Identification of Stylosanthes guianensis varieties using molecular genetic analysis.

BACKGROUND AND AIMS: The botanical classification of Stylosanthes guianensis is controversial, and few studies have used molecular markers to analyse this species. We used microsatellite markers to study the genetic diversity and population structure of S. guianensis and compare our results with the current infraspecific botanical classification.
METHODOLOGY: A representative sample from the S. guianensis Brazilian germplasm collection (150 accessions) was analysed using 20 microsatellite loci. A model-based Bayesian approach implemented in the software STRUCTURE was used to assign accessions into clusters. A dendrogram was constructed based on Roger's genetic distances. PRINCIPAL
RESULTS: The number of alleles per locus varied from 2 to 11, with an average of 4.7. The observed (H(O)) and expected (H(E)) heterozygosity values varied from 0 to 0.58 (mean of 0.18) and from 0.04 to 0.83 (mean of 0.55), respectively. Nine groups were assembled in STRUCTURE, and these groups were consistent with clusters inferred from the genetic distances and taxonomic varieties described for S. guianensis. The G(ST) among the nine groups was 0.46.
CONCLUSIONS: The low H(O) and the G(ST) values observed are in agreement with the outcrossing rate (26 %) estimated for this species. The data indicate a high genetic diversity among and within the botanical varieties and suggest that microsatellite-based information can be combined with classical taxonomy to elucidate infraspecific levels.

Introduction

The genus Stylosanthes belongs to the family Fabaceae and consists of 48 species found in tropical and subtropical regions of the Americas, Africa and Southeast Asia (Costa and Ferreira 1984; Costa 2006). The genus has two centres of diversity, the most important being located in central Brazil (Ferreira and Costa 1979; Stace and Cameron 1984). It includes 45 % of all Stylosanthes species and exhibits the greatest degree of phenotypic variation and endemism (Costa 2006). Mexico and the Caribbean Islands are also major centres of Stylosanthes diversity (Stace and Cameron 1984).

Stylosanthes guianensis (Aubl.) Sw. (2n= 20) is the most widespread Stylosanthes species and exhibits great phenotypic variation (Williams ; Vieira ). This species is native to South and Central America, where it is widely distributed, although not in the equatorial zone (Williams ). Stylosanthes guianensis is considered to be a promising forage crop in the Brazilian savannahs, and many accessions produce a large amount of dry matter and retain their leaves during the dry season (Andrade and Karia 2000; Maass and Sawkins 2004).

The taxonomic classification of S. guianensis is controversial, and different taxonomic groups have been proposed based on different morphological characters. Mannetje (1977, 1984) recognized seven different S. guianensis varieties: S. guianensis var. dissitiflora, S. guianensis var. gracilis, S. guianensis var. guianensis, S. guianensis var. intermedia, S. guianensis var. longiseta, S. guianensis var. marginata and S. guianensis var. robusta. Ferreira and Costa (1979) considered Mannetje's varieties to be different species. They proposed that S. guianensis was composed of the Mannetje S. guianensis var. guianensis but subdivided this species into four different botanical varieties. Analyses of random amplified polymorphic DNA (RAPD) markers (Kazan ; Vieira ), sequence-tagged site and internal transcribed spacer (ITS) sequences (Vander Stappen , 1999) demonstrated a high genetic diversity among the varieties proposed by Mannetje (1984), supporting their separation into distinct species. More recently, Costa (2006) used ITS sequencing and classical taxonomy to review the genus Stylosanthes. The ITS data support the classification proposed by Ferreira and Costa (1979) and Brandão , according to whom there are four botanical varieties of S. guianensis: S. guianensis var. guianensis, S. guianensis var. canescens, S. guianensis var. microcephala and S. guianensis var. pauciflora.

Vieira analysed the karyotypes of the botanical varieties described by Ferreira and Costa (1979) and Brandão , and four species considered to be S. guianensis varieties by Mannetje (1977, 1984). Their results demonstrate that the varieties proposed by Ferreira and Costa (1979) and Brandão have similar karyotypes, suggesting that S. g. canescens, S. g. microcephala and S. g. pauciflora may all have evolved from S. g. guianensis. The four species considered to be S. guianensis varieties by Mannetje (1977, 1984) have distinct karyotypes, supporting the classification proposed by Ferreira and Costa (1979) and Brandão .

Microsatellites, or simple sequence repeats (SSRs), are useful markers for a variety of applications in plant genetics because they are codominant, multiallelic, easily detected by polymerase chain reaction, relatively abundant and provide good coverage of the genome (Powell ). Microsatellite markers are available for three species of Stylosanthes: S. guianensis (Vander Stappen ; Santos ), S. capitata (Santos ) and S. macrocephala (Santos ). Vander Stappen described 18 genomic microsatellites in S. guianensis and tested them in 65 genotypes of S. guianensis and in the related species S. gracilis, S. hippocampoides, S. grandifolia, S. acuminata and S. longiseta. All 18 microsatellites were polymorphic among S. guianensis and its related species, and 16 were polymorphic within S. guianensis. Karia (2008) tested the microsatellites developed by Vander Stappen to evaluate the relationships among 437 accessions of the S. guianensis Brazilian germplasm collection and found that only seven were polymorphic among the accessions. Because of the limited number of markers, many relationships were unclear, and few could be clarified with respect to the population structure and to the clustering of the botanical varieties based on the results of Karia (2008). Considering the small number of polymorphic microsatellites available for this species and the need to better evaluate the Brazilian germplasm collection, Santos developed 46 new genomic microsatellites, 20 of which were polymorphic when tested in 20 S. guianensis accessions.

Santos-Garcia tested both sets of microsatellites (Vander Stappen ; Santos ) in 20 accessions that were used as maternal parents in a progeny array and found that only five were polymorphic and could be used to determine the mating system of S. guianensis. Based on the microsatellite data, these authors estimated the outcrossing rate in S. guianensis to be 26 %, indicating that the species presents a mixed mating system with predominance of autogamy.

Despite the importance of S. guianensis as forage in tropical areas and the fact that some Brazilian regions contain most of the diversity of this genus, few studies have been conducted to determine the genetic diversity in the Brazilian germplasm collection. The Brazilian S. guianensis collection was established in a series of collecting trips around Brazil and other South American countries, and it has not been subjected to any breeding selection. Genetic studies of this collection may provide valuable information for planning new collection trips as well as for the study of natural populations. Karia (2008) was the first to study this collection using molecular markers, but this analysis did not provide enough information to evaluate the genetic diversity of the collection or to clarify the botanical classifications and the relationships among the accessions.

Considering the classifications proposed by Ferreira and Costa (1979), Brandão and Costa (2006), we have selected a representative sample of the S. guianensis Brazilian germplasm collection consisting of 150 accessions that were either classified as one of the four botanical varieties or remained unclassified. We are dealing with botanical varieties of S. guianensis in this study, and their classification is still controversial. Currently, microsatellite markers have been the most widely used for inferring population structure that ultimately defines variation at the infraspecific level.

Considering that, we used microsatellite markers to analyse the S. guianensis accessions with the goals of (i) estimating the genetic diversity and relationships present among the accessions, (ii) determining the population structure of the samples and (iii) comparing the observed population structure to the proposed botanical varieties. The microsatellite-based population structure observed in these samples was generally in agreement with the proposed botanical varieties of S. guianensis.

Materials and methods

Plant material

A total of 150 accessions from the Brazilian Institution Embrapa Cerrados were selected to evaluate the genetic diversity, the population structure and the relationships among them. A list of the accessions with their sample codes, accession numbers, places of origin and botanical varieties is provided in Table 1.

Table 1

The S. guianensis collection used to assess the genetic diversity at 20 microsatellite loci. Shown are the sample codes, the respective accession numbers in the Embrapa Cerrados and CIAT (International Center for Tropical Agriculture) germplasm collections, the geographic collection site and the botanical variety of each accession.

Code	Embrapa Cerrados	CIAT number	Geographic sitea	Botanical varietyb
1	135	1297	Distrito Federal	pauciflora
2	464	n.a.	Tocantins	n.a.
3	517	1705	Mato Grosso	n.a.
4	648	1950	Colombia	guianensis
5	662	136	Colombia	n.a.
6	1121	1507	Venezuela	pauciflora
7	1132	1890	Venezuela	pauciflora
8	1139	1975	Colombia	n.a.
9	1144	2034	Bahia	pauciflora
10	1153	2315	Bahia	n.a.
11	1229	n.a.	Minas Gerais	microcephala
12	1230	2950	Minas Gerais	guianensis
13	1231	2951	Minas Gerais	n.a.
14	1235	n.a.	Goiás	n.a.
15	1237	2615	Tocantins	canescens
16	1239	2659	Pará	n.a.
17	1354	2991	Espirito Santo	pauciflora
18	1360	2549	Piaui	pauciflora
19	1365	2812	Venezuela	pauciflora
20	1368	2742	Minas Gerais	pauciflora
21	1369	2529	Bahia	pauciflora
22	1371	10 107	Goiás	microcephala
23	1372	2439	Pernambuco	pauciflora
24	1619	2748	Venezuela	n.a.
25	2203	2987	Bahia	pauciflora
26	2464	10 993	Tocantins	guianensis
27	2725	2974	Bahia	pauciflora
28	2734	2458	Paráiba	pauciflora
29	2738	2542	Ceará	pauciflora
30	2740	2708	Goiás	pauciflora
31	2741	2436	Alagoas	pauciflora
32	2761	2727	Distrito Federal	pauciflora
33	2771	2992	Espírito Santo	pauciflora
34	4142	n.a.	Tocantins	guianensis
35	4144	n.a.	Tocantins	canescens
36	4157	n.a.	Minas Gerais	canescens
37	4172	n.a.	Goiás	canescens
38	4173	n.a.	Tocantins	canescens
39	4174	n.a.	Maranhão	n.a.
40	4188	n.a.	Bahia	pauciflora
41	4193	n.a.	Bahia	pauciflora
42	4199	n.a.	Bahia	pauciflora
43	4227	n.a.	São Paulo	canescens
44	4233	n.a.	São Paulo	canescens
45	4237	n.a.	Minas Gerais	guianensis
46	4238	n.a.	Rio de Janeiro	guianensis
47	4239	n.a.	Minas Gerais	guianensis
48	4240	n.a.	Rio de Janeiro	guianensis
49	4262	n.a.	Minas Gerais	guianensis
50	4264	n.a.	Minas Gerais	guianensis
51	4286	n.a.	Goiás	n.a.
52	4292	n.a.	Goiás	pauciflora
53	4300	n.a.	Minas Gerais	guianensis
54	4302	n.a.	Rio de Janeiro	microcephala
55	4306	n.a.	Minas Gerais	guianensis
56	4308	n.a.	Minas Gerais	canescens
57	4314	n.a.	Pará	guianensis
58	4315	n.a.	Pará	guianensis
59	4322	n.a.	Pará	guianensis
60	4323	n.a.	Pará	guianensis
61	4324	n.a.	Pará	guianensis
62	4331	n.a.	Pará	guianensis
63	4336	n.a.	São Paulo	n.a.
64	4338	n.a.	São Paulo	n.a.
65	4364	n.a.	São Paulo	n.a.
66	4528	n.a.	Goiás	n.a.
67	4530	n.a.	n.a.	guianensis
68	5187	n.a.	Minas Gerais	pauciflora
69	5192	n.a.	Minas Gerais	pauciflora
70	5204	n.a.	Goiás	canescens
71	5206	n.a.	Minas Gerais	canescens
72	5221	n.a.	São Paulo	canescens
73	5233	n.a.	São Paulo	guianensis
74	5236	n.a.	Minas Gerais	microcephala
75	5239	n.a.	Goiás	microcephala
76	5248	n.a.	Goiás	pauciflora
77	5262	n.a.	Mato Grosso do Sul	microcephala
78	5277	n.a.	Minas Gerais	pauciflora
79	5279	n.a.	Minas Gerais	microcephala
80	5294	n.a.	n.a.	n.a.
81	5295	n.a.	n.a.	n.a.
82	5349	n.a.	Bahia	n.a.
83	1361	2445	Pernambuco	n.a.
84	5426	n.a.	n.a.	n.a.
85	5428	10 488	Pará	n.a.
86	5429	10 416	Pará	n.a.
87	5430	2649	Maranhão	n.a.
88	5432	2700	Goiás	microcephala
89	5433	2677	Tocantins	microcephala
90	5435	101 24	Minas Gerais	n.a.
91	5436	10 126	Espírito Santo	n.a.
92	5439	10 792	Minas Gerais	canescens
93	5440	10 793	Minas Gerais	canescens
94	5441	10 794	Minas Gerais	canescens
95	5445	10 799	Minas Gerais	canescens
96	5447	10 802	Minas Gerais	canescens
97	5454	10 825	Minas Gerais	canescens
98	5456	10 849	Minas Gerais	n.a.
99	5458	10 852	Minas Gerais	canescens
100	5460	10 854	Minas Gerais	canescens
101	5462	10 876	Minas Gerais	canescens
102	5464	10 888	Minas Gerais	n.a.
103	5469	10 808	Minas Gerais	n.a.
104	5471	10 826	Minas Gerais	microcephala
105	5474	10 872	Minas Gerais	n.a.
106	5476	n.a.	Minas Gerais	microcephala
107	5477	10 855	n.a.	microcephala
108	5484	10 814	Minas Gerais	n.a.
109	5488	10 821	Minas Gerais	pauciflora
110	5489	10 824	Minas Gerais	guianensis
111	5493	10 830	Minas Gerais	guianensis
112	5500	10 838	Minas Gerais	guianensis
113	5505	10 843	Minas Gerais	guianensis
114	5506	10 820	Minas Gerais	guianensis
115	5509	10 847	Minas Gerais	n.a.
116	5510	10 848	Minas Gerais	guianensis
117	5513	10 858	Minas Gerais	guianensis
118	5514	10 859	Minas Gerais	guianensis
119	5515	10 862	Minas Gerais	guianensis
120	5516	10 863	Minas Gerais	n.a.
121	5518	10 866	Minas Gerais	n.a.
122	5519	10 867	Minas Gerais	n.a.
123	5523	10 882	Minas Gerais	guianensis
124	5525	10 886	Minas Gerais	guianensis
125	5532	10 896	Minas Gerais	n.a.
126	5533	10 899	Minas Gerais	guianensis
127	5536	10 904	Minas Gerais	guianensis
128	5538	10 908	Minas Gerais	n.a.
129	EPAMIG-493c	n.a.	n.a.	n.a.
130	2745	n.a.	n.a.	n.a.
131	EPAMIG-1044c	n.a.	n.a.	n.a.
132	EPAMIG-1448c	n.a.	n.a.	n.a.
133	EPAMIG-443c	n.a.	n.a.	n.a.
134	NC 1099 Ac	n.a.	Minas Gerais	n.a.
135	NC 2270c	n.a.	Pará	guianensis
136	n.a.	10 283	Minas Gerais	guianensis
137	n.a.	10 285	Minas Gerais	pauciflora
138	IPF 394/75c	n.a.	n.a.	n.a.
139	EPAMIG-1529c	n.a.	Minas Gerais	n.a.
140	EPAMIG-1557c	n.a.	Minas Gerais	guianensis
141	EPAMIG-1670c	n.a.	Minas Gerais	guianensis
142	EPAMIG-1787c	n.a.	Minas Gerais	guianensis
143	EPAMIG-1691c	n.a.	Minas Gerais	guianensis
144	EPAMIG-1994c	n.a.	Minas Gerais	guianensis
145	2600	n.a.	Tocantins	n.a.
146	2676	n.a.	Tocantins	microcephala
147	2689	n.a.	Tocantins	microcephala
148	2694	n.a.	Tocantins	microcephala
149	LC 4297c	n.a.	n.a.	n.a.
150	LC 4471c	n.a.	n.a.	n.a.

n.a., not available.

aGeographic sites indicate the Brazilian state or other country where the plant was collected.

bAccording to Ferreira and Costa (1979) and Brandão .

cFor accessions without a number in the Embrapa Cerrados collection, the identification numbers in other germplasm collections or collector numbers are shown.

DNA extraction

DNA was extracted from the bulk leaf samples of four plants per accession using the cetyltrimethyl ammonium bromide method (Doyle and Doyle 1990) as modified by Bellon .

SSR amplification and detection

Twenty microsatellite loci were amplified from the DNA of all of the sampled accessions as previously described by Santos . Amplified fragments were separated on 6 % acrylamide gels and visualized by silver staining according to Creste .

Data analysis

The Genetic Data Analysis program (Lewis and Zaykin 2000) was used to estimate the observed and expected heterozygosities. Allele frequencies and Roger's genetic distance, as modified by Wright (1978), were estimated between all pairs of accessions using Tools for Population Genetic Analysis (Miller 1997).

The STRUCTURE software package (Pritchard ) was used to subdivide the accessions into the appropriate number of genetic clusters independent of any prior information concerning the geographic origin of the accessions. STRUCTURE uses a Bayesian approach to identify clusters based on their fit to Hardy–Weinberg proportions and their linkage equilibria. Ten STRUCTURE runs were performed by setting the number of populations (K) from 1 to 20. For each run, the burn-in time was set to 200 000, and the replication number was set to 300 000. The most likely number of distinct clusters (K) was determined according to the procedure described by Evanno . A graphical representation of the population assignments obtained from STRUCTURE was generated using R v.2.9.1.

DARwin 5.0 (Perrier and Jacquemoud-Collet 2006) was used to define the genetic relationships among accessions based on Roger's genetic distance and the UPGMA (unweighted paired group method) clustering method. FSTAT (Goudet 2001) was used to estimate Nei's GST (Nei 1973) among the groups obtained by the STRUCTURE analysis.

Results

We tested 20 genomic microsatellite loci developed by Santos and found that all loci were polymorphic within the group of accessions studied here. These 20 microsatellites generated 94 alleles that were used to study the genetic diversity among 150 S. guianensis accessions. The number of alleles ranged from 2 to 11 (Table 2), with an average of 4.7 alleles per locus. The SG03G8 locus exhibited the greatest number of alleles (11), followed by the SG03E2 locus with 10 alleles.

Table 2

The results of the analysis of 150 accessions of (Santos ). Shown are the locus names, primer sequences, repeat motifs, number of alleles per locus (A), observed heterozygosity (HO) and expected (HE) heterozygosity.

Locus	Primer sequence (5′–3′)	Repeat motif	A	HO	HE
SG03A7	5′TACGGAAGTCCCATTAGTGAGG3′	(AG)8	6	0.16	0.66
	5′GGCTGCCGGAAGTTGACG3′
SG03B5	5′AGGTGGATGCGAGTTCTT3′	(TG)7	2	0.00	0.04
	5′TCCCTTCTACCGAGTGTTC3′
SG03D4	5′GATCGGTCGGGTTGGCTACTAT3′	(GT)8	3	0.03	0.59
	5′CCTATTATCCCCATTCCTCACA3′
SG03E1	5′CCAAAGCGTAGAGAATGATGAG3′	(GT)8	2	0.00	0.43
	5′CAAATGGAGCGAAAGGACAA3′
SG03D1	5′GTGGCGAAAAATCTAAAATGTC3′	(GT)6	4	0.11	0.59
	5′GGTGGAATCCCTAACTGAAGA3′
SG03G2	5′GGTTGGAATATGGAGGAAGA3′	(GT)6	7	0.11	0.78
	5′GAGGAAAACTAAACAAAGCAGA3′
SG03G4	5′TTGCCTTTATCCTTGTCACTCA3′	(TG)8	5	0.06	0.68
	5′ATCAAGAATCCAATACCAAATG3′
SG01B9	5′TTACGCGAAAACCCGAACA3′	(AC)7	5	0.54	0.58
	5′GCACCTACAAAAGCTACACCAT3′
SG03G8	5′AATTAAAGAGGAGGAGGAAAGT3′	(CT)11…(CA)9	11	0.10	0.78
	5′TGGAGAAGTAAAAGACAGTGAG3′
SG01C2	5′TGAGAAGCACAAGGGATAAGGA3′	(GT)7	2	0.05	0.36
	5′CGAACCGGACCAAACCAT3′
SG01B12	5′ATTGTTAGGGATAGGTGATTA3′	(AC)7…(CT)4(TC)4	2	0.15	0.44
	5′TCGGAGTTGATTTGATTATG3′
SG01D7	5′ACATAAACTGGACAGGGTGATT3′	(AC)7	4	0.58	0.51
	5′ATTTTTGCGAGGTGCTAAGTC3′
SG01D3	5′AGATGGGCTAGATACGGAGATA3′	(AC)6…(AC)7	2	0.18	0.18
	5′TCGGAGTTGGTTTGATGGT3′
SG03A9	5′AGTCCCAGTACCCAGAACA3′	(CA)7	2	0.00	0.45
	5′AACCCCTTTTTAACACAACA3′
SG03E10	5′TCCCAGCTCGTATGAAGAAGTT3′	(GT)7	7	0.20	0.83
	5′GGACCCGGAGCACCTATC3′
SG03B10	5′CTCTAAACGATGAAAATGAACG3′	(GT)3G(GT)4 (TG)3(GT)6	7	0.35	0.79
	5′AAAGGAACAAAGGACGAGACAG3′
SG03E2	5′GTGCCCTTGAGCCCCCTTTAGT3′	(AC)8	10	0.35	0.68
	5′GAGCGGCGATCGGAGTTTGT3′
SG03E7	5′AAGATGGGCCAAAAGGAACAAA3′	(AC)6…(CT)5	4	0.03	0.73
	5′TGGAGTGGCTTACCGTGATTAC3′
SG01A7	5′TACCTTGAATCCGCACCTATGA3′	(AG)5…(GT)8	5	0.49	0.56
	5′CACCCGAACACCTAATCCTAAA3′
SG03E9	5′GGTCAAATGGGGCAAAAGA3′	(AC)5…(CA)5	4	0.11	0.40
	5′ATCGAAGAGGAAAAGGCTAACT3′

The observed and expected heterozygosity values (HO and HE) ranged from 0.00 to 0.58 (mean of 0.18) and from 0.04 to 0.83 (mean of 0.55), respectively. The markers with a higher observed heterozygosity were SG01D7 and SG01B9. In the case of bulk samples, a heterozygous pattern may be observed as a result of the presence of heterozygous plants in the DNA pool or variation within the accession (Zhang ).

Roger's genetic distances were estimated for each pair of accessions and varied from 0.00 (among several accessions) to 0.94 (between accessions 19 and 140), with an average of 0.66.

A model-based analysis performed by STRUCTURE was used to investigate the possible population structure within the collection sample (150 accessions). The number of clusters was set to nine, following the statistics presented in Evanno . In the ancestry plot (Fig. 1B), each accession is represented by a horizontal bar, and the length of each segment of the bar is proportional to the accession's estimated ancestry fraction from each of the nine groups. The same ancestry plot is shown in more detail in Supplementary Figure S1 [see Additional Information], which includes the sample codes for the accessions. The majority of the model-based groups were in agreement with the currently proposed S. guianensis taxonomic classification (Ferreira and Costa 1979; Brandão ). Some of the groups could also be correlated with the geographic origins of the accessions.

Fig. 1

(A) The Roger's genetic distance dendrogram of 150 . The colours in the dendrogram indicate the accession's group as assigned by STRUCTURE analysis. (B) The bar plot obtained from the model-based ancestry analysis of the same S. guianensis accessions implemented in the STRUCTURE software.

The number of accessions belonging to each variety that were assigned to one of the nine groups with >80 % probability is shown in Table 3. Of the 40 accessions belonging to S. g. guianensis, 11 were assigned to Group C, 5 to Group H and 14 to Group I. These groups are formed mostly by accessions belonging to this variety, which showed the greatest genetic diversity among all Stylosanthes varieties. The remaining 10 accessions from S. g. guianensis were distributed along with S. g. pauciflora accessions. Three of the accessions were assigned to Group B, two were assigned to Group G, and five were not assigned to any group with >80 % probability. Of the 28 S. g. pauciflora accessions, 13 were assigned to Group A (formed mostly by this variety), seven were assigned with S. g. guianensis in Groups B and G, two were in distinct Groups (E and I), and six were not assigned to any group with >80 % probability.

Table 3

The inferred ancestry of the 150 S. guianensis accessions relative to the groups obtained using STRUCTURE (A-I). Shown are the percentage of individuals belonging to each botanical variety that are assigned to each of the nine groups and the number of individuals assigned to each group with >80 % membership probability (in bold).

Botanical variety	A	B	C	D	E	F	G	H	I	P< 0.80
S. guianensis var. guianensis	0.02	3/0.07	11/0.31	0.01	0.00	0.02	2/0.08	5/0.12	14/0.36	5
S. guianensis var. microcephala	1/0.07	0.00	0.00	6/0.40	6/0.40	0.00	0.00	0.00	2/0.13	0
S. guianensis var. pauciflora	13/0.59	5/0.21	0.00	0.01	1/0.05	0.00	2/0.07	0.01	1/0.06	6
S. guianensis var. canescens	0.01	0.01	0.02	0.00	0.01	14/0.79	0.00	0.00	2/0.13	4
Unidentified	3/0.11	1/0.09	1/0.07	1/0.05	3/0.09	6/0.14	4/0.11	1/0.04	13/0.30	14

The 15 S. g. microcephala were mostly clustered in Groups D and E, both with six accessions. Group D contained six accessions belonging to S. g. microcephala and two non-classified accessions, and Group E contained six accessions belonging to S. g. microcephala, one accession from S. g. pauciflora and three non-classified accessions. Of the remaining three S. g. microcephala accessions, two were assigned to Group I and one to Group A.

The S. g. canescens accessions were clustered in a distinct Group (F) composed exclusively of this variety. Of the 20 S. g. canescens accessions studied, 14 were assigned to Group F.

In the dendrogram constructed using DARwin and the UPGMA method (Fig. 1A), the clusters, with few exceptions, were consistent with the groups generated using the Bayesian approach in STRUCTURE. The same dendrogram labelled with the sample code for the accessions is provided in Supplementary Figure S2 [see Additional Information].

The genetic differentiation among the S. guianensis groups, as clustered by the Bayesian approach, was estimated based on Nei's GST as 0.46, indicating that 46 % of differences resulted from the variation among groups. The remaining 54 % was a function of the genetic variation within groups.

Discussion

All 20 microsatellite markers from Santos were polymorphic among the 150 accessions analysed. The same set of microsatellite markers was tested previously (Santos-Garcia ), but only three were found to be polymorphic in that study, probably because the previous study was based on samples from breeding material, and many of the genotypes were closely related. In contrast, we have studied a diverse germplasm collection of accessions obtained in collecting trips around Brazil and other countries in South America.

The mean number of alleles per locus observed in this study (4.7) was higher than that reported by Vander Stappen for 65 S. guianensis genotypes and some related species but lower than that observed by Karia (2008) among 437 S. guianensis accessions; those authors reported mean numbers of alleles per locus of 3.7 and 6.43, respectively. These differences can be attributed to the number of accessions studied by each of the authors.

Considering the observed and expected heterozygosities, our data revealed a deficit in heterozygosity that was consistent with the S. guianensis outcrossing rate (26 %) that was estimated based on microsatellite data (Santos-Garcia ). The predominance of autogamy reduced the number of heterozygous samples, but some heterozygosity was maintained as a result of the 26 % outcrossing.

The genetic distances found among the studied accessions were higher than those previously reported for the species. The highest genetic distance (0.94) was observed between accessions 19 and 140. Accession 19 belongs to S. g. pauciflora and was collected in Venezuela; accession 140 belongs to S. g. guianensis and was collected in the Brazilian state of Minas Gerais. Accession 140 was one of the most divergent, and its mean genetic distance (0.75) is greater than the overall mean genetic distance (0.66). Kazan studied 31 S. guianensis accessions and observed a mean genetic distance of 0.26 using RAPD. Faleiro et al. (2003) also used RAPD to study 35 accessions and observed genetic distances varying from 0.04 to 0.54. Microsatellite markers are codominant and multiallelic with a high degree of polymorphism, making them more useful than dominant markers for revealing diversity (Laborda ). Powell compared the expected heterozygosities and the estimated genetic similarities based on different molecular marker types for the evaluation of a set of soybean accessions. Their results show that microsatellites have higher expected heterozygosity (0.61) and lower estimated genetic similarities (0.45) among accessions relative to RAPD markers (0.31 and 0.72, respectively).

STRUCTURE analysis was performed to investigate the population structure in the germplasm collection to compare the genetic population structure with the described botanical varieties. The nine groups generated based on microsatellite analysis were mostly consistent with the botanical classification. The S. g. microcephala and S. g. canescens varieties were well differentiated and formed individual groups. Although most of the accessions belonging to S. g. guianensis and S. g. pauciflora formed distinct groups, some of them were mixed together in other groups. These mixed groups generally contained small numbers of individuals, many of which were not classified into varieties. Stylosanthes g. pauciflora was recognized as a new botanical variety in 1985 (Brandão ); the three other varieties were recognized in 1979 (Ferreira and Costa 1979). This may have affected the classification process, and some of the accessions belonging to S. g. pauciflora may have been incorrectly classified as S. g. guianensis.

In previous studies, most S. g. microcephala accessions did not group together (Faleiro et al. 2003; Karia 2008). In the present work, these samples clustered into two diverse groups. Of the 15 S. g. microcephala accessions, five from the state of Minas Gerais were assigned to Group D, and six accessions (two from the state of Goiás and four from the state of Tocantins) were assigned to Group E. In both groups, the majority of the accessions were S. g. microcephala. The soil in Goiás and Tocantins is considered less fertile than the soil in Minas Gerais, and this difference in soil fertility may be the main driver of the observed genetic differentiation (Karia 2008). Our data reinforce the idea that the presence of S. g. microcephala in Minas Gerais is associated with more fertile soils, as proposed by Costa (2006). However, further studies are necessary to address this question and should include the collection and analysis of more plants from those regions. If genetic differentiation based on soil conditions is confirmed by further studies, this information could be useful for the development of new commercial varieties that are adapted to specific soil conditions.

The genetic data obtained in this study are also consistent with previously published karyological findings. All varieties have similar total chromosome lengths except for S. g. microcephala, which has visibly smaller chromosomes and the most asymmetrical karyotype (Fig. 2) (Vieira ). This variety predominantly formed Groups D and E (Fig. 1B). Stylosanthes g. canescens and S. g. microcephala are quite close in the dendrogram (Fig. 1A); in those varieties, chromosome 10 is submetacentric (2.58 and 2.55 as arm ratios, respectively) (Table 4), which is distinct from chromosome 10 in the other varieties. However, S. g. canescens has a uniquely submetacentric chromosome 8 (1.76 arm ratio). As revealed from the UPGMA-based dendrogram and the model implemented in the STRUCTURE software, S. g. guianensis and S. g. pauciflora share alleles at many of the microsatellite loci under investigation. The karyotypes of these two varieties are also very similar, except for chromosome 10, which is significantly smaller in S. g. guianensis than in S. g. pauciflora (7.08 and 8.56 relative lengths, respectively). As described above, this taxon was separated from S. g. guianensis.

Fig. 2

Ideograms of . The chromosome measurements were obtained from Vieira .

Table 4

The relative lengths and arm ratios of the chromosomes in S. guianensis varieties (modified from Vieira et al. 1993).

Variety	Chromosome pairs
	1	2	3	4	5	6	7	8	9	10
Relative length
S. g. canescens	11.94	11.17	10.87	10.43	10.35	9.70	9.58	9.11	9.00	7.83
S. g. guianensis	11.15	11.07	10.75	10.59	10.13	10.31	9.75	9.65	9.52	7.08
S. g. microcephala	12.16	11.36	10.66	10.80	10.09	9.94	9.40	9.19	8.72	7.70
S. g. pauciflora	11.64	10.97	10.80	10.31	10.39	9.96	9.59	8.91	8.86	8.56
Arm ratio
S. g. canescens	1.49	1.75	1.00	1.99	1.62	1.13	2.01	1.76	1.22	2.58
S. g. guianensis	1.47	2.02	1.1	1.92	1.82	1.10	1.90	1.44	1.20	1.53
S. g. microcephala	1.55	2.30	1.48	2.14	1.79	1.47	1.96	1.48	1.28	2.55
S. g. pauciflora	1.74	2.07	1.29	2.27	1.59	1.19	1.92	1.42	1.18	1.74

The GST observed in the present study was higher than that observed with allozymes in plants that exhibit a mixed mating system (Hamrick and Godt 1996), probably because autogamy is predominant in S. guianensis (26 % of outcrossing, as described above). In general, GST values in autogamous or predominantly autogamous species are higher than those in allogamous species (Hamrick and Godt 1996; Maki ). High variation values (30 %) were observed between groups of Mexican and South American accessions of Stylosanthes humilis using amplified fragment length polymorphism (AFLP) (Vander Stappen ). The variation was even higher in AFLP studies of S. humilis (59 %) and S. viscosa (66 %) (Sawkins ).

Stylosanthes g. microcephala and S. g. guianensis were distributed in more than one group of the STRUCTURE analysis. The genetic differentiation (GST) between the groups formed by S. g. microcephala was low (18 %) and, as discussed above, may be related to the soil conditions. However, the genetic differentiation among the three clusters formed mostly by the S. g. guianensis variety was 49 %, which is similar to the overall GST (46 %). Because most of the accessions from this variety that were included in this study were collected in the same Brazilian state, no conclusion can be drawn about the correlation between these data and the geographic origin of the accessions. More botanical and genetic studies of this variety should be conducted to determine whether it should be subdivided into multiple varieties based on the existing variation.

The accessions that were not classified into botanical varieties were randomly distributed in the genetic groups. Although groups were generally dominated by one botanical variety under both clustering methods (STRUCTURE and UPGMA), some superposition was observed. Considering these facts, the classification of individuals in each botanical variety based exclusively on the genetic groups cannot be accomplished with confidence, showing that taxonomic information is fundamental for correct classification. The consistency between the molecular analysis and botanical classification could be increased by the analysis of a larger number of microsatellite markers.

Conclusions and forward look

This study has revealed valuable information about the relationships among a large number of S. guianensis accessions, showing a population structure that is generally consistent with the taxonomic classification proposed by Ferreira and Costa (1979), Brandão and Costa (2006). These data show that molecular markers such as microsatellites can provide complementary information to address botanical questions at the infraspecific level. These data are important for existing germplasm conservation efforts and will help in planning new collecting trips and studies of natural populations of S. guianensis in its diversity centre. Moreover, information about the genetic diversity of germplasm collections is essential for their use in breeding programmes, mainly in guiding controlled crosses, as well as for the identification of natural and induced hybrids, and for monitoring the variability in subsequent generations.

Additional information

The following additional information is available in the online version of this article –

File 1. Fig. 1: The bar plot obtained from the model-based ancestry analysis of the S. guianensis accessions implemented in the STRUCTURE software. The numbers indicate the sample code given in Table 1.

File 2. Fig. 2: The Roger's genetic distance dendrogram for 150 S. guianensis accessions constructed using the UPGMA method implemented in DARwin. The colours in the dendrogram indicate the accession's group as assigned by STRUCTURE analysis. The numbers indicate the sample code given in Table 1.

Sources of funding

The work was funded by the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) (grant no. 2005/51010-0). M.O.S.-G. received a scholarship from FAPESP (2005/52211-9), and A.P.S. and M.L.C.V. received research fellowships from the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq).

Contributions by the authors

M.O.S.-G. performed experimental and statistical analyses and drafted the manuscript; M.I.Z. participated in statistical analysis; C.T.K. and L.C. participated in the germplasm selection and the design and implementation of the study; M.L.C.V. participated in the cytogenetic experiments and their interpretation; R.M.S.R. and A.P.S. conceived of the study and participated in its design and coordination. A.P.S. helped to draft the manuscript. All authors read and approved the final manuscript.

Conflict of interest statement

None declared.