Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriage.

CONTEXT AND
OBJECTIVE: The etiology of miscarriage is often multifactorial. One major cause, immunological rejection of the fetus, has not been clearly elucidated. Our aim was to establish whether the semaphorin CD100, its natural receptor CD72, and the glycoprotein CD45, implicated in immune mechanisms, are involved in pregnancy loss by examining their placental expression with real-time PCR, immunohistochemistry and western blotting techniques. PATIENTS: Placenta tissue from 72 Caucasian women undergoing surgical uterine evacuation due to early spontaneous pregnancy loss between the 8(th) and 12(th) week of gestation was divided into four groups based on miscarriage number. Gestational age-matched placentas from 18 healthy women without a history of miscarriage undergoing voluntary pregnancy termination were the control group. Placenta from 6 Caesarean deliveries performed at 38-40 weeks of gestation was also studied.
RESULTS: CD100, CD72 and CD45 were expressed in placenta and exhibited different mRNA and protein levels in normal pregnancy and miscarriage. In particular, protein levels were highly dysregulated around 10 weeks of gestation in first and second miscarriage placentas. The CD100 soluble form was produced and immediately shed from placental tissue in all samples.
CONCLUSIONS: Fetal CD100, CD72 and CD45 seem to play a role in miscarriage. The present data support the involvement of the fetal immune system in pregnancy maintenance as well as failure.

Introduction

Miscarriage (fetal death before 24 weeks of gestation, w.g.) is a frequent event in human pregnancy. Indeed as many as one in five clinical pregnancies results in miscarriage [1]; recurrent miscarriage (three or more consecutive miscarriages) accounts for ≅ 10% of all cases. The etiology of miscarriage is often multifactorial; established risk factors include parental chromosomal and uterine anatomical abnormalities [2], advanced maternal age [3], a history of miscarriage [4], and infertility [5]. Several behavioral and social risk factors, such as alcohol [6] and caffeine consumption [7], [8] and cigarette smoking [7], have been reported to increase the risk. An additional cause is immunological rejection of the fetus due to disruption of the mechanisms that normally prevent maternal immune system activation by the paternal antigens expressed by the developing fetus [9]. In a normal pregnancy the maternal immune system is not suppressed; on the contrary, it is capable of efficiently recognizing and reacting against foreign antigens of the “fetal transplant” [10]. The goal of the maternal response is to avoid extravillous trophoblast cell over-invasion [11], balancing womb integrity and fetal nutrition [12]. Such balance is realized by the development by maternal leukocytes of tolerance for the antigens expressed in the semi-allogeneic/allogeneic fetal cells. Specific fetal mechanisms also provide for acceptance of the mother’s cells, since some cell surface characteristics are not inherited [13]. Shao L. et al. [14] noted that human placental trophoblasts activate a particular type of T cells that modulate T cell-dependent B cell responses, resulting in efficient suppression of Ig secretion. A further insight into the mechanisms underpinning fetal tolerance to maternal cells is the recent discovery of a mechanism by which the mother trains the fetus’s budding immune system: the mother’s foreign antigens cross the placenta [15], [16] to lodge in fetal lymph nodes, which are populated by T cells as early as 10 w.g. [17], inducing development of antigen-specific Tregs that suppress antimaternal immunity and persist at least until early adulthood [18]. However, the fetal mechanisms that circumvent the maternal immune response in the pregnant uterus are still unclear.

Semaphorins are transmembrane proteins implicated in many processes including neural development [19], tumor progression [20], and cardiovascular development [21]. Recently, several roles for semaphorins have been identified in the immune system [22]; 4D (CD100), the first semaphorin to be found and characterized in the immune system, is sometimes cleaved from the cell surface to release a soluble semaphorin [23]. CD100 is constitutively expressed on T cells, where it is up-regulated as a result of T cell activation [24]; it is also expressed, albeit to a lesser extent, on macrophages, B cells, natural killer (NK) cells and neutrophils [24]. CD100 acts on immune cells–such as B cells and dendritic cells (DCs)–through CD72, its main receptor in lymphoid tissue [25], [26]. CD72 is a well-known B cell antigen expressed on the surface of antigen-presenting cells (APCs), mainly B cells and, to a lesser extent, DCs and macrophages [24], [27]. It seems to function as a negative regulator of immune cell responses [25], [26]. CD100 induces tyrosine dephosphorylation of the CD72 cytoplasmic domain, turning off its inhibitory signaling and enhancing immune cell responses [25], [26]. CD100 is physically associated to the transmembrane glycoprotein CD45 (common leukocyte antigen), an association that becomes closer during immune cell activation [28], [29]. In addition, CD45 triggers generation of the soluble form of CD100 which, similarly to other diffusible factors, augments the immune response by acting on remote immune cells [30].

Given the active role of CD100, CD72 and CD45 in immune response modulation and the growing interest in the immunological causes of spontaneous miscarriage, we investigated for the first time whether these molecules are expressed in placental tissue and whether they could be involved in pregnancy loss. Real-time PCR, immunohistochemistry and quantitative western blotting techniques allowed documenting significant dysregulation in their expression in miscarriage tissue, supporting the potential involvement of the fetal immune system in pregnancy maintenance as well as failure.

Materials and Methods

Ethics Statement

All patients provided their informed consent to participate in the study, which was approved by the Ethics Committee of Università Politecnica delle Marche. We used placenta and tonsil tissue collected in surgical bins for disposal as rubbish. Since the tissues did not require histopathological examination and the study did not expose subjects to any risk, an oral authorization in lieu of a written consent was obtained from patients and from children’s parents (Department of Clinical Sciences, 8/1 February 2009). A verbal consent form, one per patient, reporting the study summary; the subject’s comprehension and ability to consent; voluntariness (freedom from coercion or undue influence, real or imagined); and the opportunity to ask questions and consider their decision was signed and dated by the operator (T.L.) to document the donor’s verbal authorization and filed in the Department archives.

A power analysis was performed to establish how many cases were needed. The methods used to achieve the study aims were documented. A data collection procedure was devised to obtain an anonymous database ensuring blind sample-result correlation and standardization.

Sample Types and Tissue Processing

Placental tissue was obtained during surgical uterine evacuation from women with early spontaneous pregnancy loss, defined as miscarriage, between the 8th and 12th w.g., the period when the fetal immune system begins to develop. Gestational age (GA) was calculated from the last menstrual period. Patients were evaluated by ultrasonography (US) when they presented with vaginal bleeding. Uterine evacuation was performed within 24 h of US documentation of fetal death.

All women undergoing surgical uterine evacuation due to miscarriage at the Unit of Obstetrics and Gynecology, “G. Salesi” Hospital, Ancona, from February 2008 to December 2010, were invited to participate. Exclusion criteria were antiphospholipid syndrome, endocrine disorders, infection, chromosomal aberrations, uterine structure abnormality, cigarette smoking, use of cocaine or alcohol and caffeine overuse.

A total of 72 women (mean age 35.7 years, range 28–44) were enrolled and divided into first, second, third and fourth miscarriage; all had had singleton pregnancies. The control group included GA-matched placental tissue from 18 healthy women without a history of miscarriage, who underwent termination of pregnancy in the first trimester for psychological or social reasons. The mean age of this group was 33 years (range 25–40). All these tissue samples were subdivided into 3 w.g. subgroups (8≤ w.g. <9; 9≤ w.g. ≤10; and w.g. >10), each containing 6 specimens.

Finally, we studied normal term placenta from 6 Caesarean deliveries performed at 38–40 w.g. The mean age of these subjects was 34 years (range 31–40). All subjects were Caucasian.

Tonsils from children undergoing tonsillectomy were used as a positive control [30], [31], [32]. Two randomly selected samples from each placenta and tonsil specimen were washed with saline; one was frozen in liquid nitrogen within 5 min and stored at − 80°C until use for molecular and biochemical analysis, the other was fixed for 24 h in 4% neutral buffered formalin at 4°C and embedded in paraffin for immunohistochemistry.

Preparation of cDNA for Real-time PCR

Total RNA was extracted from 10 mg of frozen placenta and tonsil using the Total RNA purification kit and then cleaned up and concentrated using the CleanAll RNA/DNA Clean-Up and Concentration kit (both from Norgen, Biotek Corp., Thorold, Ontario, Canada) according to the manufacturer’s instructions. The quality (A260/A280) and quantity (A260) of extracted RNA were tested with a NanoDrop® ND-1000 UV-Vis Spectrophotometer (Celbio, Milan, Italy) and 1 µg of RNA was reverse transcribed using the high-capacity cDNA RT kit (Applied Biosystems, Foster City, CA, USA) in a total volume of 20 µl using random primers.

Real-time PCR

The sequences of the real-time PCR (Q-PCR) primers targeting CD100, CD72 and CD45 genes, comprising known transcript variants (2 variants for CD100 and 4 variants for CD45) are summarized in Table 1. SDHA (succinate dehydrogenase complex subunit A) was used as the housekeeping gene for data normalization, to correct for variations in RNA quality and quantity. Q-PCR was performed in a reaction mixture containing 10 µl of 2X iQ SYBR Green Supermix (Bio-Rad Laboratories, Milan, Italy), 0.1 µM of each primer, 15 ng of sample template and RNase-free sterile water to reach a final volume of 20 µl. Amplification was performed using the iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad Laboratories) as follows: i) an initial denaturation step at 95°C for 15 min; ii) 45 cycles, with 1 cycle consisting of denaturation at 95°C for 10 s, annealing at 60°C for 30 s and extension at 72°C for 30 s. Q-PCR assays with CT values >40 were considered negative. For each PCR run, a negative (no template) control was used to test for false-positive results or contamination. The absence of non-specific products or primer dimers was confirmed by the observation of a single melting peak in melting curve analysis. For each Q-PCR assay, genes were run in duplicate and all samples tested in three separate experiments. In addition, the standard curve for each gene was constructed using serial dilutions of the cDNA obtained from the tonsil sample. Since PCR efficiencies were close to 100%, the 2-ΔΔCt (Livak) method was used to compare data from miscarriage and term placentas to normal first trimester placentas (control group). The results were expressed as “fold changes” in relative gene expression compared to the control group.

Table 1

Characteristics of the primers used for SYBR green Q-PCR assays.

Target gene	Primera	Primer sequence (5′–3′)	Tm (°C)b	% GC	Ampliconlength (bp)	Accession no.
Human CD100	hCD100_F hCD100_R	GAGAAGCAGCATGAGGTGTA ATGACGGATGTGTAGCTGTG	57,3 57,3	50 50	266	NM_006378 NM_001142287
Human CD72	hCD72_F hCD72_R	CTGAGCAACATGGAGAACAG GCATAAGTCCTAGTGCGTTG	57,3 57,3	50 50	323	NM_001782
Human CD45	hCD45_F hCD45_R	CTGACATCATCACCTAGCAG TGCTGTAGTCAATCCAGTGG	57,3 57,3	50 50	257	NM_002838 NM_080921 NM_080922 NM_080923
Human SDHA	hSDHA_F hSDHA_R	AGCATCGAAGAGTCATGCAG TCAATCCGCACCTTGTAGTC	57,3 57,3	50 50	398	NM_004168

The letters F and R at the end of the primer name indicate forward and reverse orientations, respectively.

Theoretical melting temperature (Tm) calculated using the MWG Oligo Property Scan (MOPS).

Immunohistochemistry

Each paraffin-embedded placenta and tonsil sample was cut into 3 µm serial sections that were then deparaffinized and rehydrated through xylene and a graded series of ethyl alcohol. The first section was stained with hematoxylin-eosin for morphological examination. To inhibit endogenous peroxidase activity, sections were incubated for 30 min with 3% hydrogen peroxide in deionized water. Then, they were washed in 50 mM Tris/HCl, pH 7.6 and pretreated at 98°C in 10 mM sodium citrate, pH 6.0 for 45 min (for membrane-bound and soluble CD100, CD72 and CD45) and for 25 min (for CD68, used as a macrophage marker). To block non-specific background, sections were incubated for 1 h at room temperature (RT) with normal horse serum diluted 1∶75 (for membrane-bound and soluble CD100, CD72 and CD68); or with normal goat serum diluted 1∶75 (for CD45) (Vector Laboratories, Burlingame, CA, USA). Sections were then incubated with the primary antibody (listed in Table 2), overnight at 4°C. In particular, we used two CD100 antibodies, one identifying only the (free) soluble form and another identifying the (membrane-bound) intracytoplasmic portion of CD100, which recognizes both the native and the truncated form. After several washes in 50 mM Tris/HCl, pH 7.6, slides were incubated with biotinylated horse anti mouse antibody (CD100, CD72 and CD68) or biotinylated goat anti rabbit antibody (CD45) diluted 1∶200 for 1 h at RT (both from Vector Laboratories). The peroxidase ABC method (Vector Laboratories) was applied for 1 h at RT using 3′,3′ diaminobenzidine hydrochloride (DAB; Sigma, St Louis, MO, USA) as the chromogen. Sections were counterstained in Mayer’s hematoxylin, dehydrated and mounted with Eukitt solution (Kindler GmbH and Co., Freiburg, Germany). For negative controls, the primary or the secondary antibody was omitted. Further negative controls were performed using non-immune murine or rabbit serum.

Table 2

Antibodies used in the study.

Antibody	Specificity	Ab dilutionfor IH‡	µg of Ab/samplefor IP§	Ab dilutionfor WB∥	Reference
mAb* MCA1269	Human soluble CD100	1∶50	2 µg	1∶1000	AbD Serotec, Oxford, UK
mAb 610670	Human membrane-bound CD100	1∶5	/	1. 500	BD Transduction Laboratories™, Milan, Italy
mAb MCA2501	Human CD72	1∶25	2 µg	1∶1000	AbD Serotec, Oxford, UK
Rabbit pAb† ab10558	Human CD45	1∶10	/	1∶500	Abcam, Cambridge, UK
mAb A5316	Human β-actin	/	/	1∶5000	Sigma-Aldrich, Milan, Italy
mAb M 0814	Human CD68	1∶80	/	/	DAKO Cytomation, Glostrup, Denmark

mAb, monoclonal antibody; pAb, polyclonal antibody; IH, immunohistochemistry; IP, immunoprecipitation; WB, western blotting.

Preparation of Lysates for Biochemical Analysis

Tissue lysates of tonsil and miscarriage, term and first trimester placenta were obtained after complete potter homogenization (Ultra-Turrax T8, IKA®-WERKE, Lille, France) in cold lysis buffer containing 20 mM Tris/HCl, pH 8.0, 1% NP-40, 137 mM NaCl, 1 mM CaCl2, 1 mM MgCl2,10% glycerol, 5 mM EGTA, 10 mM EDTA, and freshly added protease inhibitors (Protease Inhibitor Cocktail, Sigma, Milan, Italy). Extracts were cleared by centrifugation (20,000×g) and protein concentrations assessed with the Bradford protein assay (Bio-Rad Laboratories) [33]. Samples were then immunoprecipitated for analysis of expression of soluble CD100 and CD72, or directly subjected to western blotting for quantitative determination of membrane-bound CD100 and CD45.

Immunoprecipitation

Immunoprecipitation was performed using a 50% slurry of washed GammaBind G Sepharose beads (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) in homogenization buffer; 2 µg of specific antibody (see Table 2) was added to 50 µl of the bead suspension on ice, using a microcentrifuge tube for each sample. Incubation was carried out overnight at 4°C under rotary agitation. The beads were washed five times with lysis buffer to remove unbound antibody, then gently resuspended in 50 µl of the same buffer, and finally pipetted into a test tube containing 2 mg of protein extract (the protein concentration of samples was equalized to 2 mg/ml with lysis buffer). The lysate-beads mixture was incubated overnight at 4°C under rotary agitation and subsequently centrifuged at 1,000×g for 2 min to remove the unbound fraction. The beads were then washed three times with 1 ml of homogenization buffer and centrifuged at 13,000×g for 2 min to remove any residual supernatant. Bound proteins were eluted from the beads by incubation with 40 µl glycine 100 mM, pH 2.5, for 30 min, under agitation at RT. Elutes were neutralized with NaOH 0.1 M.

Western Blotting

Immunoprecipitated proteins (soluble CD100 and CD72) or 100 µg of tissue extract (membrane-bound CD100 and CD45) were denatured in 1X loading denaturing buffer [34]. Samples were boiled for 5 min and fractionated on 10% sodium dodecyl sulphate - polyacrylamide gel electrophoresis (SDS-PAGE). All blots, except membrane-bound CD100 blots, were incubated with 5% bovine serum albumin (BSA, Sigma) in TBS-T 0.1%; membrane-bound CD100 blots were incubated with 5% non-fat dry milk (Bio-Rad Laboratories) in TBS-T 0.1%; then all blots were incubated overnight with the antibodies listed in Table 2. After washing, blots were treated with appropriate secondary antibodies conjugated to horseradish peroxidase and processed with the ECL-Western blotting detection kit (both from Amersham Italia srl, Milan, Italy) according to the manufacturer’s instructions.

The levels of CD100, CD72 and CD45 were assessed in at least three separate experiments per molecule by densitometric analysis using Bio-Rad’s ChemiDoc and Quantity-One software. Relative quantities were expressed as the ratio of the densitometric reading of each protein to the β-actin content of each sample.

Statistical Analysis

Results were expressed as mean + sd (for gene expression) or mean ± sd (for protein expression). A two-tailed t test (PRISM software, version 4 for Windows: GraphPad Software Inc, San Diego, CA) was used to analyze gene and protein expression data. The significance level was considered as low (p≤0.05), medium (p≤0.01) or high (p≤0.001).

Results

CD100 Expression

Q-PCR analysis was applied to establish whether CD100 is transcribed in placental tissue. As shown in Fig. 1a, CD100 mRNA levels never showed significant differences: differences among the four miscarriage groups and differences between any of the miscarriage groups and first trimester or term placenta were not significant, even when comparisons were made with each of the 3 w.g. subgroups (not shown). In contrast, CD100 transcripts showed highly significant down-regulation in term compared with first trimester placenta.

Figure 1

Quantitative RT-PCR of normal pregnancy and miscarriage placenta.

Data are expressed as “fold changes” in relative gene expression measured in miscarriage and term placentas compared with control tissue (first trimester placenta). mRNA expression profiles of a) CD100, b) CD72 and c) CD45 show transcript down-regulation in pregnancy at term (p<0.001) and the highest values in second miscarriage placenta (p>0.05). MC = miscarriage. Asterisks indicate the significance level: low (*), medium (**), high (***).

Immunostaining for soluble CD100 was negative in all placenta samples (not shown). Membrane-bound CD100 was expressed in a subpopulation of Hofbauer cells [Fig. 2a, 3a], identified using CD68 [Fig. 2b, 3b], although these cells were scarcely detectable in first trimester placenta [Fig. 3a]. The positive control (tonsil) for membrane-bound CD100 and for CD68 yielded a positive result on immunohistochemistry [Fig. 4a, d], confirming the quality of the method used.

Figure 2

Tissue from a representative first miscarriage, 9th week of gestation.

Paraffin serial sections. A subpopulation of Hofbauer cells residing in the villous stroma, identified by CD68 (panel b,d,f), are positive for CD100 (panel a, red asterisks), CD72 (panel c, red asterisk) and CD45 (panel e, red asterisks). a,b,c,d,e,f,: Bar = 60 µm.

Figure 3

Representative first trimester placenta (control).

Paraffin serial sections of representative first trimester placenta (9th week of gestation) from a voluntary termination of pregnancy. A subpopulation of Hofbauer cells, identified by CD68 (panel b), are positive for CD100 (panel a, red asterisks). Staining for CD72 (panel c) and CD45 (panel d) is largely negative. a,b,c,d: Bar = 60 µm.

Figure 4

Positive and negative control tissue.

Tonsil tissue was used as a positive control for CD100 (panel a), CD45 (panel b), CD72 (panel c) and CD68 (panel d). A positive reaction for CD100 (panel a, see inset), CD45 (panel b, see inset) and CD72 (panel c, see inset) was detected in lymphocytes, and a positive reaction for CD68 was seen in macrophages (panel d, see inset). Negative control is shown in panel e. a,b,c,d,e: Bar = 30 µm; insets: Bar = 300 µm.

Analysis of western blots failed to disclose soluble CD100 expression in miscarriage, first trimester or term placenta (not shown), whereas membrane-bound CD100 (either the native and the truncated form) was expressed in all samples. The relative abundance of membrane-bound CD100 protein made it possible to analyze its expression by directly loading the protein extracts onto SDS-PAGE, skipping the immunoprecipitation step. Western blot analysis [Fig. 5] revealed that the expression of native CD100 was significantly (p<0.01) lower in first trimester placenta compared with first and second miscarriage and with term placenta [Fig. 5, 6a], and changed with w.g. [Fig. 5, 6b]. When comparisons were made on the basis of w.g., differences were more significant [Fig 5, 6c]. In first trimester placenta and in all miscarriage groups, native CD100 protein expression peaked between the 9th and the 10th week of pregnancy [Fig. 5, 6b].

Figure 5

Native CD100 protein expression in normal pregnancy and in miscarriage.

Representative immunoblot. MC = miscarriage. 8–9 weeks (8≤ w.g. <9); 9–10 weeks (9≤ w.g. ≤10); >10 weeks (w.g. >10). β-actin: housekeeping protein. nCD100: native CD100.

Figure 6

Densitometric analysis of native CD100 protein expression relative to β-actin in normal pregnancy and in miscarriage.

a) Native CD100 protein expression is significantly (p<0.01) lower in the first trimester of gestation than at term as well as in first trimester vs first and second miscarriage (both p<0.01). Its expression level is highest in first and second miscarriage and decreases subsequently. b) In the first trimester and in all miscarriage groups, native CD100 expression increases from the 8th to the 10th week of gestation; these differences are significant only for third (p<0.01) and fourth (p<0.05) miscarriage. A reduction in native CD100 expression after the 10th week is significant for first trimester and for third miscarriage (both p>0.05). Different levels of native CD100 are seen in all miscarriage groups between the 8≤ w.g. <9 and the w.g. >10 subgroups, but not in first trimester. c) In all weeks of gestation, native CD100 expression is significantly lower in first trimester vs first and second miscarriage (both p<0.001). Before the 9th week of pregnancy, it is significantly greater in second vs third and fourth miscarriage (both p<0.001). Between the 9th and the 10th week, native CD100 expression is significantly lower in first trimester placenta vs third and fourth miscarriage (both p<0.01), and significantly higher in second and third miscarriage vs fourth miscarriage (both p<0.05). After the 10th week, its expression is significantly lower in first trimester vs fourth miscarriage (p<0.001). MC = miscarriage. Asterisks indicate the significance level: low (*), medium (**), high (***). 8–9 weeks (8≤ w.g. <9); 9–10 weeks (9≤ w.g. ≤10); >10 weeks (w.g. >10).

The truncated form of CD100 was expressed in placenta specimens and shared a very similar expression profile with native CD100 (not shown).

Tonsil, used as a positive control, showed a strong signal for membrane-bound CD100 on western blotting [Fig. 5].

CD72 Expression

Q-PCR analysis showed very similar expression profiles for CD72 mRNA [Fig. 1b] and protein [Fig. 7, 8a]. However, there were no significant differences in mRNA levels among miscarriage groups or between any of these four groups and first trimester or term placenta. As in the case of CD100, even when comparisons were made with each of the 3 w.g. subgroups, differences were not significant (not shown). In contrast, CD72 transcripts were highly significantly down-regulated in term compared with first trimester placenta [Fig. 1b].

Figure 7

CD72 protein expression in normal pregnancy and in miscarriage.

Representative immunoblot. MC = miscarriage. 8–9 weeks (8≤ w.g. <9); 9–10 weeks (9≤ w.g. ≤10); >10 weeks (w.g. >10). β-actin: housekeeping protein.

Figure 8

Densitometric analysis of native CD72 protein expression relative to β-actin in normal pregnancy and in miscarriage.

a) CD72 is more abundant in first and second miscarriages and absent in term placenta. Significant differences in CD72 expression are detected only in first trimester vs first miscarriage (p<0.05) and in first vs third miscarriage (p<0.01). b) In first trimester and in first, second and third miscarriage, CD72 expression shows a significant increase from the 8th to the 10th week of gestation and subsequently a significant reduction after the 10th week (both p<0.001). Similar CD72 expression levels are found in first trimester and in first, second and third miscarriage between the 8≤ w.g. <9 and the w.g. >10 subgroups. c) Trend of CD72 expression in first trimester and in the four miscarriage groups at approximately the same gestational week. Before the 9th and after the 10th week, CD72 expression is significantly greater in first miscarriage vs first trimester (p<0.001) and significantly lower in second, third and fourth miscarriage vs first miscarriage (p<0.001). Between the 9th and the 10th week, CD72 expression is significantly lower in first trimester vs first and second miscarriage (both p<0.001) and significantly higher in second miscarriage vs third and fourth miscarriage (both p<0.001). MC = miscarriage. Asterisks indicate the significance level: low (*), medium (**), high (***). 8–9 weeks (8≤ w.g. <9); 9–10 weeks (9≤ w.g. ≤10); >10 weeks (w.g. >10).

CD72 immunostaining was detected in all four miscarriage groups, in a subpopulation of Hofbauer cells [Fig. 2c], identified using CD68 [Fig. 2d], but not in first trimester placenta [Fig. 3c].

Western blot analysis documented CD72 expression [Fig. 7] in all placenta samples. It was significantly (p<0.05) increased in first miscarriage compared with first trimester placenta, and significantly (p<0.01) decreased in third miscarriage compared with first miscarriage [Fig. 7, 8a]. When comparisons were made on the basis of w.g. [Fig.7, 8b], differences among placental groups were more significant [Fig. 7, 8c]. Interestingly, CD72 expression peaked between the 9th and the 10th w.g. in several sample groups (first trimester placenta and first, second and third miscarriage) [Fig.7, 8b].

Tonsil, used as a positive control, exhibited strong CD72 and CD68 protein expression on immunohistochemistry [Fig. 4b, d] and western blotting [Fig. 7].

CD45 expression

Q-PCR analysis showed very similar expression profiles for CD45 mRNA [Fig. 1c] and protein [Fig. 9, 10a] except in term placentas, where transcript levels were considerably lower. The differences in mRNA levels among the four miscarriage groups and differences between any of the miscarriage groups and first trimester or term placenta were not significant, even when comparisons were made with each of the 3 w.g. subgroups (not shown). In contrast, CD45 transcripts were highly significantly down-regulated in term compared with first trimester placenta [Fig. 1c].

Figure 9

CD45 protein expression in normal pregnancy and in miscarriage.

Representative immunoblot. MC = miscarriage. 8–9 weeks (8≤ w.g. <9); 9–10 weeks (9≤ w.g. ≤10); >10 weeks (w.g. >10). β-actin: housekeeping protein.

Figure 10

Densitometric analysis of native CD45 protein expression relative to β-actin in normal pregnancy and in miscarriage.

a) CD45 expression is significantly (p<0.01) lower in the first trimester of gestation than at term. Its expression is highest in second miscarriage and declines subsequently. Differences are significant only in first trimester vs second miscarriage (p<0.01). b) In the first trimester and in all miscarriage groups, CD45 expression increases from the 8th to the 10th week; these differences are significant only for first (p<0.05), second (p<0.05) and third (p<0.01) miscarriage. A reduction in CD45 expression after the 10th week is significant for first trimester (p<0.01) and for first (p<0.05), second (p<0.05) and third (p<0.001) miscarriage. Similar CD45 expression levels are found in all miscarriage groups between the 8≤ w.g. <9 and the w.g. >10 subgroups, with the exception of third miscarriage and first trimester, where they are significantly lower in the samples with gestational age >10th week (both p<0.01). c) In all weeks of gestation, CD45 expression is significantly lower in first trimester vs first (p<0.001) and second (p<0.001) miscarriage and in first vs second miscarriage (p<0.05). Before the 9th and after the 10th week, it is significantly greater in second miscarriage vs third and fourth miscarriage (both p<0.001). Between the 9th and the 10th week, CD45 expression is significantly decreased not only in second vs third (p<0.05) and fourth miscarriage (p<0.001), but also in third vs fourth miscarriage (p<0.001). MC = miscarriage. Asterisks indicate the significance level: low (*), medium (**), high (***). 8–9 weeks (8≤ w.g. <9); 9–10 weeks (9≤ w.g. ≤10); >10 weeks (w.g. >10).

In miscarriage placenta, CD45 immunopositivity was detected in a subpopulation of Hofbauer cells [Fig. 2e] identified by CD68 [Fig. 2f] and in syncytiotrophoblasts, whereas most specimens from normal first trimester pregnancies showed no macrophage reactivity and weak heterogeneous syncytial staining [Fig. 3d].

Since CD45 protein is abundant in placenta, its expression was analyzed by directly loading the protein extracts onto SDS-PAGE, as in the case of CD100. Representative western blots are shown in Fig. 9. CD45 expression was significantly (p<0.01) lower in first trimester than in second miscarriage and term placenta [Fig. 9, 10a]. As in the case of both CD100 and CD72, its expression changed markedly with w.g. [Fig. 9, 10b]. When comparisons were made on the basis of w.g., differences were more significant [Fig 9, 10c]. In first trimester placenta and in all miscarriage groups, CD45 protein expression peaked between the 9th and the 10th week of pregnancy [Fig. 9, 10b].

Tonsil, used as a positive control, revealed strong CD45 and CD68 expression on immunohistochemistry [Fig. 4c, d] and western blotting [Fig. 9].

Discussion

To the best of our knowledge, this is the first study investigating the expression of CD100, CD72 and CD45 mRNA and protein in placenta from miscarriage, the commonest complication of pregnancy. The three molecules are known to play a role in the immune system, which has come to be recognized as an important factor in miscarriage. We found similar CD100, CD72 and CD45 mRNA and protein profiles, but different expression levels, in miscarriage compared to normal pregnancy. The western blotting data were confirmed by the immunohistochemical findings. In particular, tissue from the majority of normal first trimester pregnancies showed no CD100 and CD72 staining and weak heterogeneous syncytial staining for CD45, whereas in all miscarriage groups the three molecules were expressed by subpopulations of Hofbauer cells (placental macrophages) residing in the villous placental stroma. Absence of native CD100, which is normally expressed by macrophages, results in reduced macrophage recruitment; therefore, the CD100 found in Hofbauer cells, independently of its effects on the adaptive immune response, could have a role in macrophage recruitment, as described in other organs [35]. We also found that part of the CD100 expressed by Hofbauer cells was cleaved from their surface, giving rise to the soluble form [30]. This form results from phosphorylation of cytoplasmic CD100, which is associated to serine and/or threonine kinase activities [36]. CD100 and CD45 form a functional association in immune cells; their levels increase during immune system activation [28], promoting the maturation and differentiation of these cells [29]. CD45 is endowed with intrinsic protein tyrosine phosphatase (PTPase) activity [37], which is responsible for initial activation of the serine and/or threonine kinase associated to CD100. CD45 was abundant in placental macrophages and in syncytiotrophoblasts from miscarriage tissue and shared a similar expression profile with CD100. This finding corroborates the production of the soluble CD100 form, which is immediately shed from placental tissue, as shown by its absence in placental villi of all samples. Moreover, since soluble CD100 release from the immune cell surface is well regulated and strictly dependent on cell activation [38], this form enhances the immune response by acting on remote immune cells in a similar manner to other diffusible factors, such as cytokines and chemokines. CD100 could therefore be involved in immune response stimulation in miscarriage, supporting the hypothesis of high levels of fetal immune system activity during pregnancy loss [18]. It is thus reasonable to speculate that membrane-bound CD100 might constitute a reservoir of soluble CD100, enabling a stronger immune response [39]. A role for CD45 in fetal immunotolerance may also be hypothesized. The present findings suggest that high CD45 expression could be associated to fetal rejection of maternal cells. Excessive amounts of CD45 protein in placenta tissue probably enhance release of soluble CD100, which fetal mechanisms are unable to break down. Interestingly, soluble CD100 levels in the sera of patients with autoimmune diseases correlate with autoantibody titre, suggesting that its determination could help monitor disease activity [38].

These data lend support to the hypothesis that soluble CD100 is released in maternal blood and acts on maternal cells. Notably, CD45 expression was higher in term compared with first trimester placenta despite exhibiting lower mRNA levels in the former specimens. Increased CD45 protein expression at the end of pregnancy is an index of strong fetal immune system activation; high activation levels may exceed immunotolerance by the fetus, precipitating labor. CD72 immunostaining was also detected in a subpopulation of Hofbauer cells. The molecule functions as a negative regulator, blocking immune cell responses in normal conditions. Immune activation by soluble CD100 turns off its inhibitory signal [26]. Interestingly, CD72 protein was higher in first trimester than in term placentas, as shown by western blot analysis, suggesting its involvement in pregnancy maintenance. The almost overlapping expression patterns of CD72 and CD45 proteins found in all miscarriage groups suggest a link between CD45 over-expression and CD72 up-regulation.

The expression of CD100, CD72 and CD45 seemed to be finely regulated, because small gestational week increments induced strong changes. An outstanding question is why their expression was most altered in first and second miscarriage placenta compared with third and fourth miscarriage tissue, particularly around the 10th w.g. It is indeed surprising that their levels increase on this particular w.g., when progesterone production switches from the corpus luteum to the placenta. The fact that progesterone has a role in modulating macrophage activation [40] suggests that it can exert an influence on macrophage expression of CD100, CD72 and CD45 precisely on the 10th week of gestation.