Oligodendroglia are limited in type I interferon induction and responsiveness in vivo.

Type I interferons (IFNα/β) provide a primary defense against infection. Nevertheless, the dynamics of IFNα/β induction and responsiveness by central nervous system (CNS) resident cells in vivo in response to viral infections are poorly understood. Mice were infected with a neurotropic coronavirus with tropism for oligodendroglia and microglia to probe innate antiviral responses during acute encephalomyelitis. Expression of genes associated with the IFNα/β pathways was monitored in microglia and oligodendroglia purified from naïve and infected mice by fluorescent activated cell sorting. Compared with microglia, oligodendroglia were characterized by low basal expression of mRNA encoding viral RNA sensing pattern recognition receptors (PRRs), IFNα/β receptor chains, interferon sensitive genes (ISG), as well as kinases and transcription factors critical in IFNα/β signaling. Although PRRs and ISGs were upregulated by infection in both cell types, the repertoire and absolute mRNA levels were more limited in oligodendroglia. Furthermore, although oligodendroglia harbored higher levels of viral RNA compared with microglia, Ifnα/β was only induced in microglia. Stimulation with the double stranded RNA analogue poly I:C also failed to induce Ifnα/β in oligodendroglia, and resulted in reduced and delayed induction of ISGs compared with microglia. The limited antiviral response by oligodendroglia was associated with a high threshold for upregulation of Ikkε and Irf7 transcripts, both central to amplifying IFNα/β responses. Overall, these data reveal that oligodendroglia from the adult CNS are poor sensors of viral infection and suggest they require exogenous IFNα/β to establish an antiviral state.

INTRODUCTION

Type I interferons (IFNα/β) are critical innate cytokines that limit viral replication and dissemination prior to the emergence of adaptive immune responses. In addition to inducing an antiviral state, IFNα/β exert numerous other functions including induction of apoptosis, mobilizing innate cells, and regulating adaptive immune responses (Barton,2008; Borden et al.,2007; Stetson and Medzhitov,2006; Vilcek,2006). As these pleiotropic effects can be detrimental if left unregulated, the innate antiviral response has to be controlled to minimize cell injury and maintain cellular homeostatic functions. Although an early IFNα/β response contributes to viral control and disease outcome, its precise regulation is especially critical in the central nervous system (CNS), where the health of nonrenewable neurons as well as resident glia is vital for the maintenance of host physiological function. IFNα/β production and signaling is thus tightly regulated by both the basal and inducible expression of numerous factors involved in the IFNα/β pathway.

During viral infections the ability to induce IFNα/β is determined by activation of pattern recognition receptors (PRR) following interaction with pathogen associated molecular patterns, which typically constitute viral RNA or DNA structures. PRRs comprise members of the Toll‐like receptor (TLR) family and the cytosolic helicase sensors, retinoic acid‐inducible gene 1 (RIG‐I), and melanoma differentiation‐associated antigen 5 (MDA5) (Kawai and Akira,2009; Mogensen,2009). PRR recognition of viral RNA triggers the activation and nuclear localization of interferon regulatory factors (IRF) IRF3 and IRF7 leading to IFNα/β induction. By binding to its receptor, secreted IFNα/β initiates a signaling cascade leading to transcription of a variety of interferon stimulated genes (ISG). ISG encode both direct antiviral factors as well as PRR and signal transduction components, such as IRF7 and STAT1 (Borden et al.,2007). This amplification loop thus elevates the ability of cells to induce and respond to IFNα/β. In general IRF7 is considered the master switch in IFNα/β induction following various viral infections due to its role in amplifying IFNα/β production (Honda and Taniguchi,2006). Because the pattern as well as levels of PRR, IRF, and IFNα/β receptor expression and activation varies with each cell type, initial IFNα/β induction and amplification can be very distinct depending on the cell types infected (Colonna,2007; Stewart et al.,2005). Furthermore, due to the potency of IFNα/β in inhibiting viral replication, many viruses have evolved mechanisms to antagonize the IFNα/β pathway, either at the induction or signaling level (Levy and Garcia‐Sastre,2001; Sen,2001). Microglia and astrocytes are primary sentinels within the CNS parenchyma responding to stimuli triggered by either microbial infection or degenerative events (Dong and Benveniste,2001; Hanisch,2002; Paul et al.,2007). This function is partially attributed to basal expression of a vast array of PRRs (Bsibsi et al.,2002; Carty and Bowie,2011; Hanke and Kielian,2011; Okun et al.,2009; van Noort and Bsibsi,2009). Irf3 mRNA, and to a lesser extent Irf7 mRNA, are constitutively expressed in the CNS. While Irf7 expression is highly inducible, Irf3 transcripts remain constant following infection (Ousman et al.,2005). However, their relative expression in different cell types has not been extensively explored. Consistent with PRR activation, microglia, astrocytes, and neurons all induce IFNα/β (Paul et al.,2007). However, the vast majority of information on CNS innate responsiveness is derived from primary glia and neuronal cultures established from neonates and may not reflect responsiveness of fully differentiated cells. Distinct from in vitro studies, IFNα/β production in vivo is highly restricted as indicated by the small proportion (<5%) of infected neurons with detectable IFNα/β expression in mice infected with lymphocytic choriomeningitis virus (Delhaye et al.,2006). Furthermore, IFNα/β inducible Irf7 transcripts mapped closely to sites of viral RNA (Ousman et al.,2005), supporting highly focal IFNα/β responses. Overall however, little is known about responsiveness of distinct CNS cell types to viral infections in vivo. Specifically oligodendroglia appear to express a limited TLR repertoire at basal levels compared with microglia (Hanke and Kielian,2011; Okun et al.,2009; Paul et al.,2007). They also do not appear to contribute to extensive proinflammatory cytokine secretion (Cannella and Raine,2004).

Infection with the neurotropic mouse hepatitis virus (MHV) strain JHM (JHMV), belonging to the positive strand RNA coronavirus family, was used to better characterize the ability of oligodendroglia to mount innate antiviral immune responses in vivo based on its prominent infection and persistence in oligodendroglia (Bergmann et al.,2006). In adult mice, JHMV infection causes an acute encephalomyelitis, which resolves into a persistent infection of the spinal cord associated with demyelination. In addition to oligodendroglia, JHMV also infects microglia and infiltrating macrophages during acute infection; however, neuronal and astrocyte infection is sparse (Ireland et al.,2008, 2009). Coronaviruses are poor inducers of IFNα/β in numerous cell types due to their 5′RNA structures mimicking self RNA (Daffis et al.,2010; Zust et al.,2011). However, IFNα/β is induced in microglia, macrophages, and plasmacytoid dendritic cells (Cervantes‐Barragan et al.,2007; Roth‐Cross et al.,2008). Importantly, a protective effect of IFNα/β in vivo was highlighted by uncontrolled MHV replication in mice deficient in IFNα/β signaling (Cervantes‐Barragan et al.,2007; Ireland et al.,2008). Furthermore, protection following peripheral MHV infection is associated with TLR7 dependent IFNα/β production by plasmacytoid dendritic cells (Cervantes‐Barragan et al.,2007). The naïve CNS is devoid of plasmacytoid dendritic cells (Serafini et al.,2000), implicating infected glia as primary candidates contributing to protective IFNα/β production following CNS infection. This is supported by MDA5 mediated IFNα/β production in infected microglia (Roth‐Cross et al.,2008).

In the present study we compared the relative IFNα/β responsiveness of oligodendroglia and microglia following infection with JHMV or intracerebral inoculation of the double stranded RNA mimic poly I:C. Both glia populations were isolated directly from the CNS to monitor changes in mRNA expression. These results are the first to imply an inherent paucity in IFNα/β transcription by oligodendroglia, coincident with limited expression of PRR and signaling molecules downstream of PRR activation. The dependence of oligodendroglia on IFNα/β from other cellular sources to induce an antiviral state in vivo highlight the potent monitoring functions of microglia and suggest a mechanism to preserve oligodendroglial homeostatic functions.

MATERIALS AND METHODS

Mice, Virus, and Poly I:C Injection

C57BL/6 wild type (Wt) mice were purchased from the National Cancer Institute (Frederick, MD). Mice expressing green fluorescent protein (GFP) under the control of the proteolipid protein (PLP) promoter (PLP‐GFP) (Fuss et al.,2000) were backcrossed six times with C57BL/6 mice prior to use (Malone et al.,2008). Congenic mice defective in IFNα/β signaling (IFNAR−/−) were previously described (Ireland et al.,2008). Mice at 6–7 weeks of age were infected via intracerebral injection with 250 Plaque Forming Units of the neutralizing monoclonal antibody (mAb)‐derived JHMV variant, designated V2.2v‐1 (Fleming et al.,1986) in 30 μL of endotoxin‐free Dulbecco's modified phosphate‐buffered saline (PBS). In some experiments, the double stranded RNA mimic poly I:C (Invitrogen, Carlsbad, CA; high molecular weight) was injected intracerebrally into 6‐ to 7‐week‐old C57BL/6 mice at a concentration of 200 μg in 30 μL endotoxin‐free PBS. All mice were housed and bred under pathogen‐free conditions at an accredited facility at the Lerner Research Institute, Cleveland Clinic. All procedures were in compliance with animal protocols approved by the Institutional Animal Care and Use Committee.

CNS Cell Isolation by Fluorescent Activated Cell Sorting (FACS) and Ex Vivo Poly I:C Treatment

Mononuclear cells were isolated from spinal cords as described previously (Malone et al.,2008; Phares et al.,2009). Briefly, spinal cords from six to seven mice were finely minced, digested in PBS containing 0.25% trypsin for 30 min at 37°C, and trypsin quenched by addition of 20% new born calf serum. Following centrifugation at 400g for 7 min, cells were resuspended in 30% Percoll (Pharmacia, Uppsala, Sweden) and concentrated by centrifugation for 30 min at 800g at 4°C onto a 1 mL 70% Percoll cushion. Cells collected from the 30%/70% Percoll interface were washed with RPMI medium containing 25 mM HEPES (pH 7.2), viable cells determined by trypan blue exclusion, and incubated in PBS supplemented with 5% Bovine Serum Albumin (BSA) (1× FACS buffer), 1% mouse serum and anti‐mouse CD16/32 (clone 2.4G2; BD Pharmingen, San Diego, CA) for 15 min at 4°C to block nonspecific antibody binding. Cell populations were identified by four‐color staining with phycoerythrin (PE)‐, fluorescein isothiocyanate‐, peridinin chlorophyll protein‐, or allophycocyanin‐conjugated mAb. CNS infiltrating macrophages and resident microglia were distinguished by staining with anti‐CD45 (30‐F11), and anti‐F4/80 mAb (Serotec, Raleigh, NJ). Infiltrating macrophages were characterized by their CD45hi F4/80+ and microglia by their CD45low F4/80+ phenotype, respectively. PLP‐GFP transgenic mice facilitated identification of oligodendroglia via their CD45− GFP+ phenotype (Malone et al.,2008). Oligodendroglia from IFNAR−/− and Wt control mice were identified by consecutive staining with unconjugated O4 mAb and anti‐mouse IgM (PE) mAb (R6‐60.2) (BD Pharmingen) and purified based on their CD45− O4+ phenotype as described (Gonzalez et al.,2005; Phares et al.,2011). Cells were purified on a BD FACSAria (BD Biosciences), resuspended in TRIzol (Invitrogen, Carlsbad, CA) and stored at −80°C. Typical yields for six to seven naïve spinal cords were 4–8 × 104 oligodendroglia and 4–6 × 105 microglia. For ex vivo poly I:C stimulation, FACS sorted microglia and oligodendroglia were incubated with 10 μg mL−1 poly I:C alone or together with the FuGENE 6 transfection reagent (Roche diagnostics, Indianapolis, IN) in DMEM for 8 h following the manufacturer's protocol. Fetal calf serum was added to a final concentration of 5% after 1 h.

Quantitative Real‐time PCR

RNA was extracted by dissociation in TRIzol reagent (Invitrogen) according to the manufacturer's instructions and subjected to real‐time PCR analysis as described (Phares et al.,2011). In brief, snap‐frozen spinal cords or FACS‐purified cells were homogenized with TRIzol in a Tissuelyser II (Qiagen, Valencia, CA) or by pipetting, respectively, and treated with chloroform. RNA was precipitated with isopropyl alcohol, washed with 75% ethanol, and resuspended in RNase‐free water (Gibco/Invitrogen, Grand Island, NY). Following DNAse treatment using a DNA Free™ kit (Ambion, Austin, TX) cDNA was synthesized using Moloney murine leukemia virus reverse transcriptase (Invitrogen) in buffer containing 10 mM deoxynucleoside triphosphate mix, 250 ng random hexamer primers and oligo(dT) (1:1 ratio) (Invitrogen). Quantitative real‐time PCR was performed for mRNA expression levels of IFNAR receptor chains, IKKε, virus‐nucleocapsid (N) protein, MDA5, RIG‐I and IFNλ using SYBR green master mix (Applied Biosystems, Foster city, CA). The primer sequences are as follows (F, forward; R, reverse): IFNAR1, F,5′‐CCCAAGGCAAGAGCTATGTC‐3′, and R,5′‐TCTGAACGGCTTCCAGAACT‐3′; IFNAR2a (soluble), F,5′‐GATGATGACCCCGCAATAAA‐3′, and R,5′‐AAAACAATAGTGCAAATTTTAAAAACC‐3′; IFNAR2c (transmembrane), F,5′‐GGCAGTGACAGTGACGAAGA‐3′, and R,5′‐CTGGCTGAGGTGTCAGAGGT‐3′; IKKε, F,5′‐CCAGAAGATTCAGTGTTGTTTGG‐3′, and R,5′‐TCATTGTAGCTGAGCCCTG‐3′; JHMV‐N, F,5′‐CGCAGAGTATGGCGACGAT‐3′, and R,5′‐GAGGTCC TAGTCTCGGCCTGTT‐3′; MDA5, F,5′‐GACACCAGAATT CAAGGGAC‐3′, and R,5′‐GCCACACTTGCAGA TAATCTC‐3′; RIG‐I, F,5′‐GTCAGCACAAACCACAACC‐3′, and R,5′‐GTCTCAACCACTCGAATGTC‐3′; IFNλ, F,5′‐AGCTGCAGGCCTTCAAAAAG‐3′, and R,5′‐TGGGAGTGAATGTGGCTCAG‐3′. Reactions were monitored using the 7500 Fast Real Time PCR system (Applied Biosystems) under the following conditions: 95°C for 10 min, followed by 40 cycles of denaturation at 94°C for 10 s, annealing at 60°C for 30 s, and elongation at 72°C for 30 s. Expression levels of Adar1, Gapdh, Ifna4, Ifnβ, Ifit1, Ifit2, Irf3, Irf7, Irf9, Stat1, Tlr3, and Tlr7 were determined by using TaqMan primer and probe sets, and 2× universal TaqMan fast master mix (Applied Biosystems). TaqMan PCR reactions were performed in 10 μL final reaction volumes containing specific master mix, 1 mM concentrations of each primer mix, and 4 μL of cDNA using the ABI 7500 fast PCR and 7500 software. All TaqMan reactions were initiated by incubation at 95°C for 20 s, followed by 40 cycles of denaturation at 95°C for 30 s and annealing and extension at 60°C for 30 s. Transcript levels for both SYBR and Taqman assays were calculated relative to the housekeeping gene glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) using the following formula: 2[CT(GAPDH) – CT(Target Gene)] × 1,000, where CT represents the threshold cycle at which the fluorescent signal becomes higher than the background (Kapil et al.,2009; Phares et al.,2009).

The CNS cell isolation procedure routinely yielded higher numbers of microglia compared with oligodendroglia. To validate that RNA isolation from a low cell number was not a factor limiting detection of low abundance mRNA, minimum cell numbers needed to achieve reliable PCR products were determined. For this purpose brain‐derived CD45lo CD11b+ microglia were purified by FACS from mice injected with poly I:C 4 h prior to isolation. RNA was separately isolated from increasing cell numbers starting with as few as 7,500 up to 240,000 cells and analyzed for Gapdh, Ifna4, Ifnβ, Ifit1, and Ifit2 transcripts. Titration curves demonstrate that Ct values were in the linear range down to 30,000 cells, even for low copy number Ifna4 transcripts (Supp. Info. Fig. 1). A minimum of 30,000–40,000 cells were thus used for real time PCR analysis.

RESULTS

Limited Expression of PRR and Signal Transduction Molecules in Oligodendroglia

Induction of IFNα/β by murine coronaviruses is mediated via TLR7 in pDC and via MDA5 in microglia/monocytes (Cervantes‐Barragan et al.,2007; Roth‐Cross et al.,2008). Furthermore, both MDA5 and RIG‐1 act as PRR in an oligodendroglia cell line (Li et al.,2010). However, the expression of these viral sensors in oligodendroglia in the adult CNS is unknown. To analyze their capacity to initiate innate responses, oligodendroglia and microglia were isolated from spinal cords of uninfected PLP‐GFP mice by FACS based on their respective CD45− GFP+ and CD45lo/int F4/80+ phenotypes (Malone et al.,2008). Spinal cords were used as donor tissue based on higher oligodendroglia yields compared with brains. The potential of mature oligodendroglia to recognize viral RNA in comparison to microglia was assessed by comparing basal transcript levels of genes encoding the viral RNA sensors MDA5, RIG‐I, TLR3, and TLR7 (Kawai and Akira,2007). Whereas transcription of all four PRR was readily detected in microglia, Mda5, Rig‐I, and Tlr3 transcripts were significantly reduced and Tlr7 was below detection in oligodendroglia (Fig. 1A). Basal levels of PRR mRNAs are low in the resting CNS relative to lymphoid tissue, with the exception of Tlr3 (McKimmie et al.,2005). Nevertheless, PRR are rapidly upregulated during viral encephalitis initiated by Semliki Forest virus, Rabies virus, and Venezuelan Equine Encephalitis virus (McKimmie et al.,2005; Sharma and Maheshwari,2009). However, the relative contribution of infiltrating leukocytes versus resident CNS cells was not directly assessed. Microglia and oligodendroglia were therefore isolated from JHMV infected mice to evaluate upregulation of PRRs during the course of infection. Microglia upregulated Mda5, Rig‐I, Tlr3, and Tlr7 transcripts two‐ to fivefold over basal levels, with peak expression at Days 3–5 postinfection (p.i.) (Fig. 1B). Relative to the modest fold increase in microglia, Mda5 and Rig‐I transcripts were vastly increased in oligodendroglia. Rig‐I expression reached levels similar to microglia by Day 3 p.i. amounting to an ∼70 fold increase over naïve levels (Fig. 1). Nevertheless, Mda5 mRNA levels in oligodendroglia remained overall lower compared with microglia. Similarly, mRNAs encoding the endosomal PRR TLR3 and TLR7 were also induced in oligodendroglia, but absolute levels remained low and peak expression was delayed relative to microglia. Induction of Mda5 and Rig‐I in oligodendroglia, as well as all RNA sensing PRR in microglia, correlated with induction of Ifnα4 and Ifnβ mRNA in the CNS following JHMV infection (Ireland et al.,2008; Malone et al.,2008). To evaluate additional contributions of Type II (IFNγ) and Type III (IFNλ) IFN, which also induce ISG, the RNA expression kinetics of all three IFN families were assessed in spinal cords (Fig. 2). Confirming previous results (Malone et al.,2008) Ifnα4 and Ifnβ mRNA were increased at Day 3 and peaked at Day 5 p.i. Although there are three Type III IFNλ family members, IFNλ1 is a pseudogene in mice; therefore primers were used to detect IFNλ2/3. IFNλ was minimally induced, yet with similar kinetics as IFNα/β, confirming very low expression and function in the CNS following heterologous infections, including a closely related MHV strain (Sommereyns et al.,2008). IFNγ mRNA was not upregulated until Day 5 p.i., and increased substantially by Day 7 p.i. As both IFNα/β and IFNγ signaling target many overlapping ISG, a contribution of early IFNγ to increased PRR expression could thus not be excluded.

Figure 1

Oligodendroglia are limited in basal and inducible expression of viral RNA sensing PRRs. Microglia and oligodendroglia purified from spinal cords of naïve (A) or JHMV infected (B) PLP‐GFP mice were assayed for Mda5, Rig‐I, Tlr3, and Tlr7 transcripts at the indicated times p.i. Data represent the average of three separate experiments ± standard error of the mean (SEM). “*” denotes P ≤ 0.05 comparing microglia to oligodendroglia at each timepoint; “#” indicates P ≤ 0.05 compared with basal levels for each cell population.

Figure 2

Kinetics of IFNα/β, IFNλ, and IFNγ expression during viral infection. Wt mice infected with JHMV were analyzed for kinetics of Ifnβ, Ifnα4, IFNλ, and IFNγ mRNA induction in spinal cords. Data represent the mean ± SEM for three mice per group; “#” indicates P ≤ 0.05 compared with basal levels.

To verify that the increase in PRR transcripts is directly attributed to IFNα/β signaling, mRNA expression was assessed in microglia and oligodendroglia from naïve and JHMV infected Wt and IFNAR−/− mice. Although basal Mda5 and Rig‐I mRNA levels were diminished by eight‐ to ninefold in microglia from naïve IFNAR−/− relative to Wt mice, they were only slightly reduced in oligodendroglia (Fig. 3). These results are reminiscent of previous observations that PRR expression in neurons is controlled by basal IFNα/β signaling (Shrestha et al.,2003). Importantly, the absence of IFNα/β signaling abrogated upregulation of Mda5 and Rig‐I transcripts in both microglia and oligodendroglia following JHMV infection (Fig. 3). Early induction of Mda5 and Rig‐I, both classified as ISG, thus demonstrated that oligodendroglia respond to exogenous IFNα/β in vivo, similar to microglia. IFNα/β thus enhances the potential to recognize invading RNA viruses, thereby facilitating early innate responses.

Figure 3

MDA5 and RIG‐I upregulation is IFNα/β dependent. Wt and IFNAR−/− mice infected with JHMV were used to compare induction of Mda5 and Rig‐I mRNA in oligodendroglia and microglia purified from spinal cords. Data are average of three individual experiments ± SEM as described in Fig. 1. “*” denotes P ≤ 0.05 comparing wt to IFNAR−/− populations at each timepoint.

IFNα/β is not Induced in Oligodendroglia

IFNα/β signaling is crucial to prevent dissemination of gliatropic coronavirus within the CNS parenchyma (Ireland et al.,2008). Furthermore, IFNα/β induction in response to coronavirus infection has been demonstrated in microglia in vitro and in vivo (Roth‐Cross et al.,2008) as well as in an oligodendroglial cell line (Li et al.,2010). Given the distinct basal and inducible levels of Mda5 transcripts in mature CNS derived glial populations, the contribution of infected oligodendroglia and microglia to IFNα/β induction was assessed in vivo by comparing Ifnβ and Ifnα4 mRNA relative to viral replication in each population. Viral loads were monitored by measuring viral mRNA encoding the N protein, the most abundant viral RNA in infected cells (Skinner and Siddell,1983). Viral‐N transcripts prevailed in microglia at Day 3 p.i., but decreased by Days 5 and 7 p.i. (Fig. 4). By contrast, although viral mRNA was near detection levels at Day 3 p.i. in oligodendroglia, the levels increased ∼20 fold relative to microglia by Day 5 p.i. Despite subsiding by Day 7 p.i., viral mRNA levels remained significantly elevated relative to microglia. These results not only assured that infected cells were recovered by the isolation procedure, but clearly indicated that virus predominated in microglia early, but subsequently prevailed in oligodendroglia. Concomitant with infection, sparse but detectable basal levels of Ifnβ and Ifna4 transcripts increased in microglia (Fig. 4). Ifnβ levels were sustained through Day 5 p.i., while Ifnα4 levels were only transiently upregulated. The contribution of infiltrating infected monocyte‐derived macrophages (Ireland et al.,2009) to Ifnα/β induction was also assessed. Viral RNA loads in macrophages were <50% of those in microglia and declined with similar kinetics; Ifnα/β transcripts reflected the magnitude of viral RNA transcripts similar to microglia (data not shown). By contrast, neither Ifnα4 nor Ifnβ mRNA were detected in oligodendroglia from naïve or infected mice (Fig. 4), despite higher viral RNA loads as well as elevated Mda5 and Rig‐I mRNA by Day 5 p.i. (Fig. 3).

Figure 4

Oligodendroglia do not induce IFNα/β transcripts during JHMV infection. Microglia and oligodendroglia purified from spinal cords of naïve or JHMV infected PLP‐GFP mice were assessed for JHMV‐N, Ifnβ, and Ifnα4 transcripts. Data are average values ± SEM of three independent experiments. BD indicates below detection. “*” denotes P ≤ 0.05 comparing microglia to oligodendroglia.

The failure of oligodendroglia to induce Ifnα/β following infection suggested that MDA5 and RIG‐I are not activated, and/or that downstream signaling factors are limiting. PRR signaling requires several mediators including the inducible kinase IKKε (also known as Ikbke or Ikki) and the transcription factors IRF3 and IRF7. While IRF3 is constitutively expressed, IRF7 is induced by IFNα/β and amplifies IFNα/β production (Honda and Taniguchi,2006; Honda et al.,2005). Therefore to investigate the potential for PRR signaling, oligodendroglia were examined for expression of mRNAs encoding IKKε, IRF3, and IRF7. All three mRNAs were regulated in a cell type‐specific manner (Fig. 5). Microglia from naïve mice expressed higher basal Ikkε transcripts compared with oligodendroglia, which were modestly, but progressively upregulated throughout Day 7 p.i. (Fig. 5). By contrast, Ikkε induction was not detected in oligodendroglia until Day 7 p.i., at which time levels reached those in microglia. Irf3 mRNA was readily detected at basal levels in both microglia and oligodendroglia from naïve mice, but tended to decline following infection (Fig. 5). Lastly, Irf7 transcripts were sparse in both microglia and oligodendroglia derived from naive mice (Fig. 5), consistent with lower basal CNS expression relative to Irf3 (Ousman et al.,2005). However, in contrast to the increase of Irf7 mRNA detected in microglia by Day 3 p.i., induction was more modest and occurred delayed in oligodendroglia following infection (Fig. 5). As the Irf7 gene is an ISG, its upregulation in microglia was consistent with IFNα/β upregulation. By contrast, the delayed response in oligodendroglia implied more selective ISG induction and/or distinct IFNα/β receptor signaling thresholds.

Figure 5

Oligodendroglia are limited in basal and inducible expression of PRR associated signaling factors during JHMV infection. Microglia and oligodendroglia from naïve or JHMV‐infected mice were assayed for Ikkε, Irf3, and Irf7 transcripts as indicated in Fig. 1. Data show the average of three separate experiments ± SEM for Ikkε and Irf7 and represent one of three separate experiments with similar results for Irf3. “*” denotes P ≤ 0.05 comparing microglia to oligodendroglia at each timepoint; “#” indicates P ≤ 0.05 compared with basal levels for each cell population.

Oligodendroglia Induce ISG Delayed Relative to Microglia

Upregulation of the ISGs Rig‐I, Mda5, Tlr3, and Irf7 support the notion that oligodendroglia respond to IFNα/β following infection. However, optimal induction was delayed and absolute levels were not as robust as in microglia. These results suggested that oligodendroglia is exposed to limiting amounts of IFNα/β in the microenvironment, or that they are intrinsically more limited than microglia in IFNα/β responsiveness. While the first possibility is difficult to address in vivo, the second may reflect reduced expression of the IFNα/β receptor (IFNAR) or downstream signaling components. We therefore assessed regulation of transcripts encoding the IFNAR, as well as STAT1 and IRF9, which act downstream of IFNα/β signaling. IFNα/β binds a common receptor complex consisting of two transmembrane proteins, IFNAR1 and IFNAR2. As IFNAR2 exists as a soluble (IFNAR2a) and transmembrane (IFNAR2c) and isoform generated by alternative splicing (Domanski et al.,1995), we examined basal expression patterns of IFNAR1, and both IFNAR2 isoforms in microglia and oligodendroglia. Basal mRNA levels of the Ifnar1 chain were approximately twofold higher in microglia compared with oligodendroglia. However, transcripts encoding both the soluble as well as the transmembrane form of Ifnar2 were more than fivefold higher in microglia compared with oligodendroglia (Fig. 6A), suggesting more limited responsiveness of oligodendroglia to IFNα/β. Stat1 and Irf9 levels were also elevated in microglia compared with oligodendroglia derived from naïve mice (Fig. 6B). STAT1 is inducible by both IFNα/β and IFNγ, while IRF9 is constitutively expressed in most non CNS cell types (Borden et al.,2007). Consistent with a response to IFNα/β, Stat1 mRNA indeed increased ∼10 fold by Day 3 p.i. and remained elevated until Day 7 p.i. in microglia (Fig. 6B). By contrast, a reduced capacity of oligodendroglia to respond to IFNα/β was supported by the modest upregulation of Stat1 transcripts at Days 3 and 5 p.i. The prominent increase of Stat1 at Day 7 p.i. suggested IFNγ mediated upregulation. Irf9 transcripts were only upregulated twofold in microglia by Day 3 p.i. and subsequently declined to or below basal levels (Fig. 6B). Nevertheless, despite lower basal levels and apparent constitutive expression, Irf9 transcripts in oligodendroglia rapidly increased by ∼15 fold at Day 3 p.i. and remained stable to Day 7 p.i. Although activation and nuclear localization of STAT1 and IRF9 remains to be evaluated, the overall limited basal levels of Ifnar1 and Ifnar2, as well as basal and inducible levels of Stat1 and Irf9 transcripts in oligodendroglia during JHMV infection, support an inherent paucity in ISG transcriptional activation.

Figure 6

Oligodendroglia have limited IFNα/β receptor signaling capacity. Microglia and oligodendroglia from naïve or JHMV infected mice were assayed for transcripts encoding the IFNAR1, soluble IFNAR2 (IFNAR2a) and IFNAR2 transmembrane (IFNAR2c) chains (A) or Stat1 and Irf9 transcripts (B). Data in (A) represent the average of two experiments; data in (B) represent the average of three independent experiments ± SEM as indicated in Fig. 1. “*” denotes P ≤ 0.05 comparing microglia to oligodendroglia at each timepoint; “#” indicates P ≤ 0.05 compared with basal levels for each cell population.

The notion of limited ISG transcriptional activation in oligodendroglia was further supported by analysis of a subset of ISG encoding factors with antiviral activity. Basal levels of transcripts encoding protein kinase R (Pkr), and the OAS/RNaseL pathway (Oas2), known to modulate translational activity, were all elevated in microglia derived from naïve mice relative to oligodendroglia (Fig. 7). Transcripts encoding adenosine deaminase specific for mRNA (Adar1), which limits viral replication via introduction of mRNA mutations (Bass,1997), were also more abundant in microglia (Fig. 7). By contrast, Ifit2 RNA was expressed at similar levels in both cell types derived from naïve mice. Importantly, in microglia all transcripts, particularly Oas2 and Ifit2 RNA, were rapidly increased to peak levels by Day 3 p.i. and declined thereafter. With the exception of Oas2, induction was also evident at Day 3 p.i. in oligodendroglia, but increases were most prominent by Day 7 p.i.; nevertheless, they never reached the peak absolute values observed in microglia (Fig. 7). These data demonstrate that oligodendroglia not only express lower steady state levels of ISGs, but also upregulate transcription with delayed kinetics relative to microglia in response to virus infection. Furthermore, delayed ISG expression in oligodendroglia indicated a more prominent responsiveness to IFNγ than IFNα/β. Overall the data clearly suggest that oligodendroglia require paracrine IFNα/β signals to induce ISG during gliatropic coronavirus infection.

Figure 7

Delayed induction of antiviral ISG in oligodendroglia. Microglia and oligodendroglia from naïve or JHMV infected mice were assayed for Pkr, Oas2, Adar1, and Ifit2 transcripts as indicated in Fig. 1. Data represent the average of three separate experiments ± SEM. “*” denotes P ≤ 0.05 comparing microglia to oligodendroglia at each timepoint; “#” indicates P ≤ 0.05 compared with basal levels for each cell population.

Inability of Oligodendroglia to Induce IFNα/β Genes is Virus Independent

To test whether oligodendroglia are intrinsically limited in IFNα/β production, or if limited IFNα/β production is specific to JHMV infection, we assessed IFNα/β and ISG induction following intracerebral injection of the PRR ligand poly I:C. Poly I:C is a strong agonist of both TLR3 and the RIG‐like receptors RIG‐I/MDA5 (Alexopoulou et al.,2001; Kato et al.,2006). Ifnα/β upregulation was initially tested in total tissue to characterize the time course of poly I:C induced IFNα/β responses in the CNS. Ifnβ expression was maximal at 2 h and Ifnα4 mRNA was elevated between 2 and 12 h post poly I:C inoculation (Fig. 8). By contrast, peak induction of the ISGs Ifit1 and Ifit2 was delayed until 12 h (Fig. 8). Cell type‐specific gene analysis of IFNα/β and ISG after intracerebral poly I:C injection was thus performed in purified microglia and oligodendroglia at 4 h as an intermediate timepoint for optimal Ifnα/β expression and at 12 h. In microglia Ifna4 and Ifnβ transcripts were clearly induced by 4 h and expression of Ifnβ was sustained until 12‐h postinoculation (Fig. 9). Importantly, the 30–40 fold higher levels than those induced by viral infection (see Fig. 4), were consistent with the low viral loads in the microglia population. Importantly however, Ifnα/β mRNA remained near detection thresholds in oligodendroglia (Fig. 9). Mda5 and Rig‐I levels were also increased more robustly in both cell populations after poly I:C injection relative to virus infection (Fig. 9). Furthermore, similar to the trend observed during infection, Rig‐I transcripts were significantly increased over Mda5 transcripts in oligodendroglia. Nevertheless, Ikkε and Irf7 transcripts were elevated in both microglia and oligodendroglia at 4 and 12 h after poly I:C (Fig. 9) relative to viral infection (Fig. 5). While limiting IFNα/β levels thus clearly contributed to suboptimal ISG induction in both glial populations following infection, the mechanisms underlying the paucity of IFNα/β induction specifically in oligodendroglia remain elusive. Representative of antiviral ISG expression, Ifit1 and Ifit2 mRNA were also increased in microglia at 4 h, but subsided by 12 h post poly I:C administration. By contrast, Ifit1 and Ifit2 induced in oligodendroglia at 4 h were lower than in microglia, but were sustained at 12 h (Fig. 9). Even under these conditions of infection independent in vivo stimulation, oligodendroglia exhibited tentative and delayed ISG induction. These results were further supported by isolating microglia and oligodendroglia from naïve adult mice and stimulating each population ex vivo with poly I:C in the presence of FuGENE to trigger intracellular PRR activation (Supp. Info. Fig. 2). FuGENE dramatically increased transcription of Ifnα/β in microglia 8 h post poly I:C stimulation. However, under similar conditions, Ifnα/β mRNA remained below detection in oligodendroglia. Similarly, induction of Ifit1 and Ifit2 mRNA was increased greater than threefold in microglia treated with both poly I:C and FuGENE, compared with poly I:C alone, supporting enhanced IFNα/β mediated induction. By contrast, although Ifit1 and Ifit2 mRNA induction was detectable in treated oligodendroglia, overall levels were significantly reduced, supporting an inherently low, if any capacity to induce Ifnα/β mRNA. Overall our results support the notion that in vivo oligodendroglia are not only intrinsically impaired in inducing IFNα/β in response to RNA stimuli, but also in responsiveness to IFNα/β suggesting an overall dampened capacity for innate responses.

Figure 8

Kinetics of CNS IFNα/β responses to poly I:C. Wt mice were injected intracerebrally with 200 μg poly I:C to assess kinetics of Ifnβ, Ifnα4, Ifit1, and Ifit2 mRNA induction in spinal cords. Data represent the mean ± SEM for three mice per group; “#” indicates P ≤ 0.05 compared with basal levels.

Figure 9

Distinct in vivo responses of oligodendroglia and microglia to poly I:C. Microglia and oligodendroglia purified from spinal cords at 4 or 12 h post poly I:C injection were analyzed for expression of Ifnα4, Ifnβ, Mda5, Rig‐I, Ikkε, Irf7, Ifit1, and Ifit2 transcripts. Data are representative of two independent experiments each with 10 pooled mice per experiment.

DISCUSSION

PRR initiated innate responses in the CNS are critical for the induction of IFNα/β, as well proinflammatory cytokines and chemokines. While PRR expression and activation in microglia and astrocytes has been extensively explored in vitro (Butchi et al.,2010; Carpentier et al.,2008; Jin et al.,2011; So and Kim,2009), expression of PRR and associated signaling components in glia in vivo are poorly defined, especially in oligodendroglia. In this study we compared the capacity of oligodendroglia relative to microglia to mount IFNα/β mediated innate immune responses. Glial specific responses were monitored within the context of the CNS following intracerebral infection of adult mice with gliatropic JHMV or injection of poly I:C. Microglia were prominent inducers of Ifnα/β mRNA following infection, consistent with IFNα/β induction in primary microglia as well as bone marrow derived macrophages infected with a heterologous MHV (Roth‐Cross et al., 2008). However, the inability of oligodendroglia to induce Ifnα/β mRNA, despite their high load of viral RNA, contrasted with in vitro studies demonstrating MDA5 and RIG‐I dependent IFNα/β induction in the infected N20.1 oligodendroglia cell line (Li et al.,2010). This discrepancy likely reflects differences in expression and/or induction of IFNα/β pathway components, rather than distinct viral loads, as even poly I:C did not induce Ifnα/β in oligodendroglia in vivo or ex vivo.

The restricted ability of coronaviruses to induce IFNα/β was recently attributed to the O‐methylated cap structure of the viral RNA, making it difficult for the host to distinguish viral from self mRNA (Daffis et al.,2010; Zust et al.,2011). However, in contrast to cultured fibroblasts, bone marrow‐derived dendritic cells, astrocytes, and neurons, the ability of plasmacytoid dendritic cells, macrophages/microglia, and an oligodendroglia cell line to induce IFNα/β via TLR7, MDA5 and MDA5/RIG‐I dependent pathways (Cervantes‐Barragan et al.,2007; Li et al.,2010; Roth‐Cross et al.,2008; Zhou and Perlman,2007) suggests sufficient PRR activation by viral RNA structures to mediate protective responses in select cell types. Our data indicate that cell type‐specific basal expression, as well as inducible components in the innate signaling pathway constitute critical signaling thresholds determining IFNα/β induction. In the adult CNS oligodendroglia differed significantly from microglia in reduced basal transcript levels of viral RNA sensing PRRs and Ikkε. However, basal Irf3 transcripts were only reduced by ∼50%, and Irf7 transcripts were barely detectable in either cell population, consistent with higher basal Irf3 than Irf7 levels observed in whole naïve brains (Ousman et al.,2005). Reduced basal PRR levels in oligodendroglia were reminiscent of sparsely expressed PRRs in primary neurons (Carpentier et al.,2008), and supported the superior initiation of Ifnα/β responses by microglia. This concept is consistent with the inability of primary cultured neurons and astrocytes to induce IFNα/β expression following MHV infection (Roth‐Cross et al.,2008). It remains to be confirmed whether other CNS infections involving oligodendroglia reveal a similarly muted pattern of IFNα/β induction and responsiveness. However, most RNA viruses are neuronotropic, with only some variants of Theilers murine encephalomyelitis virus displaying tropism for oligodendroglia in mouse strains susceptible to persistent infection (Brahic et al.,2005). However, during the acute CNS infection, this virus primarily infects neurons and oligodendroglia and is only infected during the persistent stage, making direct comparisons difficult.

Optimal IFNα/β induction requires amplification through IFNAR to elevate PRRs and IRF7 (Honda and Taniguchi,2006; Honda et al.,2005; Malmgaard et al.,2002). However, in contrast to Ifnα/β induction, IFNAR signaling was intact in oligodendroglia. Although IFNα/β protein was below detection in cell‐free supernatants derived from the JHMV infected CNS by ELISA (data not shown), IFNα/β sufficed to upregulate the ISGs Mda5, Rig‐I, Stat1, Irf7, Pkr, Ifit2, and Adar1 in oligodendroglia. The ability of IFNα/β to induce ISGs was consistent with basal expression of IFNAR chains, as well as basal and inducible levels of Stat1 and Irf9 transcripts. Although induction above basal levels was greater in oligodendroglia than microglia for some genes, peak absolute mRNA levels were in general lower compared with those reached in microglia, as exemplified by Stat1 and Irf7 mRNA. Furthermore, peak expression for many genes did not correlate with maximal Ifnα/β mRNA levels, but rather with peak IFNγ mRNA and protein at Day 7 p.i. (Phares et al.,2011). The distinct pattern of ISG expression in oligodendroglia compared with microglia may further reside in low IKKε. In addition to mediating PRR signaling, IKKε influences ISG induction through participation in JAK/STAT mediated IFNα/β signaling (Pham and Tenoever,2010; Tenoever et al.,2007). Although not as severe as the complete abrogation of ISG induction in STAT1−/− mice, IKKε−/− mice lack induction of ∼30% of ISGs, including Adar1 (Durbin et al.,1996; Tenoever et al.,2007). The biological consequences are demonstrated by impaired clearance of influenza virus infection by IKKε−/− mice, despite similar expression of IL2, IL6, IL12, IFNγ, and RANTES as well as induction of antiviral antibody (Tenoever et al.,2007). The paucity of Ikkε mRNA and modest, if any, increase of Irf7 mRNA in oligodendroglia, despite abundant viral and Mda5 mRNA upregulation, may partially explain the absence of Ifnα/β expression and more selective and delayed ISG induction during infection. However, even the strong IFNα/β response elicited in microglia by poly I:C did not overcome the inability of oligodendroglia to induce Ifnα/β, despite the overall higher increases in Ikkε and Irf7 transcripts relative to those induced by infection. These results suggest additional restrictions intrinsic to oligodendroglia in the initiation of IFNα/β production. Furthermore, limited ISG expression by oligodendroglia following infection can partially be attributed to overall low IFNα/β induction by JHMV, as upregulation of the prominently IFNα/β dependent Ifit1 and Ifit2 mRNAs was enhanced in both microglia and oligodendroglia following poly I:C administration relative to infection. These results suggest that the ability of oligodendroglia to respond to IFNα/β is dependent on the overall availability of IFNα/β in the local environment.

The results thus indicate a reliance of oligodendroglia on external production of IFNα/β to induce an antiviral state. This concept is consistent with data indicating that microglia are a dominant source of IFNα/β within the CNS during JHMV induced encephalomyelitis (Roth‐Cross et al., 2008). The biological relevance of suboptimal IFNα/β responses is clearly evident from differential viral control in both cell types. A direct response to infection by microglia is supported by the correlation between peak viral and Ifnα/β mRNA. Furthermore, the early decline in viral RNA, prior to infiltration of T cells, indicates autocrine IFNα/β contributes to the rapid control of virus in this cell type. By contrast, although oligodendroglia were initially infected to a lesser extent than microglia, viral RNA increased over 2 logs between Days 3 and 5 p.i., coincident with no Ifnα/β and tentative induction of antiviral ISGs. These data indicate that oligodendroglia rely largely on T cell effector function, prominently IFNγ, for viral control (Parra et al.,2010). Oligodendroglia are indeed highly responsive to IFNγ as indicated by upregulation of Class I MHC molecules and associated antigen processing components during peak IFNγ, but not IFNα/β induction during JHMV infection (Malone et al.,2008). Moreover, specific blockade of IFNγ receptor signaling on oligodendroglia prolongs JHMV infection in this cell type (Gonzalez et al.,2005, 2006; Parra et al.,2010). Whether early events favoring robust infection of oligodendroglia prior to emergence of T cells, contribute to ultimate persistence of JHMV in oligodendroglia, remains to be elucidated.

Overall our results demonstrate a limited role of oligodendroglia as both inducers of, and responders to, IFNα/β compared with microglia. Limited innate antiviral activity may predispose oligodendroglia to be potent responders to IFNγ (Gonzalez et al.,2005; Popko and Baerwald,1999). While there is no evidence supporting toxicity of IFNα/β (Akwa et al.,1998), more restricted induction of antiviral mediators, especially those also affecting host cell translation, may circumvent apoptosis and guarantee maintenance of critical myelin housekeeping functions and survival. Our findings also contradict the hypothesis suggesting that virus initiated IFNα/β production by oligodendroglia drives inflammatory responses during viral‐induced demyelinating disease (Lipton et al.,2007). The low abundance of PRR at basal levels rather provide a mechanism underlying the apparent paucity of oligodendroglia to express cytokines during multiple sclerosis or other CNS inflammatory conditions (Cannella and Raine,2004; Zeis et al.,2008). Our data thus support the notion that oligodendroglia are defensive players under inflammatory conditions.

Additional Supporting Information may be found in the online version of this article.

Supporting Information Figure 1. Validation of minimum cell numbers required for reliable PCR products. Microglia from spinal cords of mice injected intracerebrally with poly I:C for 4 h were FACS purified. RNA was separately isolated from decreasing cell numbers as indicated and expression of Gapdh, Ifna4, Ifnb, Ifit1 and Ifit2 transcripts were analyzed. Data are representative of 10 pooled mice from a single experiment.

Click here for additional data file.

Supporting Information Figure 2. Ex vivo stimulation of oligodendroglia and microglia with poly I:C or poly I:C supplemented with FuGENE. Purified microglia and CD45‐ O4+ oligodendroglia from spinal cords of naïve mice were stimulated with poly I:C only or poly I:C and FuGENE for 8 h and expression of Ifna4, Ifnβ, Ifit1, and Ifit2 transcripts were analyzed. Data are representative of two independent experiments each with 12 pooled mice per experiment.

Click here for additional data file.