| Literature DB >> 22754330 |
Fuliang Cao1,2, Hua Cheng1,2,3, Shuiyuan Cheng1,2,3, Linling Li1,3, Feng Xu1, Wanwen Yu2, Honghui Yuan3.
Abstract
Heat shock proteins (HSPs) play various stress-protective roles in plants. In this study, three HSP genes were isolated from a suppression subtractive hybridization (SSH) cDNA library of Ginkgo biloba leaves treated with cold stress. Based on the molecular weight, the three genes were designated GbHSP16.8, GbHSP17 and GbHSP70. The full length of the three genes were predicted to encode three polypeptide chains containing 149 amino acids (Aa), 152 Aa, and 657 Aa, and their corresponding molecular weights were predicted as follows: 16.67 kDa, 17.39 kDa, and 71.81 kDa respectively. The three genes exhibited distinctive expression patterns in different organs or development stages. GbHSP16.8 and GbHSP70 showed high expression levels in leaves and a low level in gynoecia, GbHSP17 showed a higher transcription in stamens and lower level in fruit. This result indicates that GbHSP16.8 and GbHSP70 may play important roles in Ginkgo leaf development and photosynthesis, and GbHSP17 may play a positive role in pollen maturation. All three GbHSPs were up-regulated under cold stress, whereas extreme heat stress only caused up-regulation of GbHSP70, UV-B treatment resulted in up-regulation of GbHSP16.8 and GbHSP17, wounding treatment resulted in up-regulation of GbHSP16.8 and GbHSP70, and abscisic acid (ABA) treatment caused up-regulation of GbHSP70 primarily.Entities:
Keywords: Ginkgo biloba; SSH; abiotic stress; cold stress; heat shock proteins; heat stress
Mesh:
Substances:
Year: 2012 PMID: 22754330 PMCID: PMC3382825 DOI: 10.3390/ijms13055768
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 6.208
Figure 1Protein sequence alignment of Ginkgo heat shock protein (HSP) with other HSPs. Two consensus regions are underlined and a putative nuclear localization signal is indicated by asterisks. A polyproline motif at the carboxyl end of proteins is boxed. Following the aligned sequences is the accession numbers and homology percentage. (a) HSP 16.8; (b) HSP 17, (c) HSP 70.
Figure 2Gene tree of the three Ginkgo biloba HSPs. Gene trees were constructed using the software Molecular Evolutionary Genetics Analysis (MEGA) Version 4.0 by the neighbor-joining method with pairwise deletion and the poisson correction model. Bootstrap support values for each node are shown (percentage of bootstrap trees supporting the node, out of 1000 trees). Accession numbers for all sequences are as listed here. Hsp16.8 family: Arabidopsis thaliana CAA61675, Arachis hypogaea ACF74271, Carica papaya AAP73794, Citrus unshiu BAK61844, Picea glauca AAB01561, Picea sitchensis ACN40780, Picea sitchensis(2) ABK26390, Prunus salicina ACV93250, Triticum aestivum AAK51797, Ipomoea nil AAB39335, Vitis vinifera XP 2280485, Agave tequilana ABF61870, Funaria hygrometrica CAC81966, Ricinus communis, XP 2516106; HSP17 family: Agave tequilana ABF61868, Arabidopsis thaliana AAM67156, Capsicum frutescens AAQ19680, Carica papaya AAR25848, Gossypium hirsutum ABW89468, Medicago truncatula AES90474, Medicago truncatula(2) AES75921, Nicotiana tabacum ADK36668, Picea sitchensis ABK21289, Populus trichocarpa EEE89499, Prunus persica AAR99375, Prunus salicina, ACV93249, Pseudotsuga menziesii CAA63570; HSP70 family: Brachypodium distachyon XP 3558228, Hordeum vulgare BAJ86014, Populus trichocarpa EEE71403, Populus trichocarpa EEE71404, Camellia sinensis ACD93209, Picea sitchensis ABR18415, Nicotiana tabacum AAR17080, Vigna radiata AAS57912, Glycine max XP 3521330, Petunia hybrida CAA30018, Cyclamen persicum ABP35942, Spinacia oleracea AAB88132, Vitis vinifera CAN81694, Cucurbita maxima AAN86274, Gossypium hirsutum ACJ11741, Ricinus communis EEF34649.
Figure 3Analysis of QRT-PCR for tissue-specific transcription of GbHSP accumulation after 2 h heat shock.
Figure 4Under different stress temperatures, mRNA expression levels of the three GbHSPs were analyzed by real-time quantitative RT-PCR, G. biloba GAPDH gene was used as the internal control. Relative expression levels are shown for: (a) The relative expression levels of GbHSP16.8 at different times after stress induction. (b) The relative expression levels of GbHSP17 at different times after stress induction. (c) GbHSP70 genes expression levels.
Figure 5Real-time PCR analysis of the relative expression levels of the GbHSP genes in Ginkgo biloba under abiotic stress treatment. The G. biloba GAPDH gene was used as an internal control. The bars are means of the relative fold change of three biological and two technical replicates obtained by real-time RT-PCR. The standard errors of the biological replicates are shown as error bars. Relative expression levels are shown for (a) UV-B treatment, (b) wounding treatment and (c) ABA treatment.
Primers used in the present study.
| Primer | Sequence (5′–3′) | Description |
|---|---|---|
| H70R5 | TGTTCCGCATGTTGTAGGCATAGTT | Reverse primer for 5′RACE, outer |
| H70R3 | CTATTCCCACAAAGAAAGAGCAGGTT | Forward primer for 3′RACE, outer |
| H17R5 | GGTTTAGGTTCAGGTTGTTTAGGCAC | Reverse primer for 5′RACE, outer |
| H17R3 | CCAGGTTTGAAGAAAGAGGAGGTTA | Forward primer for 3′RACE, outer |
| H16R5 | TGCCGACTCTTCGCTCCATTCTTAT | Reverse primer for 5′RACE, outer |
| H16R3 | TAAGAATGGAGCGAAGAGTCGGCAAAT | Forward primer for 3′RACE, outer |
| H70N5 | CTTTGTGGGAATAGTAGTGTTT | Reverse primer for 5′RACE, nested |
| H70N3 | ATGGCATCCTTAATGTCTCA | Forward primer for 3′RACE, nested |
| H17N5 | CGATGCCATTTGTCATTCTT | Reverse primer for 5′RACE, nested |
| H17N3 | CCTGAGAATGCCAAGGTAGA | Forward primer for 3′RACE, nested |
| H16N5 | GCTTTCTCATCTCGCTTTCG | Reverse primer for 5′RACE, nested |
| H16N3 | CGTTACGGTTCCCAAGATTC | Forward primer for 3′RACE, nested |
| H70T1 | ACCAATGACAAGGGTAGG | Primer for QRT-PCR, forward |
| H70T2 | TGTAGGCATAGTTCTCCAAT | Primer for QRT-PCR, reverse |
| H17T1 | CTCACATCTTCAAGGCTGATC | Primer for QRT-PCR, forward |
| H17T2 | CTTCTTCTTTGCTGCGTTCT | Primer for QRT-PCR, reverse |
| H16T1 | GAGCGAAGAGTCGGCAAATT | Primer for QRT-PCR, forward |
| H16T2 | TAGCACGCCATCGTAACACG | Primer for QRT-PCR, reverse |
| GAPU | TGTCACGGTTTTCGGTTGTAG | Control Primer for QRT-PCR, forward |
| GAPD | ACCTTTTTGGCACCTCCCTTA | Control Primer for QRT-PCR, reverse |