 1mg ml–1 histone S-III] with 200nM ATP plus 1 µCi of [γ-32P]ATP (3000 Ci mM–1) for 30min. An equal volume of SDS sample buffer was added to stop the reaction. The reaction mix was boiled at 100 °C for 5min and resolved by SDS–PAGE. The unincorporated [γ-32P]ATP was removed by washing with 5% trichloroacetic acid (w/v)/1% sodium pyrophosphate (w/v) at least three times. The gel was dried onto Whatman 3 MM paper and exposed to Kodak XAR-5 film. Pre-stained size markers (Bio-Rad) were used to calculate the size of the kinases. Relative activation levels of ZmCCaMK protein were quantitated by Quantity One software (Bio-Rad Laboratories Inc., USA).

Isolation of total RNA and RT-PCR analysis

Total RNA was isolated from leaves or protoplasts using RNAiso Plus (TaKaRa Bio Inc., China) according to the instructions supplied by the manufacturer. Approximately 2 µg of total RNA were reverse transcribed using oligo(dT)18 primer and M-MLV reverse transcriptase (TaKaRa Bio Inc., China). Transcript levels of several genes were measured by RT-PCR using the following primers: ZmCCaMK (GenBank accession no. DQ403196; size of product, 457bp), forward CGCCGTTCCATGCACCA and reverse AGCCTCATCGCCCTCAGCAC; SOD4 (GenBank accession no.. X17565; size of product, 404bp), forward GGGCACAATCTTCTTCACC and reverse GTCCGATGATCCCACAAG; cAPX (GenBank accession no. EU969033; size of product, 450bp), forward TCACACCCTGGGAAGATG and reverse GCTTCATATCAAACCTTCTCC; GAPDH (glyceraldehyde phosphate dehydrogenase; GenBank accession no. X07156; size of product, 264bp), forward CAACGACCCCTTCATCACC and reverse ACCTTCTTGGCACCACCCT. To standardize the results, the relative abundance of GAPDH was determined and used as the internal standard. The cycle number of the PCRs was adjusted for each gene to obtain barely visible bands in agarose gels. Aliquots of the PCRs were loaded on agarose gels and stained with ethidium bromide.

Real-time quantitative RT-PCR expression analysis

The expression of ZmCCaMK was also measured by qRT-PCR using the DNA Engine Opticon 2 real-time PCR detection system (Bio-Rad Laboratories Inc., USA) with the SYBR® Premix Ex Taq™ (TaKaRa Bio Inc., China) according to the manufacturer’s instructions. The cDNA was amplified by PCR using the following primers: ZmCCaMK (size of product, 172bp), forward CTCAAGCCCGAGAACTGCC and reverse TGGCAGCCGAGACATCC; β-actin (GenBank accession no. J01238; size of product, 152bp), forward GTTTCCTGGGATTGCCGAT and reverse TCTGCTGCTGAAAAGTGCTGAG. To standardize the results, the amplification of β-actin was determined and used as the internal standard. The data were normalized to the amplification of a maize β-actin gene. For each sample, the mean value from three qRT-PCRs was adapted to calculate the expression abundance, and the mean values were then plotted with their SE.

Vector construction and in vitro transcription of the ZmCCaMK gene double-stranded RNA

The full-length cDNA fragment was amplified with the addition of a BsrGI site and then inserted in-frame with yellow fluorescent protein (YFP) into the pXZP008 vector driven by the Cauliflower mosaic virus (CaMV) 35S promoter. The primers used for the PCR amplification were: forward 5′-TGTACAAGATTCCTCGCACAAACCTGCCACA-3′, and reverse 5′-TGTACAGGTGGGAATGAAGTTGAACGAGTTGGAAT-3′ (underlining indicates the BsrGI site). A template partial-length DNA fragment was amplified by PCR using primers flanked by a T7 promoter, forward (5′-TAATACGACTCACTATAGGGCAAGCCCGAGAACTGCC-3′) and reverse (5′-TAATACGACTCACTATAGGGTGGCAGCCGAGACATCC-3′) (the T7 promoter site is underlined). The PCR amplification consisted of initial denaturation at 94 °C for 3min, then 35 cycles of 94 °C for 20 s, 60 °C for 15 s, and 72 °C for 15 s, and a final extension at 72 °C for 2min. Double-stranded RNA (dsRNA) of ZmCCaMK was synthesized in vitro using the RiboMAX™ Large Scale RNA Production System-T7 (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The purity and concentration of synthesized dsRNA were checked by 2% agarose gel electrophoresis and spectrophotometry.

Protoplast preparation and transfection with constructs or dsRNAs

Protoplast isolation and transfection with constructs or dsRNAs were based on the protocol for maize mesophyll protoplasts provided online by J. Sheen’s laboratory http://genetics.mgh.harvard.edu/sheenweb with minor modifications. For transfection, 1ml of maize protoplasts (usually 5×105 cells ml–1) were transfected with 150 µg of YFP–ZmCCaMK fusion constructs (pXZP008 vector as control) or dsRNAs (H2O as control) using a PEGcalcium-mediated method. Then the transfected protoplasts were incubated in incubation solution overnight in the dark at 25 °C. After that, protoplasts were collected and used for further analysis.

Localization

Expression of YFP–ZmCCaMK fusion constructs and YFP was monitored using a confocal microscope (TCS-SP2, Leica, Bensheim, Germany). The nucleus was stained with the 4′,6-diamidino-2-phenylindole (DAPI) dye, and the plasma membrane was visualized by staining with N-(3-triethylammoniumpropyl]-4-[p-diethyl- aminophenylhexatrienyl) pyridinium dibromide (FM4-64).

Western blot assay

Proteins were extracted from protoplasts tansfected with YFP or YFP-ZmCCaMK, and 20 µg of total protein was subjected to SDS–PAGE. Western blot analysis was performed as described by Sambrook and Russell (2001). Anti-YFP antibody was used to detect the YFP protein or YFP–ZmCCaMK protein.

Antioxidant enzyme assays

Protoplasts were homogenized in 0.5ml of 50mM potassium phosphate buffer (pH 7.0) containing 1mM EDTA and 1% polyvinylpyrrolidone, with the addition of 1mM ascorbate in the case of APX assay. The homogenate was centrifuged at 12 000 g for 15min at 4 °C and the supernatant was immediately used for the susequent antioxidant enzyme assays. The total activities of antioxidant enzymes were determined as previously described (Jiang and Zhang, 2001). Total SOD activity was assayed by monitoring the inhibition of photochemical reduction of nitro blue tetrazolium. One unit of SOD activity was defined as the amount of enzyme that was required to cause 50% inhibition of the reduction of nitro blue tetrazolium, as monitored at 560nm. Total APX activity was measured by monitoring the decrease in absorbance at 290nm as ascorbate was oxidized.

Nitric oxide detection by confocal laser scanning microscopy (CLSM)

Measurement of NO was performed with the specific NO dye 4,5-diaminofluorescein diacetate (DAF-2DA), using the method as described by Corpas with slight modifications. Leaf segments of ~0.5cm2 or protoplasts were incubated in loading buffer [0.1mM CaCl2, 10mM KCl, 10mM 2-(N-morpholino)ethanesulphonic acid (MES)-TRIS, pH 5.6] and DAF-2DA at a final concentration of 10 µM for 1h in the dark at 25 °C, followed by washing with loading buffer for 1h. All images were visualized using confocal microscopy (excitation 495nm, emission 515nm). To enable the comparison of changes in signal intensity, confocal images were taken under identical exposure conditions for all the samples. The green fluorescence intensity of images acquired was quantified using Leica IMAGE software to integrate the intensity over all pixels within the boundary of each image. The value of each image was normalized to a reference image of the basal state. Data are presented as average fluorescence intensity.

Results

ABA induces increases in the activity and the expression of ZmCCaMK in leaves of maize

In order to investigate the effect of ABA on the activation of ZmCCaMK in leaves of maize plants, an antibody against the C-terminus of ZmCCaMK was raised and an immunoprecipitation kinase assay was performed on protein extracts from the leaves of maize plants treated or not with ABA, using histone S-III as a substrate (Takezawa ; Zhang ). Under control conditions, a low background level of ZmCCaMK activity was observed (Fig. 1A). However, when 100 µM ABA was applied, a significant increase in the activation of ZmCCaMK was detected after 20min treatment, was maximizal at 30min, and then decreased (Fig. 1A). Moreover, the ABA-induced activation of ZmCCaMK occurred in a dose-dependent manner in the concentration range of 10–100 µM ABA (Fig. 1D).
Fig. 1.

ABA induces the up-regulation in the activity of ZmCCaMK and the expression of ZmCCaMK in leaves of maize plants. (A) Time course of ABA-induced ZmCCaMK activation. The detached plants were treated with 100 µM ABA for various times as indicated. Protein extracts from control or ABA-treated leaves were immunoprecipitated with ZmCCaMK antibody and then subjected to an in-gel kinase assay. (B) Time course of ABA-induced gene expression of ZmCCaMK. The detached plants were treated as described in A. Relative expression levels of the ZmCCaMK gene, analysed by qRT-PCR, are normalized to β-actin transcript levels. (C) PEG-induced ABA activates ZmCCaMK. The detached plants were treated as follows: distilled water (control); 10% PEG; 80 µM fluridone+H2O; 80 µM fluridone+10% PEG; 80 µM fluridone+10% PEG+100 µM ABA. Protein extracts were subjected to immunoprecipitation kinase assay. (D) Dose dependence for ABA-induced ZmCCaMK activation. The detached plants were treated with 0, 10, 50, and 100 µM ABA for 30min. Protein extracts were subjected to immunoprecipitation kinase assay. (E) Kinase activity assay of immune complexes. Immunoprecipitation was performed in the absence or presence of 10 µg or 50 µg of competitor peptides corresponding to the C-terminal peptide of ZmCCaMK. Immunocomplex kinase activity was measured using an in-gel kinase assay. Experiments were repeated at least three times with similar results. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

ABA induces the up-regulation in the activity of ZmCCaMK and the expression of ZmCCaMK in leaves of maize plants. (A) Time course of ABA-induced ZmCCaMK activation. The detached plants were treated with 100 µM ABA for various times as indicated. Protein extracts from control or ABA-treated leaves were immunoprecipitated with ZmCCaMK antibody and then subjected to an in-gel kinase assay. (B) Time course of ABA-induced gene expression of ZmCCaMK. The detached plants were treated as described in A. Relative expression levels of the ZmCCaMK gene, analysed by qRT-PCR, are normalized to β-actin transcript levels. (C) PEG-induced ABA activates ZmCCaMK. The detached plants were treated as follows: distilled water (control); 10% PEG; 80 µM fluridone+H2O; 80 µM fluridone+10% PEG; 80 µM fluridone+10% PEG+100 µM ABA. Protein extracts were subjected to immunoprecipitation kinase assay. (D) Dose dependence for ABA-induced ZmCCaMK activation. The detached plants were treated with 0, 10, 50, and 100 µM ABA for 30min. Protein extracts were subjected to immunoprecipitation kinase assay. (E) Kinase activity assay of immune complexes. Immunoprecipitation was performed in the absence or presence of 10 µg or 50 µg of competitor peptides corresponding to the C-terminal peptide of ZmCCaMK. Immunocomplex kinase activity was measured using an in-gel kinase assay. Experiments were repeated at least three times with similar results. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test. To investigate whether the activation of ZmCCaMK can be induced by endogenous ABA, maize seeds were pre-treated by fluridone, an inhibitor of carotenoid biosynthesis, and hence of ABA biosynthesis (Nagamune ), and then the pre-treated plants were exposed to PEG treatment. PEG-induced activation of ZmCCaMK was significantly inhibited in 80 µM fluridone-pre-treated plants, but this effect of fluridone was overcome by the application of 100 µM ABA (Fig. 1C), indicating that water stress-induced endogenous ABA accumulation can activate ZmCCaMK. The effects of ABA on the induction of ZmCCaMK gene expression in leaves of maize plants were further examined, and relative quantitative real-time PCR analysis was performed using total RNA extracted from maize plants treated or not with 100 µM ABA. The experimental results showed that the ZmCCaMK gene was up-regulated by the treatment with 100 µM ABA (Fig. 1B), and the changed pattern of ZmCCaMK gene expression was similar to that of ZmCCaMK activation in leaves of maize exposed to ABA treatment (Fig. 1A, B). To prove the specificity of the antibody, immunoprecipitations with or without peptide competitors were carried out and immune complexes were assayed for kinase activity. Proteins that could phosphorylate histone S-III were precipitated from extracts of leaves of maize plants. The immune complexes were competed out by the peptide used to raise the antibody against the C-terminal region of ZmCCaMK (Fig. 1E). Further, pre-treatments with the Ca2+ chelator EGTA, the Ca2+ channel blocker LaCl3, and the CaM antagonists TFP and W7 significantly reduced the ABA-induced activation of ZmCCaMK in leaves of maize plants treated with ABA (data not shown).

Subcellular localization of ZmCCaMK in maize mesophyll protoplasts

To gain evidence indicative of function, the subcellular localization of ZmCCaMK was investigated in transfected maize protoplasts by using confocal microscopy. YFP fusion constructs for ZmCCaMK were generated under the control of the CaMV 35S promoter. The results showed that YFP–ZmCCaMK was localized in the nucleus, the cytoplasm, and the plasma membrane in maize mesophyll protoplasts (Fig. 2A, B). Nuclear location was confirmed by means of DAPI staining for DNA (Sakamoto ), and the plasma membrane location was confirmed by co-localization with the plasma membrane marker, FM4-64 (Levy ; Zelazny ). In addition, the localization of YFP–ZmCCaMK was not regulated by ABA treatment in maize mesophyll protoplasts (data not shown). Furthermore, the expression of the effector proteins was confirmed by western blot analysis using an anti-YFP antibody in maize mesophyll protoplasts transfected with constructs (Fig. 2C).
Fig. 2.

Subcellular localization of ZmCCaMK in maize protoplasts. (A, B) Protoplasts were isolated from the leaves of maize, and then were transfected with constructs carrying 35S:YFP-ZmCCaMK or 35S:YFP by PEG–calcium-mediated transformation. Fluorescence micrographs were taken after 16h of incubation by a laser confocal microscope. The nucleus was stained with DAPI dye (blue, A). The plasma membrane was labelled with FM4-64 steryl dye (red, B). Experiments were repeated at least five times with similar results. (C) Western blot analysis for YFP–ZmCCaMK fusion proteins with an anti-YFP antibody. Experiments were repeated at least five times with similar results. (This figure is available in colour at JXB online.)

Subcellular localization of ZmCCaMK in maize protoplasts. (A, B) Protoplasts were isolated from the leaves of maize, and then were transfected with constructs carrying 35S:YFP-ZmCCaMK or 35S:YFP by PEGcalcium-mediated transformation. Fluorescence micrographs were taken after 16h of incubation by a laser confocal microscope. The nucleus was stained with DAPI dye (blue, A). The plasma membrane was labelled with FM4-64 steryl dye (red, B). Experiments were repeated at least five times with similar results. (C) Western blot analysis for YFP–ZmCCaMK fusion proteins with an anti-YFP antibody. Experiments were repeated at least five times with similar results. (This figure is available in colour at JXB online.)

ZmCCaMK modulates the ABA-induced antioxidant defence

To investigate whether ZmCCaMK mediates the ABA-induced antioxidant defence in maize, a transient gene expression analysis and a transient RNA interference (RNAi) analysis in maize mesophyll protoplasts, which have been proven to be efficient for functional analysis of plant genes (Sheen, 2001; Chen ; Zhai ; Kim and Somers, 2010; Gao ), were used for the functional analysis of ZmCCaMK in ABA-induced antioxidant defence. As anticipated, transient expression of ZmCCaMK in protoplasts resulted in a significant enhancement in the transcript levels of ZmCCaMK, and the antioxidant genes, SOD4 and cAPX, when compared with those in the protoplasts transfected with the empty vector (Fig. 3A). Similar to the expression of antioxidant genes, the total activities of the antioxidant enzymes SOD and APX were also obviously increased in protoplasts showing transient expression of ZmCCaMK (Fig. 3B, C). On the other hand, RNAi-mediated silencing of ZmCCaMK, which resulted in an obvious reduction in the expression of ZmCCaMK (Fig. 4A) and the activity of ZmCCaMK (Fig. 4B), significantly decreased the activities of SOD and APX compared with control (Fig. 4D, E). Further, treatment with 10 µM ABA only slightly increased the expression of ZmCCaMK and the activities of ZmCCaMK, SOD, and APX in protoplasts subjected to RNAi silencing of ZmCCaMK (Fig. 4B–E). However, treatment with 10 µM ABA induced significant increases in the expression of ZmCCaMK and the activities of ZmCCaMK, SOD, and APX in the control protoplasts (Fig. 4B–E). Taken together, these data demonstrate unequivocally that ZmCCaMK is required for ABA-induced antioxidant defence in maize protoplasts.
Fig. 3.

The gene expression and the total activities of antioxidant enzymes in maize mesophyll protoplasts transiently expressing ZmCCaMK. (A) The expression of ZmCCaMK, SOD4, and cAPX. Protoplasts isolated from the leaves of maize were transfected with constructs carrying YFP-ZmCCaMK (ZmCCaMK), and control protoplasts were transfected with empty vector (Vector). Relative expression of antioxidant enzymes was analysed by RT-PCR, and was normalized to GAPDH transcript levels. Experiments were repeated at least three times with similar results. (B and C) The activities of SOD and APX. Protoplasts were isolated as described in A, and the activities of SOD and APX were measured as described in the Materials and methods. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

Fig. 4.

The expression of ZmCCaMK and the activities of ZmCCaMK and antioxidant enzymes in the protoplasts with transiently silenced ZmCCaMK. (A) The expression of ZmCCaMK. Protoplasts were transfected with dsRNA against ZmCCaMK (RNAi) or with water (Control) and incubated for 24h. Silencing of ZmCCaMK was analysed by RT-PCR, and was normalized to GAPDH transcript levels. Experiments were repeated at least three times with similar results. (B) ABA-induced activation of ZmCCaMK. The protoplasts were treated with 10 µM ABA for 5min. Protein extracts from ABA-treated or untreated protoplasts were immunoprecipitated with ZmCCaMK antibody and then subjected to an in-gel kinase assay. Experiments were repeated at least three times with similar results. (C) ABA-induced gene expression of ZmCCaMK. Protoplasts were treated with 10 µM ABA for 15min, and the expression of ZmCCaMK was analysed by RT-PCR. Experiments were repeated three times with similar results. (D, E) ABA increased the activities of SOD (D) and APX (E). Protoplasts were treated with 10 µM ABA for 15min, and the activities of SOD and APX were measured as described in the Materials and methods. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

The gene expression and the total activities of antioxidant enzymes in maize mesophyll protoplasts transiently expressing ZmCCaMK. (A) The expression of ZmCCaMK, SOD4, and cAPX. Protoplasts isolated from the leaves of maize were transfected with constructs carrying YFP-ZmCCaMK (ZmCCaMK), and control protoplasts were transfected with empty vector (Vector). Relative expression of antioxidant enzymes was analysed by RT-PCR, and was normalized to GAPDH transcript levels. Experiments were repeated at least three times with similar results. (B and C) The activities of SOD and APX. Protoplasts were isolated as described in A, and the activities of SOD and APX were measured as described in the Materials and methods. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test. The expression of ZmCCaMK and the activities of ZmCCaMK and antioxidant enzymes in the protoplasts with transiently silenced ZmCCaMK. (A) The expression of ZmCCaMK. Protoplasts were transfected with dsRNA against ZmCCaMK (RNAi) or with water (Control) and incubated for 24h. Silencing of ZmCCaMK was analysed by RT-PCR, and was normalized to GAPDH transcript levels. Experiments were repeated at least three times with similar results. (B) ABA-induced activation of ZmCCaMK. The protoplasts were treated with 10 µM ABA for 5min. Protein extracts from ABA-treated or untreated protoplasts were immunoprecipitated with ZmCCaMK antibody and then subjected to an in-gel kinase assay. Experiments were repeated at least three times with similar results. (C) ABA-induced gene expression of ZmCCaMK. Protoplasts were treated with 10 µM ABA for 15min, and the expression of ZmCCaMK was analysed by RT-PCR. Experiments were repeated three times with similar results. (D, E) ABA increased the activities of SOD (D) and APX (E). Protoplasts were treated with 10 µM ABA for 15min, and the activities of SOD and APX were measured as described in the Materials and methods. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

NO induces the activation and gene expression of ZmCCaMK in leaves of maize plants

It has been reported that NO is involved in the ABA-induced antioxidant defence system and NO functions both upstream and downstream of Ca2+/CaM in plants (Zhang ; Sang ; Aboul-Soud ). To establish a link between NO and ZmCCaMK in ABA signalling, the NO donor SNP was used. Treatment with SNP led to a rapid activation of ZmCCaMK (Fig. 5A). A rapid increase in the activity of ZmCCaMK was detected within 10min and maximized at 45min after SNP treatment which has been shown to result in NO effects itself by using sodium ferricyanide as control (Zhang ). The activity of ZmCCaMK decreased after 60min of SNP treatment. SNP treatment also induced a significant increase in the expression of ZmCCaMK in a similar manner as the activity of ZmCCaMK in leaves of maize plants (Fig. 5B). In addition, the activation of ZmCCaMK occurred at SNP concentrations as low as 10 µM and the activity of ZmCCaMK appeared to reach a maximum at 100 µM SNP (Fig. 5C).
Fig. 5.

NO induces the activation of ZmCCaMK and the expression of ZmCCaMK in leaves of maize plants. (A) Time course of SNP-induced ZmCCaMK activation. The detached plants were treated with 100 µM SNP for various times as indicated. Protein extracts from control or SNP-treated leaves were immunoprecipitated with ZmCCaMK antibody and then subjected to an in-gel kinase assay. (B) Time course of SNP-induced gene expression of ZmCCaMK. The detached plants were treated as described in A. Relative expression levels of the ZmCCaMK gene, analysed by qRT-PCR, are normalized to β-actin transcript levels. (C) Dose dependence for SNP-induced ZmCCaMK activation. The detached plants were treated with 0, 10, 50, and 100 µM SNP for 45min and then subjected to immunoprecipitation kinase assay. (D) Effects of pre-treatments with cPTIO and l-NAME on ABA-induced ZmCCaMK activation. The detached plants were treated as follows: distilled water (control); 100 µM ABA; 200 µM cPTIO+H2O; 200 µM cPTIO+100 µM ABA; 200 µM l-NAME+H2O; 200 µM l-NAME+100 µM ABA. The detached plants were pre-treated with the scavenger or inhibitor for 4h then exposed to 100 µM ABA treatment for 30min. (E) Effects of pre-treatments with the H2O2 scavengers or inhibitor, DMTU, CAT, and DPI, and the NO scavenger or inhibitor, cPTIO and l-NAME, on the expression of ZmCCaMK in leaves of maize plants exposed to ABA treatment. The detached plants were treated as follows: distilled water (control); 10mM DMTU+H2O; 200U of CAT+H2O; 100 µM DPI+H2O; 200 µM l-NAME+H2O; 200 µM cPTIO+H2O; 100 µM ABA; 10mM DMTU+100 µM ABA; 200U of CAT+100 µM ABA; 100 µM DPI+100 µM ABA; 200 µM l-NAME+100 µM ABA; 200 µM cPTIO+100 µM ABA. The detached plants were pre-treated with scavengers or inhibitors for 4h then exposed to 100 µM ABA treatment for 30min. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

NO induces the activation of ZmCCaMK and the expression of ZmCCaMK in leaves of maize plants. (A) Time course of SNP-induced ZmCCaMK activation. The detached plants were treated with 100 µM SNP for various times as indicated. Protein extracts from control or SNP-treated leaves were immunoprecipitated with ZmCCaMK antibody and then subjected to an in-gel kinase assay. (B) Time course of SNP-induced gene expression of ZmCCaMK. The detached plants were treated as described in A. Relative expression levels of the ZmCCaMK gene, analysed by qRT-PCR, are normalized to β-actin transcript levels. (C) Dose dependence for SNP-induced ZmCCaMK activation. The detached plants were treated with 0, 10, 50, and 100 µM SNP for 45min and then subjected to immunoprecipitation kinase assay. (D) Effects of pre-treatments with cPTIO and l-NAME on ABA-induced ZmCCaMK activation. The detached plants were treated as follows: distilled water (control); 100 µM ABA; 200 µM cPTIO+H2O; 200 µM cPTIO+100 µM ABA; 200 µM l-NAME+H2O; 200 µM l-NAME+100 µM ABA. The detached plants were pre-treated with the scavenger or inhibitor for 4h then exposed to 100 µM ABA treatment for 30min. (E) Effects of pre-treatments with the H2O2 scavengers or inhibitor, DMTU, CAT, and DPI, and the NO scavenger or inhibitor, cPTIO and l-NAME, on the expression of ZmCCaMK in leaves of maize plants exposed to ABA treatment. The detached plants were treated as follows: distilled water (control); 10mM DMTU+H2O; 200U of CAT+H2O; 100 µM DPI+H2O; 200 µM l-NAME+H2O; 200 µM cPTIO+H2O; 100 µM ABA; 10mM DMTU+100 µM ABA; 200U of CAT+100 µM ABA; 100 µM DPI+100 µM ABA; 200 µM l-NAME+100 µM ABA; 200 µM cPTIO+100 µM ABA. The detached plants were pre-treated with scavengers or inhibitors for 4h then exposed to 100 µM ABA treatment for 30min. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test. In order to determine that the induction of ZmCCaMK by ABA is related to ABA-induced NO generation, the effects of the NO scavenger cPTIO and the NOS inhibitor l-NAME on ABA-induced activation of ZmCCaMK were assessed. The detached plants were pre-treated with cPTIO and l-NAME, and then exposed to ABA treatment. ABA-induced increases in the activity of ZmCCaMK and the gene expression of ZmCCaMK were greatly inhibited in the presence of cPTIO and l-NAME, as shown in Fig. 5D and E. Alone, cPTIO and l-NAME has little effect on the activation of ZmCCaMK and the gene expression of ZmCCaMK. Together these data suggest that ABA-induced NO production is required for ABA-induced activation of ZmCCaMK.

ABA-activated ZmCCaMK does not mediate the ABA-induced NO production

The role of ZmCCaMK in ABA-induced NO production was also examined by monitoring NO synthesis in response to ABA treatment, using protoplasts transfected with dsRNA against ZmCCaMK. Protoplasts were loaded with the NO-specific fluorescent dye DAF-2DA, and CLSM was used to monitor changes in NO-induced fluorescence in mesophyll protoplasts in maize leaves. Treatment with 10 µM ABA led to a rapid increase in NO-induced fluorescence in mesophyll protoplasts compared with control, and a similar induction was also observed in protoplasts transfected with dsRNA against ZmCCaMK (Fig. 6), suggesting that ABA-induced ZmCCaMK activation is not required for ABA-induced NO production.
Fig. 6.

NO production in transiently silenced ZmCCaMK protoplasts. The protoplasts were treated with 10 µM ABA for 30min, and then loaded with 4,5-diaminofluorescein diacetate (DAF-2DA) and detected by confocal laser scanning microscopy. Values are the mean ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

NO production in transiently silenced ZmCCaMK protoplasts. The protoplasts were treated with 10 µM ABA for 30min, and then loaded with 4,5-diaminofluorescein diacetate (DAF-2DA) and detected by confocal laser scanning microscopy. Values are the mean ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test. To gain further evidence that ZmCCaMK is not essential for ABA-induced NO production, the rice mutant line NF8513 (‘Nipponbare’) containing the Tos17 insertion in OsDMI3, a homologous gene of ZmCCaMK in rice, was screened and the homozygous mutant in NF8513 was isolated. As shown in Fig. 7, a significant increase in NO-induced fluorescence was observed in ABA-treated leaves of the wild type compared with the control leaves. NO production was observed as early as 1h after the addition of 100 µM ABA, was maximizal after 2h of ABA treatment, and then decreased after 4h treatment. Importantly, leaves of the rice mutant line NF8513 also exhibited a significant increase in the level of NO in response to exogenous ABA in the same manner as did those of the wild type, and ABA-induced NO production in the wild type and mutant was not significantly different (Fig. 7). These data further confirm that ZmCCaMK is not involved in ABA-induced NO accumulation in ABA signalling.
Fig. 7.

Time course analysis of NO production in mesophyll cells of the rice mutant of OsDMI3 and the wild type exposed to ABA treatment. The detached plants were treated with 100 µM ABA or distilled water for various times as indicated, and then the leaf segments were loaded with 4,5-diaminofluorescein diacetate (DAF-2DA) and detected by confocal laser scanning microscopy. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

Time course analysis of NO production in mesophyll cells of the rice mutant of OsDMI3 and the wild type exposed to ABA treatment. The detached plants were treated with 100 µM ABA or distilled water for various times as indicated, and then the leaf segments were loaded with 4,5-diaminofluorescein diacetate (DAF-2DA) and detected by confocal laser scanning microscopy. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

H2O2 is required for ABA-induced activation of ZmCCaMK and the activation is regulated by NO

Previous work showed that ABA-induced NO generation was mediated by H2O2 in ABA signalling in leaves of maize (Zhang ). To investigate whether H2O2 also plays a role in NO-induced activation of ZmCCaMK in ABA signalling, the activation and gene expression of ZmCCaMK induced by H2O2 were examined in leaves of maize plants. Exogenous 10mM H2O2 treatment rapidly induced an increase in the activity of ZmCCaMK in leaves of maize plants (Fig. 8A). Several ROS manipulators, such as DPI, an inhibitor of NADPH oxidase, and DMTU and CAT, H2O2 scavengers, were used to assess the effect of endogenous H2O2 on the induction of ZmCCaMK. Pre-treatments with DPI, DMTU, and CAT clearly blocked the ABA-induced activation of ZmCCaMK in maize plants (Fig. 8C), suggesting that H2O2 is required for the activation of ZmCCaMK in ABA signalling. Similarly, the gene expression of ZmCCaMK was also significantly up-regulated by both exogenous and endogenous H2O2 (Figs 5E, 8B). Furthermore, pre-treatment with cPTIO and l-NAME significantly blocked the H2O2-induced activation of ZmCCaMK in leaves of maize (Fig. 8D). Moreover, a previous study showed that exogenous H2O2 and ABA-induced H2O2 could induce the production of NO in leaves maize (Zhang ). Together with these data, the present results suggest that NO is required for H2O2-induced activation of ZmCCaMK in ABA signalling in leaves of maize plants.
Fig. 8.

H2O2 is involved in the ABA-induced activation of ZmCCaMK and the activation is mediated by NO. (A) Time course of H2O2-induced ZmCCaMK activation. The detached plants were treated with 10mM H2O2 for various times as indicated. Protein extracts from control or H2O2-treated leaves were immunoprecipitated with ZmCCaMK antibody and then subjected to an in-gel kinase assay. (B) Time course of H2O2-induced gene expression of ZmCCaMK. The detached plants were treated as described in A. Relative expression levels of the ZmCCaMK gene, analysed by qRT-PCR, are normalized to β-actin transcript levels. (C) Effects of H2O2 scavengers or an inhibitor on ABA-activated ZmCCaMK. The detached plants were treated as follows: distilled water (control); 100 µM ABA; 10mM DMTU+H2O; 10mM DMTU+100 µM ABA; 200U of CAT+H2O; 200U of CAT+100 µM ABA; 100 µM DPI+H2O; 100 µM DPI+100 µM ABA. The detached plants were pre-treated with scavengers or inhibitor for 4h then exposed to 100 µM ABA treatment for 30min. (D) Effects of an NO scavenger or inhibitor on H2O2-activated ZmCCaMK. The detached plants were treated as follows: distilled water (control); 10mM H2O2; 200 µM cPTIO+H2O; 200 µM cPTIO+10mM H2O2; 200 µM l-NAME+H2O; 200 µM l-NAME+10mM H2O2. The detached plants were pre-treated with scavengers or inhibitors for 4h then exposed to 10mM H2O2 treatment for 45min. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

H2O2 is involved in the ABA-induced activation of ZmCCaMK and the activation is mediated by NO. (A) Time course of H2O2-induced ZmCCaMK activation. The detached plants were treated with 10mM H2O2 for various times as indicated. Protein extracts from control or H2O2-treated leaves were immunoprecipitated with ZmCCaMK antibody and then subjected to an in-gel kinase assay. (B) Time course of H2O2-induced gene expression of ZmCCaMK. The detached plants were treated as described in A. Relative expression levels of the ZmCCaMK gene, analysed by qRT-PCR, are normalized to β-actin transcript levels. (C) Effects of H2O2 scavengers or an inhibitor on ABA-activated ZmCCaMK. The detached plants were treated as follows: distilled water (control); 100 µM ABA; 10mM DMTU+H2O; 10mM DMTU+100 µM ABA; 200U of CAT+H2O; 200U of CAT+100 µM ABA; 100 µM DPI+H2O; 100 µM DPI+100 µM ABA. The detached plants were pre-treated with scavengers or inhibitor for 4h then exposed to 100 µM ABA treatment for 30min. (D) Effects of an NO scavenger or inhibitor on H2O2-activated ZmCCaMK. The detached plants were treated as follows: distilled water (control); 10mM H2O2; 200 µM cPTIO+H2O; 200 µM cPTIO+10mM H2O2; 200 µM l-NAME+H2O; 200 µM l-NAME+10mM H2O2. The detached plants were pre-treated with scavengers or inhibitors for 4h then exposed to 10mM H2O2 treatment for 45min. Values are means ±SE of three different experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test.

Discussion

In animal cells, CaMKs have been shown to be involved in H2O2 signal transduction that results in the regulation of various cellular processes (Nguyen ; Bouallegue ; Palomeque ). In plants, CCaMKs have high homology to mammalian CaMKs in both the kinase and CaM-binding domains (Yang ) and are thought to function in a manner analogous to CaMKII (Mitra ; Yang ). It has been well documented that CCaMKs play important roles in mediating symbiotic relationships with bacteria and fungi (Lévy ; Godfroy ; Tirichine ; Chen , 2008; Capoen ; Hayashi ; Kang ). CCaMKs were also suggested to play roles in meiosis and mitosis (Yang and Poovaiah, 2003) and in abiotic stress responses (Yang ). CCaMKs were obviously regulated at the transcriptional level by ABA, NaCl, or PEG treatment (Yang ). However, it is not clear whether CCaMKs are involved in oxidative stress responses in plants as CaMKs are in animals. In the present study, the results showed that ABA treatment induced the expression of ZmCCaMK and the activity of ZmCCaMK in leaves of maize plants (Fig. 1A, B, D) and in maize mesophyll protoplasts (Fig. 4B, C). Water stress-induced endogenous ABA also increased the activity of ZmCCaMK (Fig. 1C). These results suggest that ZmCCaMK is very likely to participate in ABA signalling as reported by Yang . To investigate further the involvement of ZmCCaMK in ABA signalling, the role of ZmCCaMK in ABA-induced antioxidant defence was investigated by means of transient overexpression or transient silencing of ZmCCaMK in maize mesophyll protoplasts. Transiently expressing ZmCCaMK in maize mesophyll protoplasts significantly enhanced the activities of SOD and APX (Fig. 3). In contrast, the activities of SOD and APX were reduced in the protoplasts transfected with dsRNA against ZmCCaMK (Fig. 4). More importantly, ABA treatment failed to induce an increase in the activities of SOD and APX in the protoplasts transfected with dsRNA against ZmCCaMK, although ABA treatment significantly increased the activities of SOD and APX in the control protoplasts (Fig. 4). These results provide conclusive evidence that ZmCCaMK is required for the enhancement of ABA-induced antioxidant defence. Furthermore, in a rice mutant of OsCCaMK (OsDMI3), a gene homologous to ZmCCaMK in rice, ABA treatment was also not able to induce the increases in the activities of these antioxidant enzymes in the leaves of rice (unpublished data). These data clearly indicate that ZmCCaMK and its orthologue in rice play an important role in the ABA-induced antioxidant defence. However, a recent study showed that in wheat, the expression of TaCCaMK, which is closely related to maize ZmCCaMK and rice OsCCaMK, was down-regulated by ABA, as well as NaCl and PEG treatments in wheat seedlings roots (Yang ). Overexpression of TaCCaMK in Arabidopsis reduced ABA sensitivity in seed germination and enhanced the seed germination rate under high-salt conditions. These results suggest that TaCCaMK is, as a negative regulator for ABA signalling, involved in abiotic stress responses in wheat. The conclusion seems to be in contrast to the conclusion of this study. There exist several explanations for the discrepancy. In the study by Yang , the expression of TaCCaMK in wheat roots exposed to ABA, NaCl, and PEG treatments was analysed over a 3h period, and a transient change in the expression of TaCCaMK at times >3h was not analysed. In the present study, ABA treatment induced a significant increase in the expression of ZmCCaMK within 20min (Fig. 1B). The expression of ZmCCaMK reached the maximum after 30min of ABA treatment, and then decreased to the control level within 60min of ABA treatment. After 2h of ABA treatment, the expression of ZmCCaMK induced by ABA was significantly lower than that in the control. Moreover, CCaMK does not exist in the Arabidopsis genome (Harper ; DeFalco ). Overexpression of TaCCaMK in Arabidopsis could interfere with the function of Ca2+ sensors in Arabidopsis. The phenotypes of transgenic plants that reduced ABA sensitivity in seed germination and enhanced the seed germination rate under high-salt conditions might be not from the direct role of TaCCaMK. Another possibility is that the difference between the study by Yang and the present study may be related to the different physiological process. It is also possible that different plant species or organs have different responses to ABA. In Medicago trunculata, CCaMK (DMI3) was localized in the nucleus in epidermal root cells and root hairy cells (Kaló ; Smit ). However, in Triticum aestivum, TaCCaMK with a 3′ end green fluorescent protein (GFP) fusion has been shown to be located both on the plasma membrane and in the nucleus (Yang ). In this study, transient expression of YFP-ZmCCaMK revealed that the fluorescence of this construct was detected in the nucleus, the cytoplasm, and the plasma membrane in maize protoplasts (Fig. 2). The fluorescence of OsDMI3–YFP was also detected in the nucleus, the cytoplasm, and the plasma membrane in rice protoplasts that were transformed with an OsDMI3-YFP fusion construct under the control of the 35S promoter or the OsDMI3 native promoter (unpublished data). These results suggest that ZmCCaMK is located not only in the nucleus, but also in the cytosol and the plasma membrane. Different subcellular localizations of CCaMKs may be related to their distinct functions in plants. Previous studies showed that ABA-induced NO production up-regulated the expression and the activities of antioxidant enzymes in ABA signalling, and there exists a cross-talk mechanism between Ca2+/CaM and NO in ABA-induced antioxidant defence in maize leaves (Jiang and Zhang, 2003; Zhang ; Sang ). To investigate further the mechanisms of ZmCCaMK in ABA-induced antioxidant defence, the relationship between NO and ZmCCaMK was studied. The results showed that treatment with the NO donor SNP induced an increase in the activity of ZmCCaMK and the expression of ZmCCaMK in maize leaves (Fig. 5A–C), and pre-treatment with an NO scavenger or inhibitor substantially reduced the ABA-induced increases in the activity and the transcription level of ZmCCaMK (Fig. 5D, E). These results suggest that NO is involved in the activation of ZmCCaMK in ABA signalling. Conversely, the expression of ZmCCaMK was down-regulated through RNAi to investigate the effects of ZmCCaMK on the production of NO. The results showed that the RNAi silencing of ZmCCaMK in maize protoplasts did not block the ABA-induced increase in the production of NO (Fig. 6). Similarly, the mutant of OsDMI3, a homologous gene of ZmCCaMK in rice, also did not affect the ABA-induced increase in the production of NO within 4h of ABA treatment (Fig. 7). These results provide conclusive evidence that NO is required for the ABA-induced up-regulation in the expression and the activity of ZmCCaMK, and ZmCCaMK does not mediate the ABA-induced NO production in maize leaves. ROS have also been demonstrated to be important signal transduction molecules (Miller , 2010; Mittler ). In ABA signalling, ROS play an important role in the regulation of stomatal closure, stress survival, and growth processes (Neill ; Mittler ). It has been well established that H2O2 induces NO synthesis and accumulation in ABA signalling, and the ABAH2O2–NO cascade is involved in ABA-induced stomatal closure (Bright ; Neill ) and antioxidant defence (Zhang ). However, it is not clear whether the ABAH2O2–NO cascade is involved in the ABA-induced activation of ZmCCaMK in ABA signalling. In this study, H2O2 treatment obviously induced increases in the activity of ZmCCaMK and gene expression of ZmCCaMK (Fig. 8A, B). Pre-treatments with H2O2 scavengers or inhibitor significantly blocked the ABA-induced activation of ZmCCaMK and the gene expression of ZmCCaMK (Figs 5E, 8C). These results suggest that ABA-induced H2O2 production is required for the ABA-induced activation of ZmCCaMK. A previous study showed that exogenous H2O2 and ABA-induced H2O2 could increase the accumulation of NO in leaves of maize plants (Zhang ). Furthermore, in the present study, pre-treatments with an NO scavenger and inhibitor inhibited the H2O2-induced increase in the activity of ZmCCaMK (Fig. 8D). All these data suggest that the H2O2-NO pathway is involved in ABA-induced activation of ZmCCaMK. In conclusion, the present data indicate that ZmCCaMK is required for ABA-induced antioxidant defence in maize leaves. ABA-induced NO production mediated by H2O2 activates ZmCCaMK, thus resulting in the up-regulation of the expression and the activities of antioxidant enzymes in ABA signalling.
  58 in total

Review 1.  Signal transduction in maize and Arabidopsis mesophyll protoplasts.

Authors:  J Sheen
Journal:  Plant Physiol       Date:  2001-12       Impact factor: 8.340

2.  A novel interaction between CCaMK and a protein containing the Scythe_N ubiquitin-like domain in Lotus japonicus.

Authors:  Heng Kang; Hui Zhu; Xiaojie Chu; Zhenzhen Yang; Songli Yuan; Dunqiang Yu; Chao Wang; Zonglie Hong; Zhongming Zhang
Journal:  Plant Physiol       Date:  2011-01-05       Impact factor: 8.340

3.  Nodulation signaling in legumes requires NSP2, a member of the GRAS family of transcriptional regulators.

Authors:  Péter Kaló; Cynthia Gleason; Anne Edwards; John Marsh; Raka M Mitra; Sibylle Hirsch; Júlia Jakab; Sarah Sims; Sharon R Long; Jane Rogers; György B Kiss; J Allan Downie; Giles E D Oldroyd
Journal:  Science       Date:  2005-06-17       Impact factor: 47.728

Review 4.  ROS signaling: the new wave?

Authors:  Ron Mittler; Sandy Vanderauwera; Nobuhiro Suzuki; Gad Miller; Vanesa B Tognetti; Klaas Vandepoele; Marty Gollery; Vladimir Shulaev; Frank Van Breusegem
Journal:  Trends Plant Sci       Date:  2011-04-07       Impact factor: 18.313

5.  Dual regulation of a chimeric plant serine/threonine kinase by calcium and calcium/calmodulin.

Authors:  D Takezawa; S Ramachandiran; V Paranjape; B W Poovaiah
Journal:  J Biol Chem       Date:  1996-04-05       Impact factor: 5.157

6.  Effect of abscisic acid on active oxygen species, antioxidative defence system and oxidative damage in leaves of maize seedlings.

Authors:  M Jiang; J Zhang
Journal:  Plant Cell Physiol       Date:  2001-11       Impact factor: 4.927

Review 7.  Reactive oxygen signaling and abiotic stress.

Authors:  Gad Miller; Vladimir Shulaev; Ron Mittler
Journal:  Physiol Plant       Date:  2008-07-01       Impact factor: 4.500

8.  A dominant function of CCaMK in intracellular accommodation of bacterial and fungal endosymbionts.

Authors:  Teruyuki Hayashi; Mari Banba; Yoshikazu Shimoda; Hiroshi Kouchi; Makoto Hayashi; Haruko Imaizumi-Anraku
Journal:  Plant J       Date:  2010-04-16       Impact factor: 6.417

9.  OsIPD3, an ortholog of the Medicago truncatula DMI3 interacting protein IPD3, is required for mycorrhizal symbiosis in rice.

Authors:  Caiyan Chen; Jean-Michel Ané; Hongyan Zhu
Journal:  New Phytol       Date:  2008-08-29       Impact factor: 10.151

10.  Molecular cloning of a cytosolic ascorbate peroxidase cDNA from cell cultures of sweet potato and its expression in response to stress.

Authors:  S-Y Park; S-H Ryu; I-C Jang; S-Y Kwon; J-G Kim; S-S Kwak
Journal:  Mol Genet Genomics       Date:  2004-02-17       Impact factor: 3.291

View more
  28 in total

Review 1.  Recent advances in calcium/calmodulin-mediated signaling with an emphasis on plant-microbe interactions.

Authors:  B W Poovaiah; Liqun Du; Huizhong Wang; Tianbao Yang
Journal:  Plant Physiol       Date:  2013-09-06       Impact factor: 8.340

2.  Abscisic Acid Inhibits Rice Protein Phosphatase PP45 via H2O2 and Relieves Repression of the Ca2+/CaM-Dependent Protein Kinase DMI3.

Authors:  Lan Ni; Xiaopu Fu; Huan Zhang; Xi Li; Xiang Cai; Panpan Zhang; Lei Liu; Qingwen Wang; Manman Sun; Qian-Wen Wang; Aying Zhang; Zhengguang Zhang; Mingyi Jiang
Journal:  Plant Cell       Date:  2018-12-11       Impact factor: 11.277

3.  Biochemical basis of improvement of defense in tomato plant against Fusarium wilt by CaCl2.

Authors:  Nilanjan Chakraborty; Swarnendu Chandra; Krishnendu Acharya
Journal:  Physiol Mol Biol Plants       Date:  2017-06-06

Review 4.  Crosstalk between abscisic acid and nitric oxide under heat stress: exploring new vantage points.

Authors:  Noushina Iqbal; Shahid Umar; Nafees A Khan; Francisco J Corpas
Journal:  Plant Cell Rep       Date:  2021-04-28       Impact factor: 4.570

5.  Phosphorylation of a NAC Transcription Factor by a Calcium/Calmodulin-Dependent Protein Kinase Regulates Abscisic Acid-Induced Antioxidant Defense in Maize.

Authors:  Yuan Zhu; Jingwei Yan; Weijuan Liu; Lei Liu; Yu Sheng; Yue Sun; Yanyun Li; Henrik Vibe Scheller; Mingyi Jiang; Xilin Hou; Lan Ni; Aying Zhang
Journal:  Plant Physiol       Date:  2016-05-10       Impact factor: 8.340

Review 6.  Nitrogen metabolism in plants under low oxygen stress.

Authors:  Anis M Limami; Houssein Diab; Jérémy Lothier
Journal:  Planta       Date:  2013-12-27       Impact factor: 4.116

Review 7.  Redox regulation in plant immune function.

Authors:  Debra E Frederickson Matika; Gary J Loake
Journal:  Antioxid Redox Signal       Date:  2014-02-04       Impact factor: 8.401

8.  Rice calcium/calmodulin-dependent protein kinase directly phosphorylates a mitogen-activated protein kinase kinase to regulate abscisic acid responses.

Authors:  Min Chen; Lan Ni; Jing Chen; Manman Sun; Caihua Qin; Gang Zhang; Aying Zhang; Mingyi Jiang
Journal:  Plant Cell       Date:  2021-07-02       Impact factor: 11.277

9.  Nitric oxide acts downstream of abscisic acid in molybdenum-induced oxidative tolerance in wheat.

Authors:  Songwei Wu; Chengxiao Hu; Qiling Tan; Xiaohu Zhao; Shoujun Xu; Yitao Xia; Xuecheng Sun
Journal:  Plant Cell Rep       Date:  2018-01-16       Impact factor: 4.570

10.  ZmCPK11 is involved in abscisic acid-induced antioxidant defence and functions upstream of ZmMPK5 in abscisic acid signalling in maize.

Authors:  Yanfen Ding; Jianmei Cao; Lan Ni; Yuan Zhu; Aying Zhang; Mingpu Tan; Mingyi Jiang
Journal:  J Exp Bot       Date:  2012-12-26       Impact factor: 6.992

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.