| Literature DB >> 22550608 |
Taichi Nakamura1, Tetsuhide Ito, Hisato Igarashi, Masahiko Uchida, Masayuki Hijioka, Takamasa Oono, Nao Fujimori, Yusuke Niina, Koichi Suzuki, Robert T Jensen, Ryoichi Takayanagi.
Abstract
Pancreatitis is an inflammatory disease of unknown causes. There are many triggers causing pancreatitis, such as alcohol, common bile duct stone, virus and congenital or acquired stenosis of main pancreatic duct, which often involve tissue injuries. Pancreatitis often occurs in sterile condition, where the dead/dying pancreatic parenchymal cells and the necrotic tissues derived from self-digested-pancreas were observed. However, the causal relationship between tissue injury and pancreatitis and how tissue injury could induce the inflammation of the pancreas were not elucidated fully until now. This study demonstrates that cytosolic double-stranded DNA increases the expression of several inflammatory genes (cytokines, chemokines, type I interferon, and major histocompatibility complex) in rat pancreatic stellate cells. Furthermore, these increase accompanied the multiple signal molecules genes, such as interferon regulatory factors, nuclear factor-kappa B, low-molecular-weight protein 2, and transporter associated with antigen processing 1. We suggest that this phenomenon is a plausible mechanism that might explain how cell damage of the pancreas or tissue injury triggers acute, chronic, and autoimmune pancreatitis; it is potentially relevant to host immune responses induced during alcohol consumption or other causes.Entities:
Year: 2012 PMID: 22550608 PMCID: PMC3328960 DOI: 10.1155/2012/504128
Source DB: PubMed Journal: Int J Inflam ISSN: 2042-0099
Sequences of primers used in this study.
| Gene | Sequence |
|---|---|
| Rat DAI: sense | 5′- TGTCCCGCAGTAAAAGATGG -3′ |
| Antisense | 5′- TTCCAGCCAATGACAACCTC -3′ |
| Rat AIM2: sense | 5′- CATCACGGAGGAGGAACTGA -3′ |
| Antisense | 5′- CGTCCTGTCTGCAATGTTCA -3′ |
| Rat TLR9: sense | 5′- CCGAAGACCTAGCCAACCT -3′ |
| Antisense | 5′- TGATCACAGCGACGGCAATT -3′ |
| Rat TNF- | 5′- CTGGTGGTACCAGCAGATGG -3′ |
| Antisense | 5′- GGAGGCTGACTTTCTCCTGG -3′ |
| Rat IL-6: sense | 5′- CCACCAGGAACGAAAGTCAA -3′ |
| Antisense | 5′- CAGTCCCAAGAAGGCAACTG -3′ |
| Rat MCP-1: sense | 5′- ACGTGCTGTCTCAGCCAGAT -3′ |
| Antisense | 5′- GTTCTCCAGCCGACTCATTG -3′ |
| Rat CINC-1: sense | 5′- CCACACTCAAGAATGGTCGCG -3′ |
| Antisense | 5′- AGACGCCATCGGTGCAATC -3′ |
| Rat NF- | 5′- TTCTGGGCCATATGTGGAGA -3′ |
| p65: sense | |
| Antisense | 5′- CCTCGCACTTGTAACGGAAA -3′ |
| Rat RelB: sense | 5′- GCCACGTAGCCTCTGAGTTG -3′ |
| Antisense | 5′- ATGGAGTGCTGGACCACAAG -3′ |
| Rat IFN- | 5′- TCCAGTTCCGACAAAGCACT -3′ |
| Antisense | 5′- CTTCCATTCAGCTGCCTCAG -3′ |
| Rat IFN- | 5′- TCTTCACACTCCTGGCACAAATG -3′ |
| Antisense | 5′- CTCTCAGTCTTCCCATCAAGTTGG -3′ |
| Rat IRF1: sense | 5′- GAGGGGACATCGAGATAGGC -3′ |
| Antisense | 5′- CTGGTAGAGTTGCCCAGCAG -3′ |
| Rat IRF2: sense | 5′- CCCGACATTGAGGAAGTGAA -3′ |
| Antisense | 5′- TTCTTGGAAGGTCGCTCAGA -3′ |
| Rat IRF3: sense | 5′- CCAGACCTGTCAACCTGGAA -3′ |
| Antisense | 5′- GGTCAAAAGGGTCCTTGCTC -3′ |
| Rat IRF7: sense | 5′- GCGACAAGGATCACCACATT -3′ |
| Antisense | 5′- CTCCAGCTTCACCAGGATCA -3′ |
| Rat MHC I: sense | 5′- GACACAGATCGCCAAGGGA -3′ |
| Antisense | 5′- ATATCCGCGGAGGAGGCT -3′ |
| Rat MHC II: sense | 5′5′- GAGGCGACCGTGTTTTCC -3′ |
| Antisense | 5′- TCTGTGACTGGCTTGCTGTT -3′ |
| Rat TAP1: sense | 5′- CCACCACATCCTCTTCCTCA -3′ |
| Antisense | 5′- ACCCTCCTCTCTCCATGAGC -3′ |
| Rat LMP2: sense | 5′- GGTGTAATGGGCAGAGGTGA -3′ |
| Antisense | 5′- AAGAATGGGAGGTGCTTGCT -3′ |
| Rat | 5′- CCTCAGGGTGCTCGTGGAT -3′ |
| Antisense | 5′- CAGGACTGCCAGGCTCTCC -3′ |
| Rat type I | 5′- AGTTGGTGATGATGCCGTGTT -3′ |
| collagen: sense | |
| Antisense | 5′- ATGGGCCAAAAGGACAGCTAT -3′ |
| Rat GAPDH: sense | 5′- GCTCTCTGCTCCTCCCTGTT -3′ |
| Antisense | 5′- CACACCGACCTTCACCATCT -3′ |
Figure 1(a) Pancreatic stellate cells (PSCs) expressed double-stranded DNA (dsDNA) receptors. Total RNA was prepared from freshly isolated (3 days after isolation) culture-activated PSCs (passages 2 and 4). Expression of the dsDNA receptors was assessed by real-time PCR. All PSCs constitutively expressed DNA-dependent activator of IFN-regulatory factors (DAI), absent in melanoma 2 (AIM2), and toll-like receptor 9 (TLR9). (b) Extracellular DNA stimulation had no effect on DNA receptors, such as DAI and AIM2. In contrast, intracellular dsDNA increased the expression of all dsDNA receptors except TLR9. PSCs: pancreatic stellate cells, TFx: + transfection reagent lipofectamine. *P < 0.05, **P < 0.01.
Figure 2Transcription of cytokine and chemokine mRNA was induced by synthetic double-stranded DNA (dsDNA). (a) Extracellular DNA stimulation had no effect on inflammatory cytokines and chemokines, such as tumor necrosis factor-alpha (TNF-α), interleukin-6 (IL-6), monocyte chemoattractant protein-1 (MCP-1), and cytokine-induced neutrophil chemoattractant 1 (CINC-1). In contrast, intracellular dsDNA (at 10 μg/mL) had stimulatory effects on their expression, including the expression of their transcriptional factors nuclear factor-kappa B (NF-κB) and reticuloendotheliosis viral oncogene homolog B (RelB) (b). Release of MCP-1 was also confirmed by ELISA (c). PSCs: pancreatic stellate cells, TFx: + transfection reagent lipofectamine. *P < 0.05, **P < 0.01.
Figure 3Major histocompatibility complex (MHC) mRNA transcription is induced by synthetic double-stranded DNA (dsDNA). (a) Extracellular DNA (at 10 μg/mL) stimulation has no effect on MHC class I and class II. In contrast, intracellular dsDNA (at 10 μg/mL) increased expression of their transcriptional factors transporter associated with antigen processing 1 (TAP1) and low-molecular-weight protein 2 (LMP2) (b). TFx: + transfection reagent lipofectamine. *P < 0.05, **P < 0.01.
Figure 4Transcription of type I interferon mRNA is induced by synthetic double-stranded DNA (dsDNA). (a) Extracellular DNA stimulation had no effect on the induction of type I interferons (IFNs), such as IFN-α and IFN-β. In contrast, intracellular dsDNA (at 10 μg/mL) has stimulatory effects on their expression, including the expression of their transcriptional factors interferon regulatory factor 1 (IRF1), IRF2, and IRF7 (b). TFx: + transfection reagent lipofectamine. *P < 0.05, **P < 0.01.
Figure 5Double-stranded DNA (dsDNA) impaired cell-specific function. Cell-specific functions were impaired by intracellular dsDNA (at 1–10 μg/mL) and extracellular poly (dI : dC) (at 10 μg/mL) (a), (b). Intracellular dsDNA (at 10 μg/mL) attenuated cell proliferation of PSCs (c)–(e). TFx: + transfection reagent lipofectamine. *P < 0.05, **P < 0.01.
Figure 6Model for mechanisms triggered by intracellular double-stranded DNA (dsDNA) in PSCs. The scheme depicts the induction of the innate immune response by dsDNA reflecting the onset and exacerbation of pancreatitis under sterile an nonsterile conditions.