Exogenous high-mobility group box 1 protein injection improves cardiac function after myocardial infarction: involvement of Wnt signaling activation.

Exogenous high-mobility group box 1 protein (HMGB1) injection could prevent left ventricular remodeling and enhance left ventricular function during myocardial infarction (MI). However, the mechanism remains unclear. This paper was to investigate in the mechanism of cardioprotection of HMGB1 during MI in rats. Anesthetized male rats were treated once with HMGB1 (200 ng) 4 h after MI and then executed after 7 and 28 days, respectively. Cardiac function, collagen deposition, and dishevelled-1 and β-catenin protein expression were measured. After MI 7 days or 28 days, the left ventricular ejection fraction (LVEF) was significantly decreased compared to that of sham-operated control group (P < 0.05). However, the LVEF HMGB1-treated groups were significantly higher compared to those of the MI group in both 7 days and 28 days (P < 0.05). The collagen volume fraction was significantly reduced in the HMGB1-treated group in infarcted border zone. HMGB1 could activate the expression of dishevelled-1 and β-catenin proteins (P < 0.05). Our study suggested that exogenous high-mobility group box 1 protein injection improves cardiac function after MI, which may be involved in Wnt/β-catenin signaling activation.

1. Introduction

Myocardial infarction (MI) is one of the leading cause of morbility and mortality [1]. The healing process after MI involves early cardiomyocytes apoptosis and inflammatory cells infiltration, which also includes the proliferation and migration of myofibroblasts with the degradation and deposition of extracellular matrix. This pathological change induces the damaged myocardium to be replaced with scar tissue, which leads to “left ventricular remodeling” and heart failure [2, 3]. High-mobility group box 1 protein (HMGB1), a multifunctional protein, was originally identified as a nuclear protein and secreted from inflammatory cells to modulate inflammation and function as a mediator of inflammation in several cardiovascular diseases, such as coronary artery disease, myocardial ischemia, and reperfusion injury and heart failure [4-7]. Present studies revealed variable effects of HMGB1 to inflammation; it acts as a “double-edged sword,” not only initiating/amplifying but also attenuating the response [8, 9]. Recent studies have confirmed a novel role for HMGB1 as a strong chemoattractant and a signal of tissue damage to promote proliferation, migration, and differentiation of several stem cell types and could prevent left ventricular remolding and enhance left ventricular function during MI [10-12]. However, the above mechanism remains unclear.

Wnt proteins are a large family of secreted signaling molecules. Present study showed that the Wnt pathway is involved in post-MI wound healing and stem cell regulation, which has been shown to play an essential role in cell proliferation and differentiation both in normal homeostasis and diseased state [13-17]. On base of the common beneficial effects of HMGB1 and Wnt signal pathway in cardiac function healing after MI, we speculated that there exists a potential relationship between HMGB1 and Wnt signal pathway. In this present study, we investigated that whether exogenous HMGB1 injection could improve the cardiac function by mediating Wnt signal pathway.

2. Materials and Methods

2.1. Animal Experiments and Protein Injection

The experiment protocol conformed to the Guideline for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication, revised 1996) and was approved by Institutional Animal Care and Use Committee. Male Sprague-Dawley rats with an initial weight from 200 to 250 g were randomly assigned into 5 groups receiving the following treatments.

Group 1: sham-operated control (SO) (n = 10): rats were subjected to surgical manipulation without MI.

Group 2: MI/7 days (n = 15): rats were subjected to left anterior descending coronary artery occlusion, after 4 hours they were treated with Phosphate-Buffered Saline (PBS) and were executed after 7 days.

Group 3: MI/28 days (n = 15): rats were subjected to left anterior descending coronary artery occlusion and were executed after 28 days.

Group 4: MI-HMGB1/7 days (n = 15): rats were subjected to left anterior descending coronary artery occlusion, after 4 hours they were treated with HMGB1 (200 ng) and were executed after 7 days.

Group 5: MI-HMGB1/28 days (n = 15): rats were subjected to left anterior descending coronary artery occlusion, after 4 hours they were treated with HMGB1 (200 ng) and were executed after 28 days.

After being anesthetized with sodium pentobarbital (40 mg/kg, i.p.), the rats were ventilated artificially with a volume-controlled rodent respirator at 70 strokes per minute. Rats were placed on an electric heating pad to maintain the body temperature at 37°C. Animals were treated with heparin (200 IU/kg, iv) and then a left thoracotomy was performed. The left coronary artery was identified and ligated 2 mm below the left atrial appendage. A successful MI model was confirmed by ST segment elevation in Leads-II and regional cyanosis of the myocardial surface. The chest was closed and the rats were allowed to recover. After 4 hours, rats were under rethoracotomy, and 200 ng of purified HMGB1 in 10 uL PBS solution was injected into 2 sites of the peri-infarct zone. The dose of HMGB1 was determined based on the previous literature by Limana et al. [12]. Lead-II of the electrocardiogram was monitored with subcutaneous stainless steel electrodes. Electrocardiogram was monitored using a computer-based EP system (LEAD2000B, Jinjiang Ltd, China). To determine serial HMGB1 expression, rats were sacrificed 7 and 28 days after MI for mRNA and protein analyses.

2.2. Assessment of Cardiac Function

Echocardiography was performed to evaluate cardiac function in anesthesia rats using Sequoia 512 (Acuson, Mountain View, CA, USA) equipped with a 3–7 MHz linear transducer at 7 and 28 days after HMGB1 or PBS injection. Two-dimensional images and M-mode tracings were recorded from the anterior chest area.

2.3. Tissue Repair

Rats in each group were killed at 7 and 28 days after MI, respectively; and the left ventricular tissue specimens were immediately put into liquid nitrogen for 24 hours and then reserved in −80°C refrigerator.

2.4. Western Blot

Pulverized frozen ischemia area of the left ventricle samples were analyzed by quantitative immunoblotting using dishevelled-1 and β-catenin antibody (Santa Cruz, USA) as described previously [5]. The expression of protein was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression.

2.5. RNA Isolation, cDNA Synthesis, and Real-Time PCR

Total RNA was isolated from myocardial tissue by TRIZOL (Invitrogen) extraction and cDNA generated using High Capacity cDNA Reverse Transcription kit (TaKaRa, Japan). For real-time PCR analysis, we performed on ABI Prism 7500 sequence detection system (PE Applied Biosystems) by using SYBR Green Real-time PCR Master Mix kit (TaKaRa, Japan). PCR cycling conditions included 42°C/30 min, 99°C/10 min,5°C/5 min for reverse transcription; 94°C/30 s, 51°C (DVL), or 55°C(β-actin)/30 s and 72°C/60 s, over 35 cycles for polymerase chain reaction. Semilog amplification curves were evaluated based on 2−ΔΔCt (comparative quantification method). β-actin was selected as normalization for each sample and the reaction conditions exactly the same as specimens. The primers used were as follows: dishevelled-1, forward primer: 5′TCACGCTCAACATGGAGAGGCA3′; reverse primer: 5′GCACGGCATCATCGTTGCTCAT3′. (Gene Bank number: 83721). β-actin, forward primer: 5′ACTGGCATTGTGATGGACTCCGGA3′ reverse primer: 5′TCTCAGCTGTGGTGGTGAAGCTGT3′. (Gene Bank number: 81822)

2.6. Histology

Excised hearts were immersion-fixed in 10% buffered formalin for 24 hours and transferred to 70% ethanol to obtain serial sections at set time points. The specimens were sliced from apex to base into 4 mm thick sections and mounted on a set of gelatin-coated glass slides. These slides were stained with Masson trichrome. Five slides equally distributed through the infarct area were taken from a representative heart sample and scar thickness.

2.7. Statistical Analysis

Statistical analysis was performed with the SPSS 13.0 (SPSS Inc., Chicago, IL, USA). All values were expressed as mean ± SD. One-way ANOVA or Welch was used for comparisons among groups, and the Newman-Keuls-Student or Dunnett T3 was used for post hoc multiple comparisons. Statistical significance was defined as P < 0.05.

3. Results

3.1. Cardiac Function

As shown in Table 1, after MI of 7 days or 28 days, the left ventricular ejection fraction (LVEF) were significantly decreased compared to that of SO group (P < 0.05). However, the LVEF treated with HMGB1 were significantly higher compared to those of the MI group both in 7 days and 28 days (P < 0.05). Left Ventricular End-Systolic Volume (LVESV) and Left Ventricular End-Diastolic Volume (LVEDV) seemed to be larger in the SO group compared to HMGB1-treated group (P < 0.05). However, no significant change can be observed in heart rate of MI-HMGB1 group and MI group in 7 days and 28 days.

Table 1

Cardiac function in SO, MI, and MI-HMGB1 group at 7 and 28 days.

		7 days		28 days
	SO	MI	MI-HMGB1	MI	MI-HMGB1
HR (bpm)	334 ± 13	324 ± 11	344 ± 12	338 ± 13	351 ± 14
LVEF (%)	70.2 ± 3.2	43.1 ± 8.3*	53.42 ± 7.3∗#	30.33 ± 4.6*	50.61 ± 7.6∗#
LVEDV (cm2)	0.41 ± 0.02	0.61 ± 0.03*	0.64 ± 0.04*	0.70 ± 0.04*	0.68 ± 0.03*
LVSA (cm2)	0.23 ± 0.03	0.41 ± 0.04*	0.49 ± 0.05*	0.53 ± 0.02*	0.50 ± 0.04*

SO, sham-operated control; MI, myocardial infarction; HR, heart rate; HMGB1, high-mobility group box 1 protein; LVEF, left ventricular ejection fraction; LVEDV, Left ventricular end-diastolic volume; LVESV, Left ventricular end-systolic volume *P < 0.05 versus SO group; #P < 0.05 versus MI group.

3.2. Wnt/β-Catenin Expression

As shown in Figure 1, the expression of dishevelled-1 protein was significantly increased in both MI/7 days and MI-HMGB1/7 days (groups 2 and 4) compared to that of SO group (P < 0.05). However, dishevelled-1 protein has a sudden drop and could hardly be detected in MI/28 days (group 3). Conversely, it was significantly increased in MI-HMGB1/28 days (group 5) (P < 0.05).

Figure 1

Expression of dishevelled-1 and β-catenin protein at different time points after MI without/with HMGB1 injection (n = 5 for each group). #P < 0.05 versus SO group; ▴P < 0.05 versus MI/7 days; ▪P < 0.05 versus MI/28 days. SO, sham-operated control; MI, myocardial infarction; HMGB1, high-mobility group box 1 protein.

Subsequently, to further clarify the change mechanism, we conducted a study on β-catenin. β-catenin has historically to be recognized as a second messenger and located downstream of dishevelled-1 in canonical Wnt pathway [14]. Data analysis from our experiment suggested that the trend of its protein expression, consistent with dishevelled-1, increased significantly at MI/7 days (group 2) and then turn to almost undetectable levels in MI/28 days (group 3), while it was continually increasing from 7 to 28 days in MI-HMGB1/7 days and MI-HMGB1/28 days (groups 4 and 5) (P < 0.05).

3.3. Dishevelled-1 mRNA Expression

We investigated normalized Dishevelled-1 mRNA level from analysis of real-time PCR results. As shown in Figure 2, compared with sham-operated group, expression of dishevelled-1 mRNA increases both in MI/7 days and MI-HMGB1/7 days (group2 and 4) (P < 0.05), and then the dishevelled-1 gene expression decreased abruptly in MI/28 days (group 3) (P < 0.05). While the dishevelled-1 mRNA expression has a markedly increasing in MI-HMGB1/28 days group (group 5) (P < 0.05).

Figure 2

Expressions of dishevelled-1 mRNA at different time points in different experimental groups (n = 5 for each group). #P < 0.05 versus SO group; ▴P < 0.05 versus MI/7 days; ▪P < 0.05 versus MI/28 days. Abbreviations are identical with Figure 1.

3.4. Collagen Deposition

As shown in Figure 3, from 7 days to 28 days after MI, ventricular wall of the infarcted area became grey and stiff in all groups, and Masson trichrome staining detected a huge amount of collagen deposition in the peri-infarct area of MI/7 days and 28 days, while it was significantly reduced in the MI-HMGB1/7 days and 28 days (P < 0.05). Quantitative analysis also demonstrates that the collagen volume fraction was significantly reduced in the HMGB1-treated group in infarcted border zone.

Figure 3

Representative Masson trichrome-stained sections (blue) of hearts after MI (n = 5 for each group). ▴P < 0.05 versus MI/7 days; ▪P < 0.05 versus MI/28 days. Abbreviations are identical with Figure 1.

4. Discussion

In this study, we found that exogenous HMGB1 injection could improve cardiac function and activate the Wnt signaling pathway after MI. Thus, we speculated that HMGB1's beneficial effect in cardiac function during heart healing may be associated with the activation of the Wnt signaling pathway.

To be considered as a double-edged sword, HMGB1 massively released by necrotic cell, apoptotic cell, or activated innate immune cells (such as macrophages and monocytes) have both beneficial and detrimental effects [4, 8]. A series of recent articles have demonstrated that HMGB1 could improve global cardiac function of chronic heart failure and promote myocardial regeneration after MI [7, 12, 18]. In the present study, we also showed that exogenous HMGB1 injection into the rat heart at the time of MI could induce an enhancement of cardiac function and attenuate pathological extracellular matrix accumulation.

It is well known that the pathologic process of wound healing after MI includes cell proliferation and migration, extracellular matrix degradation and deposition, scar tissue formation and maturation. Previous study has confirmed that exogenous HMGB1 could induce myocardial regeneration after infarction via enhanced cardiac C-Kit cell proliferation and differentiation; at the same time, they observed newly formed cardiomyocytes present in the infarcted area, which express cardiac markers like myocyte enhancer factor-2C, α-sarcomeric actin, and connexin43 (Wnt signaling is also a specific and potent inducer of connexin43 expression in cardiomyocytes [9, 19]. Since several groups have explored that the migration and proliferation of cardiac stem cells were governed by different molecular signaling cascades during infarct healing, in which of them Wnt signaling plays a functional role. Mirotsou et al. [20] further demonstrated that Wnt plays a major role in mediating the survival signal of Akt-overexpressing mesenchymal stem cell on the ischemic myocardium. In the present study, the Wnt/β-catenin signal pathway was activated by exogenous HMGB1 injection after MI. Therefore, we speculated that the beneficial effects of HMGB1-inducing cell differentiation were possible depending on activation of Wnt/β-catenin signaling in damaged heart tissue after MI, and finally resulting in improvement of cardiac function.

Dishevelled-1 is a core molecule, which mediate the Wnt signal's delivery from receptor to intracellular, three highly conserved domain of it are necessary for activation of Wnt [21]. In this study, our data showed that the dishevelled-1 mRNA and protein increased in 7 days after MI, which may be attributed to the protection of compensation, but decreased significantly in MI rats in 28 days. This may be an essential mechanism for left ventricular remodeling consistent with previous study [22]. However, the expression of dishevelled-1 mRNA was hardly decreased in MI rats while sharply increased in response to exogenous HMGB1 injection in 28 days. Meanwhile, we also found that exogenous HMGB1 injection could inhibit the decrease of β-catenin induced by MI. Existing studies aiming at wound healing after MI reported an upregulation of β-catenin in vascular endothelial cells during neovascularization and could contribute to myofibroblast's migration and proliferation, promote granulation tissue formation and maturation, help to repair the damaged myocardium; these suggested that the change of β-catenin plays an important role in left ventricular remodeling after MI [23]. In addition, previous studies indicated that dishevelled-1 could upregulate and activate β-catenin during the wound-healing process after MI [22, 24, 25]. Thus, we speculated that exogenous HMGB1 injection could improve cardiac function by mediating Wnt/β-catenin signaling pathway after MI.

5. Conclusions

Our study suggested that HMGB1 could mediate Wnt signaling through upregulating the level of dishevelled-1, then upregulating β-catenin after MI, and finally result in improving cardiac function, which may become a potential therapeutic target for post-MI heart failure.