Literature DB >> 22588436

Expression of testis-specific genes, TEX101 and ODF4, in chronic myeloid leukemia and evaluation of TEX101 immunogenicity.

Soudeh Ghafouri-Fard1, Mohammad Hossein Modarressi, Fatemeh Yazarloo.   

Abstract

BACKGROUND AND OBJECTIVES: Cancer-testis (CT) antigens are a group of antigens with a restricted expression in normal tissues, except testis, and they have aberrant expression in different tumors. This pattern of expression has made them promising targets for immunotherapy and cancer detection. Our aim was to find new members of this group that might be useful as markers in the detection of cancer and immunotherapy. DESIGN AND
SETTING: A descriptive study conducted in referral centers of Tehran University of Medical Science from January 2008 to January 2009. PATIENTS AND METHODS: We analyzed the expression of two testis-specific genes named ODF4 (outer dense fiber of sperm tails 4) and TEX101 (testis expressed 101) in 20 chronic myeloid leukemia (CML) and 20 normal samples by reverse transcription-polymerase chain reaction and sequencing. Immunogenicity of TEX101 was evaluated by means of enzyme-linked immunosorbent assay.
RESULTS: These two genes were expressed in 30% of CML patients but not in any of the healthy donors. Humoral response against TEX101 was not detected in any samples.
CONCLUSIONS: TEX101 and ODF4 are CT genes useful for detection of CML. Unlike many CT genes, overexpression of TEX101 was not shown to induce immunologic responses in these samples. According to the previous studies, overexpression of TEX101 leads to suppression of cancer invasion and metastasis; thus, the induction of the expression of TEX101 in cancer by epigenetic mechanisms may be a treatment strategy.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22588436      PMCID: PMC6081032          DOI: 10.5144/0256-4947.2012.256

Source DB:  PubMed          Journal:  Ann Saudi Med        ISSN: 0256-4947            Impact factor:   1.526


Chronic myeloid leukemia (CML) is a malignant clonal disorder of the hematopoietic system that leads to an increased number of myelocytes, erythrocytes, and thrombocytes in peripheral blood. The molecular hallmark of CML is the Philadelphia chromosome, a reciprocal t(9,22) translocation. This abnormal chromosome is found in cells from the myeloid, erythroid, megakaryocytic, and B lymphoid lineages, indicating the presence of a “cancer stem cell” that is capable of producing several types of differentiated cancer cells.1 The development of leukemia-specific immunotherapies, such as the application of cancer vaccines for leukemia patients, depends on the molecular definition of immunogenic leukemia-associated antigens that are specifically recognized by the immune system. One important group of tumor-associated antigens is cancer-testis (CT) antigens. The limited expression of these genes in normal tissues and their expression in various types of tumors make them appropriate candidates for immunotherapy. As these genes are expressed almost only in male germ cells and trophoblast among normal cells. Since these cells do not express major histocompatibility complex class I molecules, their expression cannot result in presentation of the antigenic peptides. In addition, tight junctions between Sertoli cells along the basolateral aspect and between capillary endothelial cells have a role in maintaining the mechanical barrier between blood and testis, and testis is considered an immune-privileged site.2–4 If testis-specific genes are expressed in other tissues, they can elicit immune responses. For effective specific immunotherapies, extended studies on the expression and function of these genes, and their immunogenicity in leukemia are required. In the last decade, increasingly more CT antigens have been identified in hematological malignancies. The stem cell model of cancer suggests that certain cancer cells acquire stem cell–like characteristics via genetic mutations and epigenetic defects or fusion of circulating stem cells with cancer cells. Some CT antigens such as NRAGE (MAGED1, melanoma antigen family D, 1), NY-ESO (CTAG1B, cancer/testis antigen 1B), MAGE-1(melanoma antigen family A, 1), and SSX (synovial sarcoma, X) are expressed in human mesenchymal stem cells of the bone marrow, suggesting that the expression of CT antigens may be a hallmark not only of gametogenesis, but also of a stem cell marker. It has been suggested that the CT antigen expression in tumor tissues is restricted to cells that retain stem cell properties, favoring tumor maintenance, proliferation, and metastasis.5 CT antigens not only are expressed in hematological malignancies, but also induce B cell immunity in these patients. High-titer immunoglobulin G antibodies have been observed for many of them in different hematological malignancies.6 We have analyzed expression of two testis-specific genes, TEX101 (testis expressed 101) and ODF4 (outer dense fiber of sperm tails 4), in CML samples at the mRNA and protein levels to find an appropriate candidate for detection of tumor cells as well as targets for new therapeutic approaches. ODF4 is a testis-specific gene, expressed in the outer dense fibers of the tails of mature sperm. It was first isolated from a subtracted complementary DNA (cDNA) library of mouse testis.7 Later, the human ortholog of ODF4 was cloned and its mRNA was expressed exclusively in the testis; the 30 kDa protein encoded by the mRNA was detected in the flagellae of ejaculated sperm, and its gene was mapped to chromosome 17.8 Then the full-length cDNA of ODF4 gene was isolated using 5′ RACE and 3′ RACE.9 The ODF4 expression was assessed in basal cell carcinoma and prostate adenocarcinoma, but it was not expressed in either of them.10,11 TEX101 gene encodes a glycophosphatidylinositol-anchored cell surface protein known as testis-expressed protein 101 or cell surface receptor NYD-SP8. Coimmunoprecipitation experiments showed that NYD-SP8 binds to urokinase plasminogen activator receptor/urokinase plasminogen activator complexes and may be involved in extracellular matrix proteins degradation.12 Overexpression of TEX101 reduces activities of the following three major classes of proteases known to be involved in extracellular matrix degradation: uPA, matrix metalloproteinases, and cathepsin B, which lead to suppression of both in vitro and in vivo cancer cell invasion and metastasis.12 TEX101 mRNA has 4 alternative splicings, (http://www.ncbi.nlm.nih.gov/gene) and this mRNA has been shown to be expressed in basal cell carcinoma.10 We evaluated the expression of these two testis-specific genes in 20 normal healthy donors and 20 CML samples, and we screened the sera from CML patients for antibodies against TEX101 to estimate its capacity to induce humoral immune responses in vivo, which might be used as diagnostic or prognostic tools in CML.

PATIENTS AND METHODS

Blood samples were collected from 20 patients with confirmed CML diagnosis by molecular and cytogenetics methods and from 20 healthy people. All participants had given informed consent. The approval was obtained through the Investigation Review Board at Tehran University of Medical Sciences. This study was also approved by the Ethics and Clinical Studies Committee of Tehran University of Medical Sciences.

RNA Extraction, cDNA synthesis, and RT-PCR

Total RNA was isolated from leukocytes of patients using Tripure isolation reagent (Roche, Mannheim, Germany) according to the manufacturer’s instructions with minor modifications. The mRNA expression of these CT antigens was evaluated using reverse transcription (RT) and polymerase chain reaction (PCR). RT was carried out in each sample using random hexamer primers (Pharmacia, Sweden) and MMLV reverse transcriptase (Invitrogen, Carlsbad, CA) on 1 mg of total RNA. PCR reactions were performed using specific primers for ODF4, TEX101, and HPRT1 for checking cDNA quality. The primers were: ODF4-F: 5′-GCTTATCCTATACTTCACCTGCG-3′ ODF4-R: 5′-GCCAGAGTTCAGAAAAGATTACAC-3′ TEX101-F: 5′-GGGAGTTCAGTGAGACCACAG-3′ TEX101-R: 5′-TGCACCTCCAGTGATCTCAAG-3′ HPRT-F: 5′-GCATTGTTTTGCCAGTGTCAA-3′ HPRT-R: 5′-ATTGTAATGACCAGTCAACAGGG-3′ All primers were positioned in different exons of each gene to avoid false positive results caused by genomic DNA contamination of the RNA preparation. Primers for TEX101 amplification were designed in a way that they could amplify all possible transcripts of this gene. PCR was performed using 30 amplification cycles in a thermal cycler at annealing temperature of 60°C for TEX101 and HPRT1; and 55°C for ODF4. Each set of PCR reactions contained a positive control of cDNA derived from normal testis and a negative control containing all of the PCR reaction mixture except for cDNA that was substituted with water. The integrity of RNA was checked in each PCR reaction by multiplex amplification for the HPRT1 gene segment. PCR products were subjected to electrophoresis and run in a 1.8% agarose gel containing ethidium bromide, and then photographed under ultraviolet light. The specificity of primers was also confirmed by sequencing of PCR products using ABI Prism3130 Genetic Analyzer (Applied Biosystems, Foster City, CA).

TEX101 cloning

Open reading frame of TEX101 gene was amplified using specific primers having BamH1 restriction site (F: CGGATCCATGGGAACCCCTCGTATCCA, R: CGGGATCCAAGTGCCTTCTTAGGAAAAGTG). PCR was performed on cDNA of a normal testis sample. The PCR product was then inserted in BamH1 restriction sites of the Pmal-C2X vector. Competent cells from XL1-Blue Escherichia coli strain were transformed by a recombinant vector. Positive clones were selected by PCR using a specific primer for TEX101 gene and a specific primer for the vector (M13_PUC_F: CCCAGTCACGACGTTGTAAAACG). The recombinant vector sequence was then confirmed by sequencing.

TEX101 protein expression

A stock culture of E coli expressing a TEX101 protein was streaked on selective agar plates containing antibiotics and incubated for 16 hours at 37°C. One colony was picked using a sterile wooden stick and inoculated in a test tube with 2 mL of Luria broth (LB) that contained antibiotics. The tube was placed in a 37°C shaking incubator and incubated for 8 hours. The culture was then transferred to a 2-mL microcentrifuge tube and centrifuged for 1 minute at 14 000g. A 2-mL volume of fresh LB with antibiotics was used to resuspend the cell pellet. This was then added to 50 mL of LB with antibiotics and placed in a 37°C shaking incubator until the optical density at 600 nm reached approximately 0.5. The recombinant protein expression in bacterial cells was then induced by isopropyl-beta-thio galactopyranoside, and bacterial cells were cultured for 3 hours. A 12.5% polyacrylamide gel was prepared for SDS-PAGE analysis. A 5-μL aliquot of each elution was transferred to a fresh microcentrifuge tube, to which 3 μL of 3× loading dye was added. The samples were mixed, boiled for 2 minutes, and then loaded onto the polyacrylamide gel. Western blot analysis was done on the recombinant TEX101 protein as well as the testis tissue lysate, using mouse polyclonal antibody to TEX101 (ab69522) and rabbit polyclonal secondary antibody to mouse IgG-H&L (HRP) (ab6728).

Enzyme-linked immunosorbent assay

100 μL of 20 μg/mL elution of the recombinant TEX101 protein was coated on enzyme-linked immunosorbent assay (ELISA) wells. The ELISA experiment was done using 100 μL of patients’ plasma samples. After 1 hour incubation in 37°C and 3 times washing, 1/2000 elution of rabbit polyclonal secondary antibody to human IgG-HandL (HRP), preadsorbed (ab7160) was added to wells. After 1 hour incubation in 37°C and 3 times washing, the reaction was visualized using 100 μL 3,3′,5,5′-tetramethyl benzidine (US Biological, Marblehead, MA, USA).

RESULTS

Gene expression analysis

RT-PCR amplifications of cDNAs obtained from samples were performed using specific primers for mentioned genes. None of normal samples expressed ODF4 or TEX101. Each specific band for TEX101 and ODF4 was seen in 6 of 20 (30%) patients’ samples (Figure 1). Sequencing of PCR products confirmed specificity of primers (Figure 2). The size of the amplicon in CML patients was the same as in the case of testis (Figure 1), and the DNA sequence analysis confirmed no mutations. Available demographic data of patients showed no significant association with the gene expression pattern in sex, age, and other parameters. No overlap for TEX101 and ODF4 expression was observed in 20 CML samples.
Figure 1

RT-PCR results for ODF4, TEX101, and HPRT1. Lane 1: negative control; lane 2: positive control; lanes 3–8: different positive samples; lane 9: 100 bp DNA marker.

Figure 2

Sequencing results. a: ODF4, b: TEX101

TEX101 cloning and recombinant protein production

Colonies containing the favorable fragment were selected by PCR using a specific primer for TEX101 gene and a specific primer for the vector, and the DNA sequence of the insert was assessed. PCR and sequencing results of selected colonies are shown in Figures 3 and 4, respectively. Colonies having the true inserted TEX101 fragment were selected for further steps of recombinant protein induction. In addition, DNA sequencing of the inserted fragment using an upstream primer from the vector confirmed that the inserted fragment has no mutation. The result of induction of the recombinant TEX101 protein production is shown in Figure 5. As an internal control and to compare the protein size of vector containing the insert with the intact vector, the Pmal-C2X vector was induced to produce protein (Figure 5, lane 2). Uninduced vectors also were run as negative controls (Figure 5, lanes 1 and 3). The size comparison of the induced recombinant protein with the protein size marker showed the predicted protein size for the TEX101 recombinant protein.
Figure 3

Colony PCR results: colonies 1, 3, and 4 show specific bands of TEX101. Lane 7: positive control; lane 8: 100 bp DNA marker.

Figure 4

Sequencing result of a selected recombinant colony.

Figure 5

Recombinant protein induction. Lanes 1 and 2: uninduced and induced bacteria having intact Pmal-C2x vector, respectively; lane 3: protein size marker; lanes 4 and 5: uninduced and induced bacteria having recombinant fragment, respectively.

We tested the presence of circulating anti-TEX101 antibody using the purified recombinant TEX101 protein in the ELISA system in sera of CML patients. The optical density assessment of samples at 450 nm showed no significant difference between patients and normal samples, so we concluded that the humoral response against TEX101 was not detected by ELISA in our CML patients. As ELISA results for patient samples were not positive, further Western blot analysis was not done on samples.

DISCUSSION

CML is caused by a t(9;22)(q34;q11) chromosomal translocation and expression of the Bcr-Abl fusion protein. Enhanced, unregulated tyrosine kinase (TK) activity of the Bcr-Abl is causative for CML.13 Bcr-Abl fusion protein is one of the most studied CML antigens as a potential target for immunotherapy, but attempts to develop immunotherapy approaches against this protein have failed. Therefore, identifying novel tumor antigens that can be targeted to develop immunotherapy against CML is urgently needed.14 A highly restricted expression of CT antigens in normal tissues and a broad expression in a wide range of different tumor types have made CT antigens attractive targets for immunotherapy. Earlier we have demonstrated the diagnostic and therapeutic significance of TEX101 in prostate cancer and basal cell carcinoma. 10,11 As CT antigens are known for their ability to cause spontaneous humoral and cellular immune responses in vivo, they are considered targets for active immunotherapy. The ELISA methodology can be used for screening of patients’ sera for the presence of antibodies against CT antigens and for the identification of patients having high-titer serological responses to these antigens. In immunotherapeutic approaches, first it is necessary to identify patients who will benefit from a specific treatment. The differential expression of molecules involved in the sensitivity of the tumor cells to a specific therapy might explain the varying responses of patients to different therapeutic approaches such as immunotherapy, and might provide important tools for investigating this aspect in the clinic. In this study, we reported the expression of TEX101 and another testis-specific gene named ODF4 in CML patients and searched for the presence of specific antibodies against TEX101 in patients’ sera. Although TEX101 mRNA was found in 30% of patients, none of them had antibodies against it. The absence of humoral immune responses against the majority of CT antigens might be explained by their low expression, but the cause of inability of TEX101 to induce immune responses in CML patients is unclear. However, in our study, the lack of detection of anti-TEX101 humoral response in patients may be because of insufficient sample size, low level of protein expression, and the fact that most of studied patients were in the initial phases of their disease. In a study, it has been shown that 90% of CML patients have a humoral response against SPAG9, a known CT antigen.14 In contrast, in some other studies, the humoral response against some CT antigens was not detected in spite of high mRNA expression.15 So the lack of antibody response observation in this study was not an unpredictable event. However, further studies with greater sample size are recommended. A relationship between some CT antigen expression and higher tumor grades has been shown in transitional cell carcinomas of the urinary bladder,16 in certain types of brain tumors,17 and in endometrial cancer.18 It has been suggested that overexpression of TEX101 suppresses cancer cell invasion and metastasis; 12 therefore, in contrast with most CT antigens, an aberrant expression of TEX101 in CML patients should be correlated with a better prognosis and reduced metastasis and needs to be assessed in further studies. Although in most patients, the immunologic response against CT antigens is considered a good prognostic factor, in the case of TEX101, the function of overexpressed antigen may make this issue different. The lack of immunologic response in these patients despite the expression of TEX101 at the mRNA level, may be a good prognostic factor and needs to be investigated in future studies. The TEX101 protein binds to the urokinase plasminogen activator receptor (UPAR) and reduces the activity of uPA. In addition, interactions of UPAR in cells with a variety of signal transduction molecules including TKs have been described.19 So if the TEX101 protein is expressed in CML, it may indirectly have an interaction with the Bcr-Abl fusion protein. The primary regulator of CT gene expression in normal and cancer cells is an epigenetic mechanism, particularly DNA methylation. It was shown that demethylation agent 5-aza-2′-deoxycytidine can induce MAGE-A1 transcription in cell cultures, and the site-specific hypomethylation of MAGE-A1 in tumor cells depends on demethylation and then a persistent local inhibition of remethylation.20 It is quite likely that overexpression of TEX101 and ODF4 in CML patients may be because of hypomethylation of these genes and warrants further investigation. A combinatorial therapeutic approach involving epigenetic modulatory drugs and CT antigen immunotherapy is suggested for many types of cancers.21 In the case of TEX101, it seems that therapeutic approaches should focus on its overexpression to reduce invasion and metastasis in cancers. TEX101 is one of few CT genes reported to be expressed at the surface of cells; therefore, it is a suitable potential target of molecular manipulations to eradicate disease. Furthermore, the expression of TEX101 in different types of tumors may imply a potential role for it in the molecular mechanism of carcinogenesis or it may be simply a by-product of hypomethylation in cancer. In future studies, the TEX101 expression should be assessed in different tumor types regarding its correlation with tumor grade and stage. Briefly, the therapeutic strategy regarding TEX101 can be to enhance its expression by epigenetic tools. This strategy can both be protective against metastasis and trigger an immune response because of its restricted expression in testis. As discussed before, because of existence of blood-testis barrier, if testis-specific genes are expressed in other tissues at a detectable level for the immune system, they can elicit immune responses. If future studies reveal the expression of TEX101 at the protein level and the presence of humoral responses against this gene in cancers, it can be more suitable target for immunotherapy. However, the expression pattern of ODF4 in testis and CML makes this gene appropriate for immunotherapeutic approaches as well as detection of cancer.
  21 in total

1.  Isolation and expression analysis of the testis-specific gene, human OPPO1.

Authors:  Toshinobu Miyamoto; Kazuo Sengoku; Hiroaki Hayashi; Yoshihito Sasaki; Naoyuki Takuma; Tsuyoshi Yamashita; Mutsuo Ishikawa
Journal:  J Assist Reprod Genet       Date:  2004-04       Impact factor: 3.412

Review 2.  The blood-testis barrier and Sertoli cell junctions: structural considerations.

Authors:  R M Pelletier; S W Byers
Journal:  Microsc Res Tech       Date:  1992-01-01       Impact factor: 2.769

Review 3.  Getting to the stem of chronic myeloid leukaemia.

Authors:  Michael Savona; Moshe Talpaz
Journal:  Nat Rev Cancer       Date:  2008-05       Impact factor: 60.716

Review 4.  Cancer-testis antigens: potential targets for cancer immunotherapy.

Authors:  Soudeh Ghafouri-Fard; Mohammad-Hossein Modarressi
Journal:  Arch Iran Med       Date:  2009-07       Impact factor: 1.354

5.  Elevated expression levels of testis-specific genes TEX101 and SPATA19 in basal cell carcinoma and their correlation with clinical and pathological features.

Authors:  S Ghafouri-Fard; A Abbasi; H Moslehi; N Faramarzi; S Taba Taba Vakili; M B Mobasheri; M H Modarressi
Journal:  Br J Dermatol       Date:  2009-11-03       Impact factor: 9.302

6.  Expression of two testis-specific genes, SPATA19 and LEMD1, in prostate cancer.

Authors:  Soudeh Ghafouri-Fard; Zahra Ousati Ashtiani; Bareto Sabah Golian; Seyyed-Mohammad Hasheminasab; Mohammad Hossein Modarressi
Journal:  Arch Med Res       Date:  2010-04       Impact factor: 2.235

Review 7.  Regulation of cancer germline antigen gene expression: implications for cancer immunotherapy.

Authors:  Stacey N Akers; Kunle Odunsi; Adam R Karpf
Journal:  Future Oncol       Date:  2010-05       Impact factor: 3.404

Review 8.  Concise review: cancer/testis antigens, stem cells, and cancer.

Authors:  Fabrício F Costa; Katarina Le Blanc; Bertha Brodin
Journal:  Stem Cells       Date:  2006-11-30       Impact factor: 6.277

9.  Sperm associated antigen 9 expression and humoral response in chronic myeloid leukemia.

Authors:  Deepika Kanojia; Manoj Garg; Shikha Saini; Sumit Agarwal; Rajive Kumar; Anil Suri
Journal:  Leuk Res       Date:  2010-02-06       Impact factor: 3.156

10.  Molecular cloning and characterization of the human orthologue of the oppo 1 gene encoding a sperm tail protein.

Authors:  Kouichi Kitamura; Yasushi Miyagawa; Naoko Iguchi; Hiromi Nishimura; Hiromitsu Tanaka; Yoshitake Nishimune
Journal:  Mol Hum Reprod       Date:  2003-05       Impact factor: 4.025

View more
  6 in total

1.  Transcriptome analysis of the cancer/testis genes, DAZ1, AURKC, and TEX101, in breast tumors and six breast cancer cell lines.

Authors:  Maryam Beigom Mobasheri; Reza Shirkoohi; Kazem Zendehdel; Issa Jahanzad; Saeid Talebi; Mandana Afsharpad; Mohammad Hossein Modarressi
Journal:  Tumour Biol       Date:  2015-05-21

Review 2.  A Role of the TEX101 Interactome in the Common Aetiology Behind Male Subfertility and Testicular Germ Cell Tumor.

Authors:  Joshua Burton; Marcin W Wojewodzic; Trine B Rounge; Trine B Haugen
Journal:  Front Oncol       Date:  2022-06-14       Impact factor: 5.738

3.  Human testis-expressed sequence 101 is limitedly distributed in germinal epithelium of testis and disappears in seminoma.

Authors:  Cong-Cong Shen; Yu-Huan Kang; Lin Yu; Dan-Dan Cui; Yi He; Jin-Liang Yang; Lan-Tu Gou
Journal:  Biol Res       Date:  2014-10-01       Impact factor: 5.612

4.  Upregulation of RHOXF2 and ODF4 Expression in Breast Cancer Tissues.

Authors:  Golnesa Kazemi-Oula; Soudeh Ghafouri-Fard; Maryam Beigom Mobasheri; Lobat Geranpayeh; Mohammad Hossein Modarressi
Journal:  Cell J       Date:  2015-10-07       Impact factor: 2.479

5.  Long Non Coding RNA Expression Intersecting Cancer and Spermatogenesis: A Systematic Review

Authors:  Ali Dianatpour; Soudeh Ghafouri-Fard
Journal:  Asian Pac J Cancer Prev       Date:  2017-10-26

Review 6.  Immunotherapy in Multiple Myeloma Using Cancer-Testis Antigens.

Authors:  Soudeh Ghafouri-Fard; Mahnaz Seifi-Alan; Roshanak Shamsi; Ali Esfandiary
Journal:  Iran J Cancer Prev       Date:  2015-10-27
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.