Literature DB >> 22518144

An MFS Transporter-Like ORF from MDR Acinetobacter baumannii AIIMS 7 Is Associated with Adherence and Biofilm Formation on Biotic/Abiotic Surface.

Praveen K Sahu1, Pavithra S Iyer, Madhumita B Gaikwad, Sheetal C Talreja, Karishma R Pardesi, Balu A Chopade.   

Abstract

A major facilitator superfamily (MFS) transporter-like open reading frame (ORF) of 453 bp was identified in a pathogenic strain Acinetobacter baumannii AIIMS 7, and its association with adherence and biofilm formation was investigated. Reverse transcription PCR (RT-PCR) showed differential expression in surface-attached biofilm cells than nonadherent cells. In vitro translation showed synthesis of a ~17 kDa protein, further confirmed by cloning and heterologous expression in E. coli DH5α. Up to 2.1-, 3.1-, and 4.1- fold biofilm augmentation was observed on abiotic (polystyrene) and biotic (S. cerevisiae/HeLa) surface, respectively. Scanning electron microscopy (SEM) and gfp-tagged fluorescence microscopy revealed increased adherence to abiotic (glass) and biotic (S. cerevisiae) surface. Extracellular DNA(eDNA) was found significantly during active growth; due to probable involvement of the protein in DNA export, strong sequence homology with MFS transporter proteins, and presence of transmembrane helices. In summary, our findings show that the putative MFS transporter-like ORF (pmt) is associated with adherence, biofilm formation, and probable eDNA release in A. baumannii AIIMS 7.

Entities:  

Year:  2012        PMID: 22518144      PMCID: PMC3299490          DOI: 10.1155/2012/490647

Source DB:  PubMed          Journal:  Int J Microbiol


1. Introduction

Multidrug resistant (MDR) Acinetobacter baumannii [1-3] causes a range of infections in hospital environments [4, 5] which are often difficult to treat. Its pathogenesis and resistance are enhanced largely due to formation of biofilms; especially on clinically important surfaces [6]. Acinetobacter is capable of surviving on nutrient-limited abiotic surfaces and stressful environmental conditions by forming biofilms [7]. Biofilm formation is a dynamic process involving the attachment of bacteria to a biotic or abiotic surface followed by growth and maturation [8]. Property of adhesion to surfaces and subsequent formation of biofilm can be conferred by large number of genetic factors in MDR A. baumannii which are still not completely understood. Biofilm development in A. baumannii on abiotic surfaces is mediated by biofilm associated protein-Bap, as shown earlier by Loehfelm et al. [9]. Study by Tomaras and group [10] shows that BfmR, a part of a two-component regulatory system, plays an important role in the morphology of A. baumannii 19606 and the ability to form biofilms on abiotic surfaces. Earlier it was shown that expression of csuAB gene cluster is required for pili formation and attachment to abiotic surfaces, ensuing biofilm formation [11]. Adherence of A. baumannii to polystyrene and respiratory epithelial cells is correlated to antibiotic resistance [12]. Transporter proteins in bacteria have been known to have role in biofilm formation as per several recent reports [13-15]. In E. coli K-12, a putative transport protein YdgG (TqsA) enhances quorum sensing signal autoinducer 2 (AI-2) secretion or inhibits AI-2 uptake; thereby controlling the overall biofilm formation [13]. In uropathogenic E. coli, an autotransporter protein UpaH contributes to biofilm formation and cellular colonization on bladders as shown in a recent study [14]. Similarly, out of an array of proteins identified in nontypeable H. influenzae for role in biofilm formation, majority was found involved in cell motility and transport functions such as secretion [15]. In A. baumannii, porins, multidrug efflux-pump transport proteins [16] have been a key reason for its emergence as a challenging MDR pathogen in recent times. Besides, in members of Acinetobacter group, several transporter proteins are known to date, albeit the functions remained diverse, namely, transport of ions, solutes, and metabolites [17], active efflux of drug molecules [16, 18], uptake and translocation of nucleic acids [19, 20] during natural transformation, and so on. However, function of transport proteins in virulence attributes as biofilms has never been looked into. It is presumed that transporter-like proteins could have compensatory function to natural transformation seen in members of Acinetobacter baylyi, Acinetobacter calcoaceticus, and Acinetobacter sp.BD413; which are naturally competent, but not in Acinetobacter baumannii, which has evolved from these close genomic species as a pathogen and genetically diversified subsequently [21]. We hypothesize that A. baumannii, a strong biofilm former and nosocomial pathogen, may possess transporter-like proteins with multiple functions in biofilm formation. It may also possibly account for eDNA release as demonstrated in our recent work [22] in a pathogenic MDR strain of A. baumannii, isolated from ICU, also capable of forming biofilms. The present study was intended to investigate a putative MFS transporter-like ORF (pmt) and its association with adherence and biofilm formation on various clinically important surfaces.

2. Materials and Methods

2.1. Bacterial Strains and Plasmids

A strain of Acinetobacter baumannii AIIMS 7 isolated from the bloodstream of a patient in neurosurgery ward of All India Institute of Medical Sciences (AIIMS), New Delhi, India, was used in the study after identification by API 32 GN system [23] and 16SrRNA gene sequencing (Genbank EU779829). E. coli DH5α was used as host for the cloning and heterologous expression experiments. Bacterial cultures were maintained on Luria agar and Cysteine Lactose Electrolyte Deficient (CLED) Agar (HiMedia, India). E. coli DH5α-pGEpmt, E. coli DH5α pGFP, E. coli DH5α-pGFP: pGEpmt, and E. coli DH5α-pGFP: pGEM clones were maintained on Luria agar plates containing 100 mg/L ampicillin. Bacterial strains and plasmids used in the study are listed in Table 1. All bacterial strains were grown at 37°C, 150 rpm with appropriate antibiotic as and when required.
Table 1

Strains and plasmids used in the study.

DescriptionCharacteristics Reference
Acinetobacter baumannii AIIMS 7Clinical isolate from neurosurgery ward, All India Institute of Medical Sciences (AIIMS), New Delhi, India[23]
E. coli
  DH5α Used for all cloning and recombinant DNA methodsInvitrogen
  pGEpmt E. coli harbouring pmt gene cloned into pGEMT-Easy vectorThis study
  pGEM E. coli harbouring control plasmid pGEM3zf (+)This study
  pGFP: pGEpmtpGEpmt and pGFP cotransformed in E. coli DH5α This study
  pGFP: pGEMpGEM3zf (+) and pGFP cotransformed in E. coli DH5α This study
Plasmids
  pGEMT-EasyUsed to clone pmt Promega
  pGFPUsed for gfp tagClonTech, Takara

2.2. DNA and RNA Manipulations

2.2.1. Nucleic Acid Purification

Genomic DNA was isolated using a commercial kit as per manufacturer's instructions (Sigma Aldrich, USA). Total RNA isolation was done using a total RNA Extraction Kit (Bangalore GeNei, India). Recombinant plasmid purification was done using GenElute Plasmid Miniprep kit (Sigma Aldrich, USA). Nucleic acid samples were quantitatively analyzed in a Biophotometer plus (Eppendorf, Germany) along with purity. DNA samples were size fractionated by agarose gel electrophoresis.

2.2.2. In Vitro Amplification

Primers used to amplify the putative MFS transporter-like ORF (pmt) are as indicated in Table 2 (pmt-F and pmt-R). From A. baumannii AIIMS 7 genomic DNA, a 735 nt region (containing the pmt ORF) was amplified using an optimized PCR program with annealing temperature 45.1°C and annexed with poly-A tailing program. The amplicon was purified using a gel extraction kit (Sigma Aldrich, USA). Amplification was also attempted using plasmid DNA of A. baumannii AIIMS 7. PCR reagents and primers were sourced from Sigma-Aldrich. DNase, RNase, and protease-free water was used as negative PCR control in all PCR assays.
Table 2

Oligonucleotides used in the study.

DetailsPrimer name5′-3′ sequenceProduct lengthReference
Direct PCR primerspmt-FTAGGGGTATCACCATTTGTG735 bpPresent study
pmt-RTCATGTATAACGACACCAGT
RT-PCR primerspmt-RT FAGTCTTTGGCCATTTTGGTG246 bpPresent study
pmt-RT RGCAACTTCCCAAACCCTGTA
16S rRNA16S FTGGCTCAGATTGAACGCTGGCGGC1500 bp Lee et al., 2008 [12]
16S RTACCTTGTTACGACTTCACCCCA

2.2.3. DNA Sequencing and Analysis of Protein Sequence

The purified fragment was sequenced in a 3730 DNA Analyzer (Applied Biosystems, USA) using Big Dye Terminator (BDT) v 3.1 Cycle sequencing reactions. Purification of cycle-sequenced products was done using a BDT X-Terminator Kit (Applied Biosystems, USA) and subjected to capillary electrophoresis in the 3730 DNA Analyzer. Sequence data was processed using Sequencing Analysis Software version 5.1.1 (Applied Biosystems, USA). Sequencing was performed in triplicates. DNA sequences were used for homology studies and in silico analysis of the deduced protein using BLAST (NCBI) and ExPASy tools (Swiss Institute of Bioinformatics). Prediction of transmembrane helices in proteins was performed using TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/), and signature sequence was predicted using online tool PROSITE (http://prosite.expasy.org/).

2.3. Cloning of pmt

2.3.1. Ligation and Cloning of Plasmid pGEpmt into E. coli DH5α

Purified amplicon was ligated into pGEMT-Easy (3018 bp, Promega, USA). The resulting plasmid designated pGEpmt was transformed into competent E. coli DH5α [24]. Transformed colonies were selected on LB-Amp plates at 37°C overnight.

2.3.2. Confirmation of Clones

Individual antibiotic resistant colonies of recombinant E. coli DH5α containing the pmt gene (E. coli DH5α pGEpmt) were confirmed for presence of pmt using PCR primers.

2.4. Transcriptional Analysis of Pmt

2.4.1. Transcription Analysis

Expression of pmt was tested by RT-PCR analysis using total RNA isolated from bacteria grown in LB broth. The RNA samples were treated with RNase-free DNase I (Sigma Aldrich, USA). RT-PCR was carried out using an RT-PCR kit (Invitrogen, USA), as per the manufacturer's instructions and using 16SrRNA as a control. Direct-PCR of total RNA without reverse transcription was used to test for DNA contamination of RNA samples. Primers pmt RT-F and pmt RT-R were used for amplification of an internal pmt region. The amplicons were analyzed by agarose gel electrophoresis using the Tris-borate/EDTA buffer system and ethidium bromide staining. The sequence identity of the amplicons was confirmed by standard automated capillary DNA sequencing as described above.

2.4.2. Expressional Difference

Variation of gene expression in planktonic and biofilm mode of growth was checked by RT-PCR, as per the methods described above. Overnight grown Acinetobacter baumannii AIIMS 7 was diluted 1 : 100 with sterile LB broth in 6-well polystyrene culture plates (Tarsons, India) and were incubated for 24 hours at 37°C static. The plate was sonicated moderately to remove loosely adherent cells at 53 KHz, 2 mins at 25°C in a Sonicator waterbath (Equitron, India), followed by washing twice with phosphate buffered saline. Adherent cells were gently scraped from the culture plate bottom, and total RNA was purified as described above. For planktonic cells, the total RNA was purified from overnight grown A. baumannii AIIMS 7 culture. Direct PCR of total RNA without reverse transcription was used to test for any DNA contamination of RNA samples.

2.5. Analysis of MFS-Transporter Like Protein

2.5.1. In Vitro and In Vivo Translation

In vitro translation of pmt gene cloned downstream of the SP6 promoter of pGEpmt was analyzed using TNT SP6-High-yield Wheat germ protein expression system (Promega, USA) as per manufacturer's instructions. For comparison, in vivo translation was assessed; after overnight culturing in LB broth at 37°C with constant shaking, E. coli DH5α-pGEpmt and control E. coli DH5α-pGEM cells were used to prepare whole-cell lysates. Products were analyzed on 17.5% SDS-PAGE stained with Coomassie brilliant blue (0.1%).

2.6. Characterization of Clones for Biofilm Formation

2.6.1. Comparative Biofilm Assay of Control and Clones on Abiotic Surfaces (Polystyrene and Glass)

Qualitative biofilm assay on glass tubes was performed as earlier described [25]. Quantitative biofilm assay was performed in 96-well polystyrene microtitre plates [12], and absorbance at 570 nm was read in a Multiplate reader (Molecular Devices, USA). The assays were repeated at least five times. Absorbances were normalized using LB broth as blank.

2.7. Quantification of Biofilm Formation on Biotic Surfaces

2.7.1. HeLa Cells

Biofilm formation was quantified as per methods described elsewhere [26] with required modifications. HeLa cells (105 cells/mL) grown in Dulbecco's Modified Eagles Medium (DMEM, HiMedia, India) were seeded in a 96-well microtitre plate and incubated at 37°C in CO2 atmosphere for 48 hours. Overnight grown bacterial culture (2 × 105 cells/mL) was resuspended in DMEM and added to the wells followed by incubation for 3 hours at 37°C in CO2 atmosphere. The supernatant was aspirated from the wells and washed twice with phosphate buffered saline (PBS) and fixed with 100% methanol. This was followed by staining with 0.1% Giemsa stain and taking absorbance at 590 nm after solubilization in glacial acetic acid.

2.7.2. Saccharomyces cerevisiae

10-hour-old culture of Saccharomyces cerevisiae (Baker's yeast) grown in 5% sucrose was inoculated in a 96-well microtitre plate (105 cells/mL) and incubated at 37°C for 12 hours to allow biofilm formation. The supernatant was aspirated, and overnight grown bacterial culture (2 × 105 cells/mL) was added to the wells and incubated at 37°C for 16 hours. This was followed by the quantitative biofilm assay as for polystyrene surfaces [12].

2.8. Localization Studies for Adhesion of Clones

2.8.1. Fluorescence Microscopy for Adherence of Clones to Yeast Cells

In order to observe the adherence of recombinant strains to biotic surfaces (S. cerevisiae), E. coli DH5α-pGFP: pGEpmt and E. coli DH5α-pGFP: pGEM were used. Success of cotransformation was verified by plasmid isolation from green-fluorescent colonies observed under UV and positive colony PCR amplification. A sterile slide was placed in a sterile empty Petri dish, and 20 mL of 10-hour-old S. cerevisiae culture was added and incubated at 37°C for 12 hours to allow biofilm formation. Excess medium from the plate was discarded, and 20 mL of overnight-grown bacterial culture was added on the S. cerevisiae biofilm itself and incubated for 16 hours at 37°C. Supernatant was discarded, and slide was washed thrice with PBS to remove nonadherent cells. The slide was observed at 400x magnification of a fluorescent microscope (Axioscope A.1, Zeiss, Germany).

2.8.2. Scanning Electron Microscopy (SEM) on Abiotic Surfaces (Glass)

Overnight grown cells (3 × 109 cells) were inoculated on (1 × 1 cm) glass slides inside sterile 12-well culture plates (Tarsons, India) and incubated at 37°C overnight. Culture supernatant was removed, slides were immediately flooded with 2.5% glutaraldehyde in PBS and incubated at room temperature for 2 hours, followed by rinsing with sterile distilled water and serially dehydrated with an ethanol gradient (25–100%), CO2 critical point dried and coated with Platinum in a Auto Fine coater (JFC-1600, JEOL, Japan). Coated slides were fixed onto sample holders by carbon tapes and mounted on a scanning electron microscope (Vega, Tescan, USA) with 30 KV input voltage. At least 50 fields were observed at various magnifications and working distances and each sample repeated twice.

2.9. Analysis of DNA Release

Purification of extracellular DNA was done from 0.22 μm filtered supernatant of overnight grown cultures of E. coli DH5α-pGEM, E. coli DH5α-pGEpmt, and A. baumannii AIIMS 7 as per methods described [27]. Briefly, to 750 μL cell-free supernatant (0.22 μm filter sterilized), equal volume of buffer A (50 mM Tris and 10 mM EDTA, 1% CTAB, pH 8.0) was added and incubated at 65°C for 30 min, followed by centrifugation at 8000 rpm for 10 min. To the pellet, 500 μL of buffer B (10 mM Tris, 0.1 mM EDTA and 1 M NaCl, pH 8.0) was added, followed by addition of 0.3 volumes of ice cold isopropanol, incubated for three hours at 4°C, and, finally, pellet was resuspended in 40 μL DNase RNase-free T10E1 buffer pH~8.0 (Sigma Aldrich). Purified eDNA samples were assessed quantitatively in Biophotometer Plus (Eppendorf, Germany) along with purity and analyzed qualitatively by agarose gel electrophoresis.

2.9.1. Statistical Analysis

Each datum point was averaged from three independent experiments, each with eight replicate wells. All results obtained from nucleic acid quantification and biofilm assays were entered in to excel spreadsheets (Microsoft, USA). Frequency distribution, namely, mean with standard deviations was determined. Statistical analysis was performed by Student's two tailed t-tests, P value <0.05 was considered to be statistically significant.

3. Results

3.1. DNA and RNA Manipulations

Amplification and Transcription of the Gene In vitro amplification by PCR yielded an amplicon of size 735 bp. To check the transcriptional activity of the gene in vivo, RT-PCR was performed using cDNA and an internal primer set (Table 2). The amplified product contained the cDNA regions (246 nt) in the ORF of the gene pmt being investigated, and, therefore, it could be confirmed that the gene was actively transcribed in the cells. DNA Sequencing. DNA sequencing of the amplicon yielded a 735 nt sequence which was analyzed further to reveal that it contains a ORF of 453 nucleotides. BLASTn results showed 97% identity with the available genome sequences of A. baumannii strains AB307-0294, AB0057, AYE (E = 0.0) with specific hits directed towards MFS transporter proteins. The DNA sequence was deposited in GenBank under Accession number HM595762. Cloning and confirmation. The purified recombinant plasmid pGEpmt had a size of 3.75 kb. Colony PCR of the transformants showed amplification of the original fragment of ~735 bp indicating successful cloning of pmt ORF in the selected colonies (data not shown).

3.2. Differential Expression of pmt Gene

Significantly higher expression of the pmt was observed in adherent cells of biofilm (scraped cells from bottom), as compared to the planktonic cells (nonattached) (Figure 1(a)). We intended to evaluate the level of transcription upon adherence on to surface; the observations as indicated by the intensity (Figure 1(a)) denote a high degree of transcription of this region of the ORF and demonstrate direct evidence of functionality of this gene in biofilm mode of growth. The negative controls showed no amplification, indicating absence of DNA in the sample (Figure 1(a), lane 1, 2). 16SrRNA gene was amplified as negative control (Figure 1(b)).
Figure 1

Differential expression of pmt of A. baumannii AIIMS 7 (a) expression of pmt. Lane 1: direct PCR using total RNA from planktonic cells (nonadherent) of A. baumannii AIIMS 7; Lane 2: direct PCR using total RNA from biofilm cells (adherent) of A. baumannii AIIMS 7; Lane 3: RT-PCR using total RNA from planktonic cells (nonadherent) of A. baumannii AIIMS 7. Lane 4: RT-PCR using from biofilm cells (adherent) of A. baumannii AIIMS 7 cells (b) Expression of internal control 16SrDNA gene. Lane 1: direct PCR using total RNA from planktonic cells (nonadherent) of A. baumannii AIIMS 7; Lane 2: direct PCR using total RNA from biofilm cells (adherent) of A. baumannii AIIMS 7; Lane 3: RT-PCR using total RNA from planktonic cells (nonadherent) of A. baumannii AIIMS 7; Lane 4: RT-PCR using from biofilm cells (adherent) of A. baumannii AIIMS 7 cells.

3.3. Analysis of Protein

Using the obtained nucleotide sequence, the ORF yielded 150 amino acid residues by theoretical translation. The obtained ORF was much shorter than predicted MFS transporter proteins (400 amino acid residues) present in the genomes of A. baumannii typed strains. BLASTp analysis of the amino acid sequence showed presence of conserved motifs specific to MFS transporter superfamily proteins with high similarity (up to 72%). Prediction of transmembrane helices in proteins using TMHMM Server v. 2.0 indicated presence of two transmembrane helices (amino acid position: 67–89; 93–115). PROSITE pattern analysis indicated that the entire ORF was a signature sequence of MFS transporter superfamily. In silico proteomic feature analysis (ExPASy tools, ProtParam) predicted a translation of Pmt protein of ~16.95 kDa with an Isoelectric point (pI) of 9.67. When we evaluated this using the in vitro translation experimentally, a distinctly overexpressed band of ~17 kDa appeared on SDS-PAGE and (Figure 2) indicated that and was in accordance with the in silico prediction. Moreover, total protein profile analysed from clones also showed the overexpressed protein of same size (~17 kDa) on induction with IPTG (Figure 3, Lane 3). Our analysis suggested that presence of transmembrane helices in the Pmt protein might enable it to function as a transporter protein in A. baumannii AIIMS 7.
Figure 2

In vitro translated protein products. Lane M: ultra low-range peptide molecular weight marker, Lane 2: product of in vitro translation of pGEpmt, Lane 3: negative control (E. coli DH5α-pGEM).

Figure 3

Total protein profile of recombinant E. coli DH5 showing in vivo translation. Lane 1: total protein profile of E. coli DH5α-pGEM, Lane 2: total protein profile of E. coli DH5α-pGEpmt, Lane 3: total protein profile of E. coli DH5α-pGEpmt after IPTG induction.

3.4. Characterization of Adherence and Biofilm Formation

3.4.1. Comparative Biofilm Assay of Control and Clones on Abiotic Surfaces (Glass and Polystyrene)

Surface adhesion and biofilm formation were tested on model surfaces that are clinically important. With due consideration on the ability of A. baumannii to persist on inanimate surface in clinical environments as well as inside the host tissue by forming biofilms, two surfaces of each abiotic and biotic were selected. Qualitative biofilm assay performed using a simple assay (glass tube method) showed direct biofilm formation and augmentation on glass surfaces in comparison to control E. coli DH5α-pGEM (Figure 4). On 96-well polystyrene surface, quantitative assay showed marked biofilm augmentation by the pmt clones. A temporal evaluation of the same was assessed till 96 hours. Results showed maximum expression of gene in the beginning stages of biofilm formation (24 hour and 48 hour; 2.05- and 2.79-fold increase respective); 2.79-, 1.33-, 1.16-fold increase, respectively, at 72 and 96 hours (Figure 5). This also correlated well with our differential expression by RT-PCR assay where biofilm or attached cells showed enhanced transcription of the gene.
Figure 4

Qualitative assay showing biofilm formation on abiotic (glass) surface. biofilms formed by 1: A. baumannii AIIMS 7, 2: E. coli DH5α-pGEpmt, 3: E. coli DH5α-pGEM, 4: negative control (LB broth).

Figure 5

Quantitative analysis of adherence and biofilm formation on abiotic surface (polystyrene microtitre). (Absorbance values normalized with blank medium, P < 0.05.)

3.4.2. Quantification of Biofilm Formation on Biotic Surfaces (HeLa Cell Line and Yeast Cells)

Similar to abiotic surface, representative biotic surfaces were also chosen. HeLa Cells. Significant increase in adherence onto human (HeLa cell line) cells was observed for the E. coli DH5α-pGEpmt. 4.1-fold increase in adherence was observed as compared to control E. coli DH5α-pGEM (Figure 6, black bars). S. cerevisiae. A 3.1-fold increased adherence was observed in E. coli DH5α-pGEpmt as compared to control E. coli DH5α-pGEM as was observed (Figure 6, grey bars) in case of the recombinants containing the gene.
Figure 6

Quantitative analysis of adherence and biofilm formation on biotic surfaces (S. cerevisiae and HeLa cells). (Absorbance values normalized with blank medium, P < 0.05.)

3.5. Localization of Adherence

3.5.1. Fluorescence Microscopy for Adherence of Clones to Saccharomyces  cerevisiae Yeast Cells

To assess the adherence capabilities augmented due to expression of the protein, we performed the gfp-tagged fluorescence microscopy. When compared to the control cells, the clones exhibited marked increase in the adherence to yeast cells (Figure 7). The primary biofilm formed by S. cerevisiae was almost completely colonized by biofilm formed by the recombinants. The EPS formed by the bacteria could be seen prominently as hazy layers (Figure 7(f)), covering biofilm of S. cerevisiae. The number of adhering bacterial cells on the surface of S. cerevisiae biofilm was clearly much larger in case of recombinants.
Figure 7

Fluorescence microscopic analysis of adherence to S. cerevisiae. (a) E. coli DH5α-pGFP: pGEM cells. (d) E. coli DH5α-pGFP: pGEpmt cells. (b), (c) Adherence of control (E. coli DH5α-pGFP: pGEM) cells to S. cerevisiae cell surface beneath. (e), (f) Adherence of E. coli DH5α-pGFP: pGEpmt cells on S. cerevisiae. Intense green fluorescence indicates expression of gfp-tag, whereas S. cerevisiae cells are seen as yellow colored. (Images taken at 400x.)

3.5.2. Scanning Electron Microscopy

To address the question of enhancement of adherence on to abiotic surface, SEM was performed, where representative micrographs showed significantly dense and thicker biofilm formed by the E. coli DH5α-pGEpmt (Figures 8(b) and 8(c)) as compared to control E.coli DH5α-pGEM (Figure 8(a)).
Figure 8

Scanning electron microscopy images showing adherence and biofilm formation on glass. (a) E. coli DH5α-pGEM cells adhering to abiotic (glass) surface. (b), (c) E. coli DH5α-pGEpmt cells adhering together and forming biofilm on glass surface. (Bars and magnification indicated below representative figures.)

3.5.3. Analysis of eDNA

Figure 9 shows the eDNA purified and analysed on agarose gels; distinct presence of equivalent molecular weight eDNA from the clones can be seen with Lane 1 showing control genomic DNA from A. baumannii AIIMS 7. When quantitatively analyzed, as shown in Figure 10, about 2.58-fold increase in eDNA production was seen in E. coli DH5α-pGEpmt (480.7 ± 52.69 μg/mL) as compared to the E. coli DH5α-pGEM (186.5 ± 32.52 μg/mL). eDNA concentration in A. baumannii AIIMS 7 was found to be 520.0 ± 40.0 μg/mL.
Figure 9

Qualitative analysis of eDNA production. Lane 1: gDNA of A. baumannii AIIMS 7 (Positive control), Lane 2: eDNA produced by E. coli DH5α-pGEpmt, eDNA, Lane 3: eDNA produced by E. coli DH5α-pGEM, Lane 4-5: eDNA produced by A. baumannii AIIMS 7, Lane 5: negative control (Luria broth).

Figure 10

Quantitative analysis of eDNA production during in vitro growth.

4. Discussion

Members of at least three types of transport systems, namely, ATP-binding cassette (ABC)-type, resistance nodulation division (RND)-type, and major facilitator superfamily (MFS)-type transporters, have been proposed so far, to function together with trans-periplasmic proteins called membrane fusion proteins (MFP) to facilitate transport across both membranes of the Gram-negative bacterial cell envelope [28]. The MFS consists of membrane transport proteins which are found in several bacteria to higher eukaryotes and are involved in the symport, antiport, or uniport of various substrates, such as sugars, Krebs cycle intermediates, phosphate esters, oligosaccharides, and antibiotics [29]. It is known that members of the MFS transporter family could drive the export of cytoplasmically derived molecules, namely, DNA across the two membranes of the Gram-negative bacterial cell into the external milieu. It was hypothesized that the characterized MFS transporter-like protein has a similar role of transport with greater implication; especially with reference to emerging pathogens like MDR A. baumannii, which is known to devote considerable portion of its genes to pathogenicity [30]. We characterized this gene pmt in an highly MDR pathogenic A. baumannii AIIMS 7; whose over-expression of the ~17 kDa protein showed marked increase in cellular adherence as well as biofilm augmentation. Moreover, the sequence homology to “putative MFS transporter proteins” of Acinetobacter baumannii indicated with larger probability that it could be involved in nucleic acid transport. Our observation also brings to light a probable function of this transporter gene to be involved in nucleic acid export as indicated by analysis of eDNA release (Figures 9 and 10). The function of eDNA release was thought to be due to uncommon evolution (with regard to pathogenicity) of A. baumannii from close members of the genus (which are naturally competent) and the adaptability of its genome to perform function like spreading resistance genetic traits through eDNA owing to its ubiquity in nature and survival. In our recent work [22], we have characterized the role of eDNA in biofilm formation as well as augmentation on abiotic surface in A. baumannii AIIMS 7. Although presence of eDNA in the extracellular growth medium may be contributed by minimal amount of passively released DNA from cell lysis at later stages, significant amount of increased eDNA content from pmt clones under similar growth conditions as in the control cells may well justify our current hypothesis that MFS transporter-like proteins could be involved in eDNA release. As reviewed earlier [31], developmental progression of surface-attached bacterial communities would require differential expression of various genes. Downregulation of flagellar biosynthetic machinery upon surface attachment in P. aeruginosa [32] and biofilm-dependent gene regulation in E. coli [33] has been studied. In A. baumannii we have shown overexpression of pmt gene in 24-hour biofilm bacteria (Figure 1), than in nonadherent and/or planktonic bacteria indicating that the expression is surface induced and stage specific. SEM and fluorescence microscopic analysis (Figures 7 and 8) also supported this finding, as the phenotypic expression in terms of increased adherence, was seen only at surfaces. Interestingly, RT-PCR analysis from 24-hour old biofilm showed high expression also correlated well with our quantitative biofilm assay (Figure 5) showing maximum biofilm at 24 hours and gradually decreasing till 96 hours. Specificity of gene expression being surface and stage specific may correlate to important parameters in severity of the infection, for example, expression of such genes would largely affect the stability as well as infectious nature of biofilms in clinically important surfaces as urinary catheters in patients with urinary tract infections, as shown recently in our study [6]. However, biofilm augmentation due to Pmt (putative MFS transporter-like gene) expression, in general, would be in coordination with various other determinants of biofilm formation like macromolecular secretions (EPS matrix and nucleic acids), biofilm associated proteins, autolysin proteins, and so forth [34]. The collective expression of these determinants would account for the extremely strong biofilm formation by A. baumannii [35] and may be part of a tight regulation. After cloning of pmt in E. coli, 2.1-fold increase in biofilm formation on abiotic (polystyrene surfaces) was observed as compared to control E. coli and substantial increase in biofilm formation on glass was observed. Maximum biofilm augmentation on polystyrene surfaces was observed at 24 hours of growth (corresponding to stationary phase in the growth of bacteria). A 4.1-fold increase in adherence to biotic surfaces (HeLa cell line) was observed in case of E. coli DH5α-pGEpmt. A novel approach was used to detect the adherence of the recombinants with pGEpmt plasmid by gfp-tagged fluorescence microscopy. Adherence of these recombinants on S. cerevisiae was studied using E. coli-pGFP: pGEM as a control. Significant increase in attachment of clones to S. cerevisiae cells as compared to E. coli-pGFP: pGEM (Figure 6) was seen, indicating the role of pmt in adherence to biotic surfaces presenting a “preferred choice” of surface, that is, biotic over abiotic. Taken together, this work depicts the characterization of a newly identified MFS transporter-like gene pmt, from a MDR clinical isolate of A. baumannii isolated from an ICU in India. First, it shows differential expression in biofilm mode, which largely implicates its role in adherence and biofilm formation, with the expression being stage dependent. This was further assessed using E. coli model of heterologous expression; specifically the characterization of adherence and biofilm augmentation on chosen biotic and abiotic surfaces. Furthermore, the strong sequence homology of pmt ORF to MFS transporter proteins, presence of transmembrane helices in the protein and eDNA analysis, it may be associated with eDNA release in A. baumannii, although further studies are warranted to establish this function. Nevertheless, studies on transporter proteins of the ubiquitous bacterium of Acinetobacter genus with role(s) in biofilm formation on biotic and abiotic surfaces might fascinate microbiologists more, not only because of the diverse implication of MFS superfamily of proteins in multiple molecular, physiological, and metabolic processes, but also the uniqueness of this genus in being involved in natural competence, genomic diversity, multidrug resistance, gene transfer, pathogenesis, and biofilm formation. Especially structure, function, and phylogeny of the array of uncharacterized transporter proteins in MDRAB may provide possibilities for development of new strategies to inhibit or modify binding of pathogens to clinically important as well as host surface, providing effective therapeutic options for combating biofilm pathogenesis.
  32 in total

1.  Abiotic surface sensing and biofilm-dependent regulation of gene expression in Escherichia coli.

Authors:  C Prigent-Combaret; O Vidal; C Dorel; P Lejeune
Journal:  J Bacteriol       Date:  1999-10       Impact factor: 3.490

Review 2.  Bacterial biofilms: a common cause of persistent infections.

Authors:  J W Costerton; P S Stewart; E P Greenberg
Journal:  Science       Date:  1999-05-21       Impact factor: 47.728

3.  Molecular and structural characterization of the HMP-AB gene encoding a pore-forming protein from a clinical isolate of Acinetobacter baumannii.

Authors:  Anna Gribun; Yeshayahu Nitzan; Izabella Pechatnikov; Gitit Hershkovits; Don J Katcoff
Journal:  Curr Microbiol       Date:  2003-11       Impact factor: 2.188

4.  UpaH is a newly identified autotransporter protein that contributes to biofilm formation and bladder colonization by uropathogenic Escherichia coli CFT073.

Authors:  Luke P Allsopp; Makrina Totsika; Jai J Tree; Glen C Ulett; Amanda N Mabbett; Timothy J Wells; Bostjan Kobe; Scott A Beatson; Mark A Schembri
Journal:  Infect Immun       Date:  2010-02-09       Impact factor: 3.441

5.  YdgG (TqsA) controls biofilm formation in Escherichia coli K-12 through autoinducer 2 transport.

Authors:  Moshe Herzberg; Ian K Kaye; Wolfgang Peti; Thomas K Wood
Journal:  J Bacteriol       Date:  2006-01       Impact factor: 3.490

6.  Characterization of a two-component regulatory system from Acinetobacter baumannii that controls biofilm formation and cellular morphology.

Authors:  Andrew P Tomaras; Michael J Flagler; Caleb W Dorsey; Jennifer A Gaddy; Luis A Actis
Journal:  Microbiology       Date:  2008-11       Impact factor: 2.777

7.  Identification and characterization of an Acinetobacter baumannii biofilm-associated protein.

Authors:  Thomas W Loehfelm; Nicole R Luke; Anthony A Campagnari
Journal:  J Bacteriol       Date:  2007-11-16       Impact factor: 3.490

8.  Capacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to form biofilm and adhere to epithelial cell surfaces.

Authors:  H-W Lee; Y M Koh; J Kim; J-C Lee; Y-C Lee; S-Y Seol; D-T Cho; J Kim
Journal:  Clin Microbiol Infect       Date:  2007-11-13       Impact factor: 8.067

9.  Nosocomial Acinetobacter baumannii infections: microbiological and clinical epidemiology.

Authors:  D Villers; E Espaze; M Coste-Burel; F Giauffret; E Ninin; F Nicolas; H Richet
Journal:  Ann Intern Med       Date:  1998-08-01       Impact factor: 25.391

10.  Comparative analysis of Acinetobacters: three genomes for three lifestyles.

Authors:  David Vallenet; Patrice Nordmann; Valérie Barbe; Laurent Poirel; Sophie Mangenot; Elodie Bataille; Carole Dossat; Shahinaz Gas; Annett Kreimeyer; Patricia Lenoble; Sophie Oztas; Julie Poulain; Béatrice Segurens; Catherine Robert; Chantal Abergel; Jean-Michel Claverie; Didier Raoult; Claudine Médigue; Jean Weissenbach; Stéphane Cruveiller
Journal:  PLoS One       Date:  2008-03-19       Impact factor: 3.240

View more
  10 in total

1.  Effect of a novel podophage AB7-IBB2 on Acinetobacter baumannii biofilm.

Authors:  Nikhil D Thawal; Ajinkya B Yele; Praveen K Sahu; Balu A Chopade
Journal:  Curr Microbiol       Date:  2012-04-26       Impact factor: 2.188

2.  Overexpression of BIT33_RS14560 Enhances the Biofilm Formation and Virulence of Acinetobacter baumannii.

Authors:  Ruifu Yang; Bipeng Lai; Kang Liao; Baomo Liu; Lixia Huang; Shaoli Li; Jincui Gu; Ziying Lin; Yili Chen; Shuaishuai Wang; Yanli Qiu; Jiating Deng; Simin Chen; Chao Zhuo; Yanbin Zhou
Journal:  Front Microbiol       Date:  2022-04-25       Impact factor: 6.064

Review 3.  Mycobacterium tuberculosis Major Facilitator Superfamily Transporters.

Authors:  Ping Li; Yinzhong Gu; Jiang Li; Longxiang Xie; Xue Li; Jianping Xie
Journal:  J Membr Biol       Date:  2017-08-29       Impact factor: 1.843

Review 4.  Structural and Functional Diversity of Resistance-Nodulation-Cell Division Transporters.

Authors:  Philip A Klenotic; Mitchell A Moseng; Christopher E Morgan; Edward W Yu
Journal:  Chem Rev       Date:  2020-11-19       Impact factor: 60.622

5.  Global transcriptional analysis of Burkholderia pseudomallei high and low biofilm producers reveals insights into biofilm production and virulence.

Authors:  Chui-Yoke Chin; Yuka Hara; Ahmad-Kamal Ghazali; Soon-Joo Yap; Cin Kong; Yee-Chin Wong; Naufal Rozali; Seng-Fook Koh; Chee-Choong Hoh; Savithri D Puthucheary; Sheila Nathan
Journal:  BMC Genomics       Date:  2015-06-20       Impact factor: 3.969

Review 6.  Nanoparticles for Control of Biofilms of Acinetobacter Species.

Authors:  Richa Singh; Shradhda Nadhe; Sweety Wadhwani; Utkarsha Shedbalkar; Balu Ananda Chopade
Journal:  Materials (Basel)       Date:  2016-05-18       Impact factor: 3.623

7.  Acinetobacter baumannii NCIMB8209: a Rare Environmental Strain Displaying Extensive Insertion Sequence-Mediated Genome Remodeling Resulting in the Loss of Exposed Cell Structures and Defensive Mechanisms.

Authors:  Guillermo D Repizo; Martín Espariz; Joana L Seravalle; Juan Ignacio Díaz Miloslavich; Bruno A Steimbrüch; Howard A Shuman; Alejandro M Viale
Journal:  mSphere       Date:  2020-07-29       Impact factor: 4.389

Review 8.  The Varied Role of Efflux Pumps of the MFS Family in the Interplay of Bacteria with Animal and Plant Cells.

Authors:  Martina Pasqua; Milena Grossi; Alessandro Zennaro; Giulia Fanelli; Gioacchino Micheli; Frederic Barras; Bianca Colonna; Gianni Prosseda
Journal:  Microorganisms       Date:  2019-08-22

Review 9.  Acinetobacter baumannii Efflux Pumps and Antibiotic Resistance.

Authors:  Seyyed Naser Abdi; Reza Ghotaslou; Khudaverdi Ganbarov; Ahmad Mobed; Asghar Tanomand; Mehdi Yousefi; Mohammad Asgharzadeh; Hossein Samadi Kafil
Journal:  Infect Drug Resist       Date:  2020-02-12       Impact factor: 4.003

10.  Green synthesis of selenium nanoparticles using Acinetobacter sp. SW30: optimization, characterization and its anticancer activity in breast cancer cells.

Authors:  Sweety A Wadhwani; Mahadeo Gorain; Pinaki Banerjee; Utkarsha U Shedbalkar; Richa Singh; Gopal C Kundu; Balu A Chopade
Journal:  Int J Nanomedicine       Date:  2017-09-13
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.