| Literature DB >> 22572637 |
Matthew D Yates1, Patrick D Kiely, Douglas F Call, Hamid Rismani-Yazdi, Kyle Bibby, Jordan Peccia, John M Regan, Bruce E Logan.
Abstract
Microbial fuel cells (MFCs) are often inoculated from a single wastewater source. The extent that the inoculum affects community development or power production is unknown. The stable anodic microbial communities in MFCs were examined using three inocula: a wastewater treatment plant sample known to produce consistent power densities, a second wastewater treatment plant sample, and an anaerobic bog sediment. The bog-inoculated MFCs initially produced higher power densities than the wastewater-inoculated MFCs, but after 20 cycles all MFCs on average converged to similar voltages (470±20 mV) and maximum power densities (590±170 mW m(-2)). The power output from replicate bog-inoculated MFCs was not significantly different, but one wastewater-inoculated MFC (UAJA3 (UAJA, University Area Joint Authority Wastewater Treatment Plant)) produced substantially less power. Denaturing gradient gel electrophoresis profiling showed a stable exoelectrogenic biofilm community in all samples after 11 cycles. After 16 cycles the predominance of Geobacter spp. in anode communities was identified using 16S rRNA gene clone libraries (58±10%), fluorescent in-situ hybridization (FISH) (63±6%) and pyrosequencing (81±4%). While the clone library analysis for the underperforming UAJA3 had a significantly lower percentage of Geobacter spp. sequences (36%), suggesting that a predominance of this microbe was needed for convergent power densities, the lower percentage of this species was not verified by FISH or pyrosequencing analyses. These results show that the predominance of Geobacter spp. in acetate-fed systems was consistent with good MFC performance and independent of the inoculum source.Entities:
Mesh:
Year: 2012 PMID: 22572637 PMCID: PMC3475369 DOI: 10.1038/ismej.2012.42
Source DB: PubMed Journal: ISME J ISSN: 1751-7362 Impact factor: 10.302
Figure 1Average maximum voltage (n=3) in each cycle for each inoculum source (B=bog, P=PSU and U=UAJA).
Figure 2Power density curves generated from cycle 16 showing that UAJA replicate 3 produced far less power than all other reactors, including other UAJA replicates. Legend order mimics the order of the curves based on max power density.
Figure 3Abundance of clones with sequence identity to dominant classes in each reactor from cycle 16. UAJA3 had the lowest number of clones showing similarity to Deltaproteobacteria. The group labeled as other consists of sequences with <95% identity. Insert: the majority of the Deltaproteobacteria were Geobacter sulfurreducens.
Figure 4Community analysis results obtained from pyrosequencing. No significant difference in the amount of Proteobacteria was seen in any reactor. Insert: the Deltaproteobacteria was made up almost entirely of Geobacter and Trichlorobacter (95%). Other minor genera were detected by pyrosequencing that were not detected in the clone libraries.
Shannon Diversity Indices and Good's coverage values calculated from 16S rRNA gene clone library and pyrosequencing data taken during cycle 16
| Bog 1 | 93 | 1.57 | 86 | 3413 | 3.82 |
| Bog 2 | 92 | 1.94 | 80 | 1757 | 4.04 |
| Bog 3 | 92 | 1.45 | 89 | 1698 | 4.07 |
| Bog-average | 1.65 | 85 | 3.98 | ||
| PSU 1 | 86 | 1.86 | 81 | 3073 | 5.07 |
| PSU 2 | 94 | 1.53 | 84 | 2675 | 4.36 |
| PSU 3 | 95 | 1.99 | 82 | 2745 | 4.32 |
| PSU-average | 1.79 | 82 | 4.58 | ||
| UAJA 1 | 95 | 1.90 | 79 | 1022 | 4.39 |
| UAJA 2 | 88 | 1.72 | 79 | 1043 | 4.25 |
| UAJA 3 | 91 | 2.07 | 81 | 3595 | 4.69 |
| UAJA-average | 1.90 | 80 | 4.44 | ||
Abbreviations: PSU, Pennsylvania State University; UAJA, University Area Joint Authority Wastewater Treatment Plant.
Figure 5PCA plot of the dominant (darkest) bands from the DGGE gels representing the communities at cycle 1 and cycle 16. This plot contrasts the initial community of wastewater-inoculated reactors (P=PSU and U=UAJA) with the bog-inoculated reactors (B). Over the duration of the experiment all communities converged irrespective of inoculum source.
Figure 6DDGE gel from cycle 16 showing bands that were excised and identified. Gels were used in the PCA to monitor shifts in overall microbial community throughout the experiment. (B=bog, P=PSU and U=UAJA). Asterisks denote bands that exhibited comigration during analysis.
DGGE band identification
| Band 1 | 99 | Yes | |
| Band 2 | 89 | Yes | |
| Band 3 | 99 | Yes | |
| Band 4 | 89 | Yes | |
| Band 5 | 89 | Yes | |
| Band 6 | 83 | No | |
| 81 | Yes | ||
| Band 7 | 88 | No | |
| 84 | Yes |
Abbreviation: DGGE, denaturing gradient gel electrophoresis
Figure 7Percentage of G. sulfurreducens in each reactor determined by FISH analysis, based on 10 images taken from different locations of each anode sample.
Primer hits to the major phylogenetic taxa found in this study using RDP probe match
| | | | | Deltaproteobacteria | Geobacter | Bacteroidia |
| Clone libraries | GT | This study, | 0.1 0.3 | 0 0.2 | 0.1 0 | |
| 530F/1494R | GT | 97 0.3 | 97 0.2 | 97 0 | ||
| 27F/1541R | AGAGTTTGATCCTGGCTCAG AAGGAGGTGATCCAGCC | 26 3.8 | 28 6 | 24 0.3 | ||
| 63/1389 | CAGGCCTAACACATGCAAGTC ACGGGCGGTGTGTACAAG | 0.8 78 | 0.2 82 | 6 31 | ||
| 41F/1389R | GCTCAGATTGAACGCTGGCG ACGGGCGGTGTGTACAAG | 6.4 78 | 0.2 82 | 0 31 | ||
| DGGE | 341F/534R | CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG | 96 86 | 98 98 | 98 98 | |
| 341F/926R | CCTACGGGAGGCAGCAG CCGTCAATTCMTTTGAGTTT | 96 80 | 98 96 | 98 96 | ||
| 968F/1401R | AACGCGAAGAACCTTAC CGGTGTGTACAAGACCC | This study,
| 59 1 | 15 1 | 0.5 0.3 | |
| 454 Sequencing | 343F/926R | TACGGRAGGCAGCAG CCGTCAATTYYTTTRAGTTT | This study,
| 96 96 | 98 96 | 98 96 |
| 27F/342R | AGAGTTTGATCCTGGCTCAG CTGCTGCSYCCCGTAG | 27 96 | 28 98 | 24 98 | ||
| 1114F/1392R | GCAACGAGCGCAACCC ACGGGCGGTGTGTRC | 94 80 | 97 86 | 0.7 37 | ||
| FISH | GBS207 | GAAGACAGGAGGCCCGAAA | 0.1 | 3 | 0 | |
Abbreviations: DGGE, denaturing gradient gel electrophoresis; FISH, fluorescent in-situ hybridization, RDP, ribosomal database project.
This primer sequence was incorrectly written in the reference. The correct sequence is 5′-GTGCCAGCMGCCGCGG-3′ (Madrid ; Rossetti ). Deltaproteobacteria, Geobacter and Bacteroidia all had 97% probe match values when the correct sequence was used. The specificity of the PCR conditions would determine whether one mismatch would allow a primer to anneal to the template. This one mismatch did not appear to bias the targeting of any particular taxa as all probe match values for the incorrect primer gave ∼0% match.