| Literature DB >> 2258648 |
K Kobayashi1, K Seto, S Akasaka, M Makino.
Abstract
A rapid and simple procedure using polymerase chain reaction (PCR) was developed for the detection of cholera enterotoxin (CT) producing character. This method is based on amplifying a 380 base pair (bp) segment of the CT gene (ctx) which controls the production of CT. Two single-stranded oligonucleotides, synthetized to be complementary to the known nucleotide sequences of genes encoding the A-subunit of ctx, were used as extension primers. The oligonucleotide sequences are 5'TCAAACTATATTGTCTGGTC (CT-1) and 5'CGCAAGTATTACTCATCGA (CT-2). As template DNA was used 5 microliter of boiled bacterial culture broth at 95 degrees C for 5 min without the need for DNA extraction. The amplified target DNA were confirmed with only CT producing Vibrio cholerae O1 but not with CT non-producing organisms such as heat labile enterotoxin producing Escherichia coli by electrophoretic analysis of PCR mixture after amplification. A few isolates of CT producing V. mimicus and V. cholerae non-O1 were identified.Entities:
Mesh:
Substances:
Year: 1990 PMID: 2258648 DOI: 10.11150/kansenshogakuzasshi1970.64.1323
Source DB: PubMed Journal: Kansenshogaku Zasshi ISSN: 0387-5911