Literature DB >> 22479333

Genomic organization, tissue distribution and functional characterization of the rat Pate gene cluster.

Angireddy Rajesh1, Suresh Yenugu.   

Abstract

The cysteine rich prostate and testis expressed (Pate) proteins identified till date are thought to resemble the three fingered protein/urokinase-type plasminogen activator receptor proteins. In this study, for the first time, we report the identification, cloning and characterization of rat Pate gene cluster and also determine the expression pattern. The rat Pate genes are clustered on chromosome 8 and their predicted proteins retained the ten cysteine signature characteristic to TFP/Ly-6 protein family. PATE and PATE-F three dimensional protein structure was found to be similar to that of the toxin bucandin. Though Pate gene expression is thought to be prostate and testis specific, we observed that rat Pate genes are also expressed in seminal vesicle and epididymis and in tissues beyond the male reproductive tract. In the developing rats (20-60 day old), expression of Pate genes seem to be androgen dependent in the epididymis and testis. In the adult rat, androgen ablation resulted in down regulation of the majority of Pate genes in the epididymides. PATE and PATE-F proteins were found to be expressed abundantly in the male reproductive tract of rats and on the sperm. Recombinant PATE protein exhibited potent antibacterial activity, whereas PATE-F did not exhibit any antibacterial activity. Pate expression was induced in the epididymides when challenged with LPS. Based on our results, we conclude that rat PATE proteins may contribute to the reproductive and defense functions.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22479333      PMCID: PMC3316536          DOI: 10.1371/journal.pone.0032633

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Spermatogenesis and sperm maturation occur in the testis and epididymis respectively. In the testis, a number of morphological, molecular and biochemical events allow the differentiation to spermatids [1]. Spermatozoa that leave the gonads are immature, non-motile and lack fertilizing ability and undergo post-gonadal differentiation in the epididymis. Their passage through the epididymis allows interaction with a wide variety of epididymal secreted proteins resulting in acquisition of motility and fertilizing ability [1]. Besides maturation in the epididymis, factors present in the secretions of the prostate and seminal vesicles are also thought to be involved in production of functional spermatozoa [2], [3], [4]. Epididymal and seminal vesicle fluid consists of a wide variety of proteins [5] which includes defensins [6], [7], lipocalins [8], cathelicidins [9], members of the sperm associated antigen 11 family [10], protease inhibitors [11], [12], [13], inhibitors of complement lysis [14], [15], lysozymes [16], [17] and the cysteine rich proteins such as CRISPs [18] and members of the PATE family [19], [20], [21], [22]. Pate gene family members identified in mouse and humans [19], [20], [21], [22] are located on chromosomes 11 and 9 respectively. The PATE proteins contain 10 cysteine residues and display an interesting feature wherein the cysteine at the C-terminal end is placed next to an aspargine to form a cysteine-aspargine (CN) dipeptide sequence [19]. The cysteines of PATE proteins form two motifs (C[XX]C[X7–8]C[X6]C[X7–8]C and C[X3]C[X15–16]CC[X4–5]CN. Pate genes in both mouse and humans are located closer to acrosomal vesicle protein 1 (ACRV1) gene, which encodes a protein that also contains 10 cysteine residues. Further, a characteristic feature of PATE proteins is that the distribution of the cysteine array resembles to that found in the three-fingered proteins (TFPs) [23], [24], uPAR and murine Ly-6 GPI anchored proteins [24], and activin receptors [25]. The functional roles of PATE proteins are not well characterized. Recent reports indicate their neuromodulatory activity [21] and inhibition of calcium uptake in the spermatozoa [26]. Cysteine rich proteins such as eppin and members of the WFDC family display potent antimicrobial activity [27], [28]. However, such functional analyses are not reported till now for the cysteine rich PATE proteins. The Pate gene cluster in the rat has received no attention. Among the eleven rat Pate gene sequences available in the GenBank, only Pate-B is reported, whereas the others are predicted. Further, no information is available about their expression pattern and functional significance. Though Pate genes are reported to be predominantly expressed in the testis and prostate, a recent study indicated their expression in the epididymis and not in the testis and prostate [22], suggesting a species specific expression pattern of these genes. Hence, it is very intriguing to determine the expression of rat Pate genes. In this study, we report the identification and characterization of ten rat Pate genes. Further, the expression profile of the Pate transcripts was analyzed and their androgen dependence determined. Since they are cysteine rich proteins and contain domains characteristic to venom proteins, their ability to kill bacteria was analyzed to demonstrate their possible contribution to the male reproductive tract immunity.

Results

In silico analyses

Ten of the eleven (the exception being Pate-B, which is already reported in Gen Bank) rat Pate mRNA transcripts were amplified and sequenced. They are localized on chromosome 8q21 within a 2.5 kb segment present between the Acrv1 and Ddx25 genes, a characteristic feature observed in the humans and mice (Figure 1). PCR amplification using gene specific primers resulted in two amplicons each for Pate and Pate-2. Sequence analysis of the Pate amplicons revealed that the 378 bp amplicon corresponds to Pate, whereas the 400 bp amplicon seems to be its alternate transcript. Similarly, an alternate transcript for Pate-2 was also observed. The Pate sequences were submitted to GenBank and were assigned the accession numbers - Pate-P – JQ031758; Pate-Q – JF412807; Pate-F – JF412806; Pate-A – JF412804; Pate-C – HQ687475; Pate-E – JF412805; Pate-N – HQ687476; Pate – JF412809; Pate-2 – HQ687477; Pate-Dj – HQ916281. Majority of them contained three exons (Figure S1). However, Pate, its alternate transcript, Pate-2 and its alternate transcript contained more than three exons. The number of exons reported in this study for each Pate transcript is in agreement with the information available in the rat genome. In silico protein translation analyses revealed that all the Pate mRNA transcripts except for the alternate transcripts of Pate and Pate-2, encode for proteins that are cysteine rich and contain the characteristic TFP/Ly-6/uPAR domain with a highly conserved distribution of 10 cysteines in two motifs (Figure 2). This is in agreement with the predictions available in the rat genome. Based on the ClustalW2 score, the homology among the rat PATE proteins was found to be high (Table 1). The rat PATE proteins are highly homologous to their known mouse and human counterparts (Table 2). All the Pate proteins identified in this study contain a signal peptide and seem to be secretory in nature (Figure S1). The predicted physical characteristics of the rat PATE proteins are given in Table 2. The alternate transcripts of Pate and Pate-2 contained a premature stop codon, because of which they do not encode the full length proteins (Figure S1) and hence were not characterized further.
Figure 1

Genomic localization of rat Pate genes.

Arrows indicate direction of transcription. Positions were taken from the Mapview (RGSC v3.4) at the National Center for Biotechnology Information (NCBI) website. Distance between genes is not to scale. Rat Pate sequences were submitted to GenBank and were assigned the accession numbers: Pate-P – JQ031758; Pate-Q – JF412807; Pate-F – JF412806; Pate-A – JF412804; Pate-C – HQ687475; Pate-E – JF412805; Pate-N – HQ687476; Pate – JF412809; Pate-2 – HQ687477; Pate-Dj – HQ916281.

Figure 2

Multiple sequence alignment of PATE proteins.

Alignment of rat PATE proteins. Signal peptide is shown in blue. The characteristic ten cysteines are indicated in red and underlined. The conserved amino acid residues are shaded.

Table 1

ClustalW2 score for rat PATE proteins.

PATE-PPATE-QPATE-FPATE-APATE-CPATE-EPATE-NPATEPATE-2PATE-DjPATE-B
PATE-P 82282625241621172722
PATE-Q 272722301722152722
PATE-F 5030222217182327
PATE-A 33221616201924
PATE-C 301322212022
PATE-E 1420172719
PATE-N 15222617
PATE 172621
PATE-2 2218
PATE-DJ 23
PATE-B
Table 2

General characteristic features of rat PATE proteins.

Name of the proteinLength (aa)MW (kD)pISignal peptideNet chargeO-Gly sitesMyristyltionsitesPhosphorylationHomology with mouse counterpartHomology with human counterpart
SerThrTyr
PATE-P10111.048.311 to 21−3Nil-Nil-66845772%
PATE-Q10110.998.321 to 21+3Nil-Nil-66845771%
PATE-F10912.278.541 to 21+4Nil-Nil-79,83,86Nil58,87,106
PATE-A11512.989.271 to 23+10Nil-Nil-Nil63Nil89%
PATE-C10611.96.681 to 190Nil-Nil-27,72,806828,8273%
PATE-E10912.554.771 to 20−6Nil-Nil-Nil27,5129,68,80,82,9528%
PATE-N11914.146.861 to 220Nil-Nil-18,29,10128,37,5633,49,60,84,10288%
PATE12514.359.071 to 21+9Nil-Nil-Nil69Nil26%62%
PATE-V19911.38.531 to 21+3Nil-Nil-87,90699280%62%
PATE-210812.68.451 to 16+4Nil-Nil-66,74,994558,70,10183%70%
PATE-DJ9811.569.081 to 18+8Nil-Nil-Nil20,637786%63%
PATE-410211.276.851 to 230Nil-Nil-NilNilNil57%38%

Genomic localization of rat Pate genes.

Arrows indicate direction of transcription. Positions were taken from the Mapview (RGSC v3.4) at the National Center for Biotechnology Information (NCBI) website. Distance between genes is not to scale. Rat Pate sequences were submitted to GenBank and were assigned the accession numbers: Pate-P – JQ031758; Pate-Q – JF412807; Pate-F – JF412806; Pate-A – JF412804; Pate-C – HQ687475; Pate-E – JF412805; Pate-N – HQ687476; Pate – JF412809; Pate-2 – HQ687477; Pate-Dj – HQ916281.

Multiple sequence alignment of PATE proteins.

Alignment of rat PATE proteins. Signal peptide is shown in blue. The characteristic ten cysteines are indicated in red and underlined. The conserved amino acid residues are shaded.

Pate gene expression in the rat

Though Pate gene expression is thought to be prostate and testis specific, we found them to be expressed in the epididymis and seminal vesicle (Figure 3). Pate-Q mRNA was detected in the caput, seminal vesicle and prostate. Epididymis specific expression was observed for Pate-F, Pate-Dj and Pate-A. Pate-C, Pate-N and Pate-2 were found to be expressed in all the tissues analyzed. Pate and Pate-E expression was found to be present in the epididymis and prostate, whereas Pate-B was confined to seminal vesicle and prostate. Pate-P expression was not found in any of the male reproductive tract tissues analyzed (Figure 3). Since, the alternate transcripts of Pate and Pate-2 are predicted to code for truncated proteins lacking the Ly-6 motif, we did not characterize them further. To determine if the expression pattern of Pate mRNA transcripts is male reproductive tract specific, RT-PCR was performed in a variety of tissues obtained from male and female rats (Figure 4). Pate, Pate-F, Pate-A, Pate-E, Pate-B and Pate-N were not found to be expressed in non-reproductive tissues of male rat and in the female reproductive tract tissues. However, Pate-Q and Pate-Dj expression was detected in the liver, whereas Pate-P was detected in the ovary. Weak expression of Pate-2 and Pate-C was observed in majority of the tissues analyzed.
Figure 3

Expression of Pate genes in the male reproductive tract of rat.

Total RNA isolated from the caput, corpus, cauda, testis, seminal vesicle and prostate of adult rats was reverse transcribed and Pate mRNAs amplified using gene specific primers. Arrows indicate the representative alternate transcripts of Pate and Pate-2.

Figure 4

Tissue distribution of Pate genes in the rat.

RT-PCR analysis was performed using total RNA isolated from Brain, Heart, Lung, Liver, Kidney, Spleen, Ovary, Uterus and Cervix of adult rats.

Expression of Pate genes in the male reproductive tract of rat.

Total RNA isolated from the caput, corpus, cauda, testis, seminal vesicle and prostate of adult rats was reverse transcribed and Pate mRNAs amplified using gene specific primers. Arrows indicate the representative alternate transcripts of Pate and Pate-2.

Tissue distribution of Pate genes in the rat.

RT-PCR analysis was performed using total RNA isolated from Brain, Heart, Lung, Liver, Kidney, Spleen, Ovary, Uterus and Cervix of adult rats.

Androgen dependent expression

Gene expression in the male reproductive tract is under the influence of androgens [29], [30]. To elucidate the effect of androgen variation, PCR analyses for Pates were carried out using total RNA isolated from the epididymides of 20–60 day old rats. Pate-Q, Pate-C, Pate-2, Pate-E and Pate-Dj were found to be expressed in the epididymides throughout the development, where as Pate-N and Pate were expressed starting from 30 days (Figure 5). Pate-F and Pate-A expression in the epididymis seems to appear from 40 days during development. The absence of certain Pate transcripts in the caput or cauda during development (Figure 5) seems to correlate with the expression profile observed in the male reproductive tract tissues obtained from the 90 day old rats (Figure 3). For example, Pate-Q and Pate-F expression was restricted to the caput in the 90 day old rats and their expression is also not observed in the corpus and cauda during development. Similarly, Pate expression was absent in the caput of 90 day old rat and in the developmental regulation analyses, its expression is absent in the caput of 60 day old rat. These results indicate that expression of some of the Pate genes in the epididymis seems to be suppressed during development. Pate-P and Pate-B were not found to be expressed in the epididymides obtained from all the age groups, which is consistent with their absence in the epididymis of adult rat.
Figure 5

Pate gene expression in the epididymides of developing rats.

RNA was isolated from the epididymides of 20–60 day old rats, reverse transcribed and PCR for Pate genes performed. Caput, corpus and cauda obtained from 50 and 60 day old animals are indicated as Cp, Co and Cu respectively.

Pate gene expression in the epididymides of developing rats.

RNA was isolated from the epididymides of 20–60 day old rats, reverse transcribed and PCR for Pate genes performed. Caput, corpus and cauda obtained from 50 and 60 day old animals are indicated as Cp, Co and Cu respectively. Though majority of the Pate genes were not expressed in the adult testis (Figure 3), it is possible that they may be expressed in younger rats during development. To determine, whether Pate genes have a role in testis development PCR analyses was carried out using mRNA isolated from testis of 20–60 day old rats. Pate-C and Pate-N were found to be weakly expressed starting from day 30 in the developing rats, whereas the other Pate genes were not detected at all the ages analyzed (Figure 6). The weak expression of Pate-C and Pate-N in the developing testes is consistent with the lower levels observed in the adult rats (Figure 3).
Figure 6

Pate gene expression in the testes of developing rats.

RNA was isolated from the testes of 20–60 day old rats, reverse transcribed and PCR for Pate genes performed.

Pate gene expression in the testes of developing rats.

RNA was isolated from the testes of 20–60 day old rats, reverse transcribed and PCR for Pate genes performed. To gain further knowledge into the role of androgens in regulating Pate gene expression, RT-PCR analyses was performed using epididymides obtained from androgen ablated rats with or without testosterone supplementation. PCR analyses were performed for those Pate genes that were expressed in the adult epididymis. Androgen ablation resulted in complete loss of Pate gene expression (Figure 7). Dihydrotestosterone supplementation reverted the expression of majority of the Pate genes except Pate, Pate-A and Pate-F. These results suggest that Pate genes are under the control of androgens in the epididymis.
Figure 7

Androgen regulation of Pate gene expression in the adult rat.

Adult male Wistar rats were either sham operated or castrated or castrated and DHT supplemented. Two weeks after castration total RNA was isolated from the epididymides and PCR analyses carried out for the expression of Pate genes.

Androgen regulation of Pate gene expression in the adult rat.

Adult male Wistar rats were either sham operated or castrated or castrated and DHT supplemented. Two weeks after castration total RNA was isolated from the epididymides and PCR analyses carried out for the expression of Pate genes.

Three-dimensional structure prediction

Among the Pate genes identified, we chose Pate and Pate-F because of their predominant expression in the epididymis for further characterization. Three-dimensional (3D) modeling of mature PATE and PATE-F proteins displayed structure similar to the three fingered toxin, bucandin (Figure 8A–C), a neurotoxin. PATE and PATE-F in different orientations are shown (Figure S2). Superimposition of the 3D structures of PATE and PATE-F reveal that they match to a larger extent (Figure 8D). PATE-F structure is in agreement with bucandin structure (Figure 8F). PATE structure also seems to be matching with bucandin structure (Figure 8E), but not to an extent to that of PATE-F, because of the additional amino acid sequence coded by the extra exon. The root mean square distance (RMSD) value for PATE and PATE-F superimposition was 1.93, suggesting structural similarities between these proteins. However, the RMSD values for PATE-Bucandin and PATE-f-Bucancin superimpositions were 3.5 and 2.9 respectively. Basing on the manual alignment of PATE, PATE-F and Bucandin, it can be expected that five disulfide bridges could be formed similar to that in Bucandin (Figure S3). Ramachandran plot analyses revealed that the percentage of amino acids in the allowed regions for PATE and PATE-F was 78.9 and 79.5 respectively (data not shown). There were no amino acids (0 percent) in the disallowed regions. The G factor values for PATE and PATE-F were −0.57 and −0.29 respectively. All the three proteins contain three fingered structure. ClustalW2 analysis revealed that the similarity score between bucandin and PATE was 22 and it was 14 between bucandin and PATE-F. Though there is less of sequence similarity among these proteins, they seem to have conserved the organization of 10 cysteine residues that may contribute to their structural similarity.
Figure 8

Three dimensional protein structure predictions.

Protein sequences were submitted to FUGUE threading server and the best model was selected based on best Z score value obtained. The final structure of PATE and PATE-F was generated using the best model by modeler 9.10. Purple regions indicate conserved cysteines. Cartoon models of A) rat PATE, B) rat PATE-F, C) Bucandin, D) PATE (blue) and PATE-F (red) superimposed, E) PATE (blue) and Bucandin (red) superimposed and F) PATE-F (red) and Bucandin (blue) superimposed.

Three dimensional protein structure predictions.

Protein sequences were submitted to FUGUE threading server and the best model was selected based on best Z score value obtained. The final structure of PATE and PATE-F was generated using the best model by modeler 9.10. Purple regions indicate conserved cysteines. Cartoon models of A) rat PATE, B) rat PATE-F, C) Bucandin, D) PATE (blue) and PATE-F (red) superimposed, E) PATE (blue) and Bucandin (red) superimposed and F) PATE-F (red) and Bucandin (blue) superimposed.

Immunolocalization

To allow further insight into the functional role of PATE proteins in male reproductive tract and to confirm whether their mRNA are translated into proteins, we analyzed their expression using immunofluorescence techniques. PATE protein was found to be abundantly localized in the cauda (Figure 9) and appears to be present throughout the epithelium, suggesting that it may be secreted into the lumen. PATE-F protein was also found to be expressed abundantly in the caput (Figure 9). Similar to PATE, PATE-F is localized throughout the epithelium and on the spermatozoa.
Figure 9

Immunolocalization of rat PATE and PATE-F in the epididymis.

Serial sections of the rat tissues were subjected to antigen retrieval in citrate buffer pH 6.0. They were then probed with polyclonal antibodies (1∶250 dilution) raised in rabbit against PATE and PATE-F followed by TRIC (for PATE) or FITC (for PATE-F) conjugated secondary antibody (1∶500 dilution) against rabbit IgG raised in goat. Sections were counter-stained with DAPI. Panels A–C – preimmune serum; D–F – immune serum. Magnification – 10×.

Immunolocalization of rat PATE and PATE-F in the epididymis.

Serial sections of the rat tissues were subjected to antigen retrieval in citrate buffer pH 6.0. They were then probed with polyclonal antibodies (1∶250 dilution) raised in rabbit against PATE and PATE-F followed by TRIC (for PATE) or FITC (for PATE-F) conjugated secondary antibody (1∶500 dilution) against rabbit IgG raised in goat. Sections were counter-stained with DAPI. Panels A–C – preimmune serum; D–F – immune serum. Magnification – 10×. Localization of PATE and PATE-F proteins on the sperm was analyzed using immunofluorescence. PATE was found to be present throughout the sperm surface, whereas, PATE-F localization was restricted to the head region (Figure 10). Presence of PATE proteins on the sperm surface indicates their possible role in spermatogenesis and sperm maturation.
Figure 10

Immunofluorescence detection of PATE and PATE-F on rat sperm.

Cauda epididymides from adult rats were dissected out and the spermatozoa collected were air dried and fixed on glass slides by methanol. PATE and PATE-F localization was carried out by incubating with PATE and PATE-F polyclonal antibodies raised in rabbit followed by FITC conjugated secondary antibodies against rabbit IgG raised in goat. Counter staining was carried out using DAPI. A–C, preimmune serum. D–F, immune serum. Magnification – 60×.

Immunofluorescence detection of PATE and PATE-F on rat sperm.

Cauda epididymides from adult rats were dissected out and the spermatozoa collected were air dried and fixed on glass slides by methanol. PATE and PATE-F localization was carried out by incubating with PATE and PATE-F polyclonal antibodies raised in rabbit followed by FITC conjugated secondary antibodies against rabbit IgG raised in goat. Counter staining was carried out using DAPI. A–C, preimmune serum. D–F, immune serum. Magnification – 60×.

Antimicrobial activity

Proteins with cationic nature or rich in cysteine content like eppin and WFDC proteins are known to exhibit antimicrobial activity [27], [28]. Because of their cationic nature (pI = 9.0 for PATE and pI = 8.54 for PATE-F) and high cysteine content they might be expected to exhibit antimicrobial activity. PATE at higher concentrations (50 and 100 µg/ml) exhibited bacterial killing activity, whereas PATE-F even at a concentration of 100 µg/ml did not display any antibacterial activity (Figure 11A).
Figure 11

Antibacterial activities of rat PATE and PATE-F and their response to endotoxin challenge.

A, Mid-log phase E. coli were incubated with 0 (○), 10 (▪), 25 (▴), 50 (•) and 100 (♦) µg/ml rat recombinant PATE or 100 µg/ml of PATE-F (◊) protein for 0–180 min. After incubation, the assay mixture was serially diluted with 10 mM phosphate buffered saline (pH 7.4), plated on LB plates and incubated overnight. Colonies were hand counted. Values shown are Mean ± S.D. * indicates p<0.05. B, Rat epididymides were maintained in nutritive medium (136.89 mM NaCl, 5.63 mM KCl, 1.80 mM CaCl2, 0.36 mM NaH2PO4, 14.88 mM NaHCO3 and 5.55 mM glucose pH 7.6–7.8) and challenged with LPS (1 µg/ml) for 0, 3, 6 and 9 h. RNA was isolated after LPS treatment and the expression of rat Pate in the epididymides was analyzed by RT-PCR. C, Rats were challenged with a single intraperitoneal dose (1 mg/kg body weight) of LPS and epididymides were collected at 0, 3, 6, 9, 15 and 24 h after injection. RNA isolated from the epididymides was used for Pate gene expression.

Antibacterial activities of rat PATE and PATE-F and their response to endotoxin challenge.

A, Mid-log phase E. coli were incubated with 0 (○), 10 (▪), 25 (▴), 50 (•) and 100 (♦) µg/ml rat recombinant PATE or 100 µg/ml of PATE-F (◊) protein for 0–180 min. After incubation, the assay mixture was serially diluted with 10 mM phosphate buffered saline (pH 7.4), plated on LB plates and incubated overnight. Colonies were hand counted. Values shown are Mean ± S.D. * indicates p<0.05. B, Rat epididymides were maintained in nutritive medium (136.89 mM NaCl, 5.63 mM KCl, 1.80 mM CaCl2, 0.36 mM NaH2PO4, 14.88 mM NaHCO3 and 5.55 mM glucose pH 7.6–7.8) and challenged with LPS (1 µg/ml) for 0, 3, 6 and 9 h. RNA was isolated after LPS treatment and the expression of rat Pate in the epididymides was analyzed by RT-PCR. C, Rats were challenged with a single intraperitoneal dose (1 mg/kg body weight) of LPS and epididymides were collected at 0, 3, 6, 9, 15 and 24 h after injection. RNA isolated from the epididymides was used for Pate gene expression.

Endotoxin effect on Pate expression

Since the recombinant PATE protein showed potent antibacterial activity in vitro, its possible functional role during infection or under conditions that mimic an infection to counter pathogen attack in the male reproductive tract was investigated. To accomplish this, Pate expression was analyzed by semi-quantitative RT-PCR in the cauda epididymides challenged with LPS in vitro. Though Pate expression is not observed in the untreated control, it was up regulated 3 hours after LPS challenge followed by a decline at the later time points (Figure 11B). To determine whether, the effects observed in vitro are replicated in vivo, Pate expression was analyzed in the cauda epididymides obtained from rats challenged with a single dose of LPS. Pate mRNA levels were found to be increased 15 h after LPS injection (Figure 11C). These results suggest that Pate may have a role in contributing to the innate immune responses of the male reproductive tract during endotoxin challenge.

Discussion

Epididymal fluid is a complex mixture of proteins [31] that is thought to modify sperm surface during epididymal transit and maturation. PATE proteins, though reported to be present in the male reproductive tract of humans and mouse, their role in this organ system still remains elusive. The expression pattern of Pate genes and proteins are not characterized in the rat. In this study, we analyzed their mRNA and protein expression to determine their possible roles in male reproductive tract function and immunity. In silico analyses revealed that all the ten Pates identified in ths study are clustered on chromosome 8 within a 2.5 kb segment present between the Acrv1 and Ddx25 genes. Similar organization of Pate genes is observed in the mouse and humans [21], [22]. Further, majority of the Pate mRNAs are encoded by three exons, whereas Pate and Pate-2 are coded by five and four exons respectively. This is in agreement with the gene structure available at GenBank. Similar exon structure was reported in the human and mouse, wherein Pate and Pate-2 were encoded by five and four exons respectively and the rest of the Pates are encoded by three exons, adding further evidence that these gene are highly conserved among the species. Sequence analyses of the alternate transcripts of rat Pate and Pate-2 revealed that they encode for truncated proteins lacking the ten cysteine signature and. could have functional roles that are different than their counterparts. A high degree of homology among the rat PATE proteins suggests a common physiological function, such as regulating the activities of ion-channels, as was demonstrated for the human PATE-B, mouse PATE-C and PATE-B [21], [26]. Rat PATE proteins can be classified to the secreted Ly-6 family, because of their 10 cysteine signature and the presence of three fingered protein structure. The similarity of PATE and PATE-F three dimensional structures to the toxin bucandin a 63 amino acid neurotoxin isolated from the Malaysian krait (Bungarus candidus) [32] gives a clue to understand the role of PATE and PATE-F in nerve function. The RMSD value (1.9) obtained when PATE and PATE-F 3D structures were superimposed is a clear indication that these proteins share structural simililarity. PATE-Bucandin and PATE-F-Bucandin protein superimpositions resulted in RMSD values of 3.5 and 2.9 respectively; values that do not indicate a high degree of similarity between PATE proteins and Bucandin. In our analyses, we did not apply in depth the various factors (compactness, hydrogen bonding, percent secondary structure, principal component analyses, etc) that affect the RMSD and this could have resulted in high values. To the best of our knowledge, we report for the first time the expression pattern of Pate mRNA transcripts in the rat. Pate gene expression is not restricted only to the prostate and testis, as indicated by their nomenclature. However, organ (epididymis) specific expression of rat Pate (Pate-F and Pate-A) was observed in our study similar to the mouse, wherein Pate-F and Pate-Dj were testis specific and Pate-Q and Pate-P were restricted to the placenta [21]. On the same lines, the human Pate-Dj mRNA was detected only in the testis. Reproductive tract specific expression was also demonstrated for other genes such as Spag11e [33], DEFB118 [34] and members of the HE2 family [10]. The expression of rat Pate genes in non-reproductive and female reproductive tissues suggests that they may have functions beyond male reproductive tract physiology. Such observations were reported for the mouse and human Pate genes [21], [22]. Hormonal regulation of a wide variety of genes due to fluctuations of androgens at various stages of development in the male reproductive system is well reported [35]. Androgen levels in the epididymis of rat decline from birth until 20 days and a normal level of 10 ng/g tissue (35 nM) is maintained until approximately 40 days after which, the levels begin to increase to that of the adult, between 15–20 ng/g [36]. Serum testosterone levels in the young rat remain low and do not begin to increase to adult levels until 35–40 days of age [37]. Absence of Pate-A, Pate-F, Pate-N and Pate-Dj in the epididymides during early development (20–30 days) correlate with reported low levels of androgens. Pate-Q, Pate-F and Pate-A in the adult rat (90 days old) was restricted to the caput. In the developing rat epididymis also, their expression was restricted to the caput in the 50 and 60 day old rats. The expression observed in the 30 and 40 day old animals could be due to the use of whole epididymides . It is possible that the expression of these genes could be restricted to the caput in the younger animals also. Presence of some of the Pate mRNA transcripts at all the stages of development indicated their androgen independent expression in the epididymis. Variation in testicular androgens during development in the rat is quite different from the epididymis. A steady increase in testosterone levels occurs in the rete testis of 30–130 day old rats [38], [39]. Though majority of the Pate mRNA were not detected in the adult rat, we analyzed their expression in the testis to determine whether they are expressed in the developing rats and whether they have a possible role in testicular development. Among the Pate genes (Pate-N, Pate-C and Pate-2), whose expression was barely detected in the adult rats, Pate-C and Pate-N were found to be expressed at very low levels in the testes of developing rats starting from day 30. The expression pattern of Pate transcripts in the testis is androgen dependent since it correlates with the minimal androgen levels from day 20 to day 40 and increased androgen in the adult [36]. The role of androgens in governing Pate gene expression was evident since a down regulation was observed in the epididymides of castrated rats and that DHT supplementation reverted the mRNA levels. Pate gene expression in relation to androgens was reported in the human and mouse. In the human dorsal prostate, PATE-B and PATE-E were found to be up regulated in castrated rats, whereas in the ventral prostate, no changes were observed for PATE-H under the same conditions [21]. In the mouse, mixed responses in Pate gene expression was observed in the initial segment, caput and proximal epididymis of gonadectomized mice [22]. Androgen regulation of Pate genes seem to vary among the species and in the organs within species, suggesting a more complex network of regulatory mechanisms that may include the testicular factors. PATE and PATE-F proteins were found to be abundantly localized in the male reproductive tract and on the spermatozoa. Similar PATE protein expression in the reproductive tract and on the sperm is reported in the mice and humans [19], [21], [22] implicating that they may have similar functions. Further, the exact role of PATE proteins in the male reproductive tract remains elusive, though their possible role in calcium transport to regulate acrosome reaction is reported [26]. In this study, PATE was found to be predominantly localized on the sperm tail, whereas PATE-F was restricted to the sperm head. Human PATE and PATE-B were found to be localized only on the sperm head [20], [21]. The presence of PATE-F specifically on the sperm head suggests that it may be involved in fertilization, whereas PATE localization on the tail sperm surface may contributes to motility. Cysteine rich proteins belonging to the WFDC family, eppin and defensins are known to exhibit potent antimicrobial activity and the mechanisms involve permeabilization of bacterial membranes and inhibition of macromolecular synthesis [27], [28]. Further, snake toxins that contain the Ly-6 domain are shown to be involved in defense against microbes [40]. In this study, we report that rat PATE exhibited potent antimicrobial activity, a property that is highly conserved in LY-6 family of proteins; and PATE may function to confer antimicrobial defense mechanisms in the male reproductive tract. PATE-F, on the other hand, did not exhibit any antimicrobial activity, suggesting a varied functional nature among the PATE proteins. Since PATE protein displayed potent antimicrobial activity, its epididymal expression was analyzed in response to LPS in vitro and in vivo. We observed an induction of Pate gene expression during LPS challenge, suggesting that the innate immune responses in the male reproductive tract under these conditions may involve alterations in Pate mRNA expression. Ours is the first study that provides evidence on the possible involvement of Pate genes in the male reproductive tract immunity. However, the expression profile of PATE protein in response to LPS challenge or bacterial infection and its ability to clear the invading pathogens needs further investigation. Based on the results of this study, we conclude that Pate genes are abundantly expressed in the male reproductive tract and are androgen dependent. Their presence on the sperm and their ability to be antimicrobial and respond to endotoxin challenge implicates a role in fertility and male reproductive tract defense mechanisms as well.

Materials and Methods

The rat Pate predicted sequences were obtained from the rat genome (build RGSC v3.4) at the NCBI website (http://www.ncbi.nlm.nih.gov/). HUGO nomenclature was followed for the gene and protein notation used in this study. Gene symbols are italicized, with only the first letter in uppercase and the remaining letters in lowercase (Pate). Protein designations are the same as the gene symbol; all uppercase, but are not italicized (PATE). Gene specific primers were designed for each Pate mRNA (Table 3). RT-PCR was performed using rat testis and epididymis mRNA as the template. The Pate PCR amplicons were sequenced, aligned and deposited in GenBank. The corresponding exon/intron boundaries were determined by aligning the cDNA with the genomic sequence. The sequences were translated and the predicted physical features of the deduced amino acid sequences were analyzed using tools available at ExPASy proteomics server (http://ca.expasy.org/).
Table 3

Gene specific primers used in this study.

Gene NameForward primer(5′ → 3′)Reverse Primer(5′ → 3′)
Pate-P ATGGGAAAGGACATCTTGCTGCTC TCACGGATATGGTTTATTGCAG
Pate-Q ATGGAAAAGCACATCTTGCTGCTCC TCAGGTATGTGCTTTATTGCAG
Pate-F AGACTGAGATGGGCAAGCT ACCTCTTGCATTGAAAAGATAG
Pate-A GAGTCTGCAACCTGCTCTCATCTA ATGTTGGGGTACAGCCAGA
Pate-C ATGGAAAACCTACTGAAGCTGTGCC CTAAGTCATTACGATTGGAAAACCG
Pate-E ACCTGCTGCAAGAATTAGAAGATCC AAGATGAGGAAGACTGGAGG
Pate-N ATGGACTGGCTCCTGTTTCTTTTG TTAGACAAAATTATTTTCTTTGAAGTG
Pate ATGTTCAAGCCCCACTTACTGAG CTAGAAAAAGAATGCTTTCCCTGTGAC
Pate-2 ATGCTGGTGATAGTCTGTTTGTTCTGCC CTAGAGTCCCATTGGGAGGTT
Pate-Dj ATGAACAGGCACTTCTTGCTGCTC TTAAAGTCTGAAGTTACAAAAATC
Pate-B CAAGCCACCTTCTAACATCCA GCTTAAAACAACACGCAT
To generate the possible three dimensional structures of PATE and PATE-F, their protein sequences were initially submitted for BLAST against PDB database to search for homologous proteins. In the absence of any homologous proteins to PATE and PATE-F in the existing database even with the identity of TWILIGHT region, the sequences were submitted to FUGUE threading server. The parameters are set to generate the five best models and the best model is selected based on best Z score value obtained. This model was taken as the template to generate the final structure of PATE and PATE-F by using modeler 9.10. There were 100 models with different energy constituents generated, of which we selected the models with lowest energy constituents. In order to refine these residues ModLoop database was used to address the amino acid residues that fall in the disallowed regions based on the Ramachandran plot values. The obtained structure was energy minimized in the Gromos Force field by Gromacs software.

Tissue specimens and RT-PCR

All the animals used in the study were obtained from National Institute of Nutrition, Hyderabad, India. Tissues collected from Wistar rats (aged 20–90 days; n = 3) were placed in RNALater (Ambion Inc, Austin, TX, USA) solution overnight at 4°C to allow penetration and fixation and stored at −70°C. Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) from the following tissues: the three regions of the epididymis (caput, corpus and cauda), testis, prostate, seminal vesicle, brain, liver, lung, kidney, heart, spleen, cervix, ovary and uterus. Total RNA (2 µg) was reverse transcribed using 200 U SuperSciptIII (Invitrogen, Carlsbad, CA, USA) and 0.5 µg of oligodT (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. 2 µl of the resultant cDNA was amplified by PCR using gene specific primers (Table 3). A typical PCR reaction consisted of the following conditions: 94 C for 2 min followed by 25–35 cycles at 94 C for 30 sec, 56 C for 30 sec and 72 C for 30 sec, and with a final round of extension at 72 C for 10 min. PCR amplicons were analyzed on 2% agarose gels and sequenced. To study the expression of Pate transcripts under androgen ablated conditions, epididymides were obtained from sham operated, castrated and castrated + DHT supplemented Wistar rats (n = 5 in each group). DHT pellet (20 mg) was implanted subcutaneously after castration to supplement testosterone. All the animals were sacrificed 14 days after castration.

Recombinant protein production

Recombinant PATE and PATE-F proteins were prepared as described earlier [41]. DNA corresponding to the open reading frame of PATE and PATE-F full length without the signal peptide were cloned into pQE30 expression vector (Qiagen, Valencia, CA, USA). E. coli (BL-21) was transformed with pQE30 vector containing rat Pate or Pate-F cDNA according to the supplier's instructions. His tagged protein expression was induced with 1 mM isopropyl-1-thio-β-D-galactoside for 3 h at 37°C. 1% glucose was maintained in the medium to avoid baseline expression of the protein prior to induction. Bacterial cells were lysed with buffer A (100 mM NAH2PO4, 10 mM Tris-Cl, 6 M gunadium hydrochloride, pH 8.0). Bacterial lysate was then incubated with nickel-nitrilotriacetic acid-agarose (Qiagen) for 1 h to allow binding of His-tagged recombinant protein to the resin. It was then transferred to a column, washed with buffer B (100 mM NAH2PO4, 10 mM Tris-Cl, 8 M urea, pH 8.0 and the recombinant protein eluted with buffer B of varying pHs namely 6.3, 5.9 and 4.5. The His-tagged recombinant PATE proteins contained the following additional amino acid residues at the N-terminus (MRGSHHHHHHGS) due to the construction of the vector. Fractions were analyzed on 15% gradient polyacrylamide Tris-Tricine gels and stained with Coomassie blue G250. Further, the identity of the protein was confirmed by Western blotting using anti-His-tag antibody. To remove urea, fractions containing purified protein were pooled and dialyzed serially in 10 mM phosphate buffered saline (pH 7.4) containing decreasing concentration of urea to allow protein refolding.

Antibody production and immunodetection

Rat PATE and PATE-F antibodies were raised in our laboratory. Briefly, recombinant PATE or PATE-F protein was mixed with complete adjuvant and rabbits were immunized followed by booster doses 4 and 6 weeks after initial immunization. Antiserum was collected 2 weeks after the second booster dose. The specificity of antiserum obtained was confirmed by Western blotting using positive and negative controls. As a positive control, recombinant protein (PATE or PATE-F) was used. Anti serum to PATE or PATE-F recognized their respective recombinant proteins (Figure S4). In negative control experiments, antiserum to PATE was tested against PATE-F and vice-versa. No cross reactivity was observed (Figure S4). For immuno fluorescent staining, epididymides and testes were fixed in 4% paraformaldehyde and Bouin's fluid respectively and embedded in paraffin. Five micron thick sections were taken and treated with xylene and graded alcohol (70–100%). The sections were subjected to antigen retrieval in citrate buffer pH 6.0. PATE and PATE-F were detected by incubating the sections using polyclonal antibodies (1∶250 dilution) raised in rabbit followed by TRIC (for PATE) or FITC (for PATE-F) conjugated secondary antibody (1∶500 dilution) against rabbit IgG raised in goat. Sections were counter-stained with DAPI. For immunostaining of the sperm, adult rat epididymides were dissected out and the spermatozoa were air dried and fixed on glass sides using methanol. Immunofluorescence on the sperm was detected by using PATE or PATE-F antiserum and anti-rabbit secondary antibodies tagged with FITC. Counter staining was done using DAPI. Photographs were taken using a color digital imaging system attached to a Leica Photomicroscope. The magnifications were 10 and 60× for tissues and sperm respectively. Surgical procedures were conducted using the guidelines for the care and use of laboratory animals and this study was specifically approved by the Institutional Animal Ethics Committee of University of Hyderabad.

Antibacterial assay

Colony forming units (CFU) assay was employed to test the antibacterial activity as described previously [41]. E. coli XL-1 Blue (Stratagene, La Jolla, CA, USA) grown to mid-log phase (A 600 = 0.4–0.5) diluted with 10 mM sodium phosphate buffer (pH 7.4) was used in the assay. Varying concentration of PATE or PATE-F protein (10–100 µg/ml) was added to approximately 2×106 CFU/ml of bacteria and incubated at 37°C for 30–120 min. After incubation, the assay mixtures were serially diluted with 10 mM sodium phosphate buffer (pH 7.4) and 100 µl of each was spread on a Luria–Bertani agar plate and incubated at 37°C overnight to allow full colony development. The resulting colonies were hand counted and plotted as % survival. Values shown are Mean ± S.D. Statistical analyses were performed using Student's t-test available in Sigma Plot software.

In vitro and in vivo endotoxin treatments

The effect of endotoxin challenge on Pate expression was investigated in vitro and in vivo following the methodology described earlier [42], [43]. For the in vitro experiments, caput, cauda and testis from adult rats were dissected and cut into two longitudinal halves. One half of the tissue was used as control, and the other was treated with LPS. Tissues were transferred to 2 ml nutritive media (136.89 mM NaCl, 5.63 mM KCl, 1.80 mM CaCl2, 0.36 mM NaH2PO4, 14.88 mM NaHCO3 and 5.55 mM glucose pH 7.6–7.8) and cultured at 30 C with aeration. After 15 min of incubation, tissues were transferred to nutritive solution with or without LPS (1 µg/ml) and incubated for 0–9 h. During these incubations nutritive solution with or without LPS were renewed every 30 min. The tissues were collected, rinsed with PBS, frozen in liquid nitrogen and stored in −80 C until use. For the in vivo LPS challenge, adult male Wistar rats (90-days-old), maintained on a 12L∶12D lighting schedule, at 22–25°C, with food and water ad libitum, were injected intraperitoneally with LPS (1 mg/kg body weight; from E. coli 0111∶B4; Sigma, St. Louis, MO, USA) or saline (control). LPS dose and site of injection was chosen based on previous reports [43]. Rats were sacrificed at 3, 6, 9, 15 and 24 h after LPS treatment. Cauda epididymis was identified, stripped of connective tissues, frozen in liquid nitrogen, and kept at −70°C until use. Alignment of rat mRNA and chromosomal sequence. Bold upper case letters indicate exons and lower case letters indicate introns. Amino acids are indicated in bold single letters. Predicted signal peptide cleavage site is underlined and in italics. The conserved ten cysteines are indicated in blue and underlined. Numbers in parentheses indicate amino acids of the protein. (DOC) Click here for additional data file. Three dimensional structures of rat PATE and PATE-F. The ten conserved cysteines are shown. Pairs of cysteines that may take part in disulfide bonding are shown in same color. (PPT) Click here for additional data file. Manual alignment of PATE, PATE-F and Bucandin. Cysteines in same color may form disulphide bonds in PATE and PATE-F similar to that of Bucandin. (DOC) Click here for additional data file. Western blotting using positive and negative controls. PATE and PATE-F recombinant proteins were probed with the polyclonal antibodies. For PATE, PATE-F was used as a negative control and vice-versa. (TIF) Click here for additional data file.
  43 in total

1.  HE2beta and HE2gamma, new members of an epididymis-specific family of androgen-regulated proteins in the human.

Authors:  K G Hamil; P Sivashanmugam; R T Richardson; G Grossman; S M Ruben; J L Mohler; P Petrusz; M G O'Rand; F S French; S H Hall
Journal:  Endocrinology       Date:  2000-03       Impact factor: 4.736

2.  NMR structure of bucandin, a neurotoxin from the venom of the Malayan krait (Bungarus candidus).

Authors:  A M Torres; R M Kini; N Selvanayagam; P W Kuchel
Journal:  Biochem J       Date:  2001-12-15       Impact factor: 3.857

3.  Cystatin and cystatin-derived peptides have antibacterial activity against the pathogen Porphyromonas gingivalis.

Authors:  M F Blankenvoorde; W van't Hof; E Walgreen-Weterings; T J van Steenbergen; H S Brand; E C Veerman; A V Nieuw Amerongen
Journal:  Biol Chem       Date:  1998-11       Impact factor: 3.915

4.  The PATE gene is expressed in the accessory tissues of the human male genital tract and encodes a secreted sperm-associated protein.

Authors:  Angel A Soler-García; Rangan Maitra; Vasantha Kumar; Tomoko Ise; Satoshi Nagata; Richard Beers; Tapan K Bera; Ira Pastan
Journal:  Reproduction       Date:  2005-04       Impact factor: 3.906

5.  Androgen levels in the rete testis fluid during sexual development.

Authors:  M E Harris; A Bartke
Journal:  Experientia       Date:  1981-04-15

6.  Metabolism of progesterone by rat testicular homogenates. II. Changes with age.

Authors:  S N Nayfeh; S W Barefoot; B Baggett
Journal:  Endocrinology       Date:  1966-05       Impact factor: 4.736

7.  Mouse cysteine-rich secretory protein 4 (CRISP4): a member of the Crisp family exclusively expressed in the epididymis in an androgen-dependent manner.

Authors:  Jenni Jalkanen; Ilpo Huhtaniemi; Matti Poutanen
Journal:  Biol Reprod       Date:  2005-01-26       Impact factor: 4.285

8.  Biosynthesis and molecular cloning of sulfated glycoprotein 2 secreted by rat Sertoli cells.

Authors:  M W Collard; M D Griswold
Journal:  Biochemistry       Date:  1987-06-16       Impact factor: 3.162

Review 9.  Structure-function relationships in the receptor for urokinase-type plasminogen activator. Comparison to other members of the Ly-6 family and snake venom alpha-neurotoxins.

Authors:  M Ploug; V Ellis
Journal:  FEBS Lett       Date:  1994-08-01       Impact factor: 4.124

10.  Effects of seminal vesicle fluid components on sperm motility in the house mouse.

Authors:  B Peitz
Journal:  J Reprod Fertil       Date:  1988-05
View more
  5 in total

1.  Identification and expression of an uncharacterized Ly-6 gene cluster in zebrafish Danio rerio.

Authors:  Quanyang Guo; Dongrui Ji; Man Wang; Shicui Zhang; Hongyan Li
Journal:  Funct Integr Genomics       Date:  2015-06-26       Impact factor: 3.410

2.  Mechanism of antibacterial action of the alcoholic extracts of Hemidesmus indicus (L.) R. Br. ex Schult, Leucas aspera (Wild.), Plumbago zeylanica L., and Tridax procumbens (L.) R. Br. ex Schult.

Authors:  Kongari Saritha; Angireddy Rajesh; Khanapur Manjulatha; Oruganti H Setty; Suresh Yenugu
Journal:  Front Microbiol       Date:  2015-06-09       Impact factor: 5.640

3.  IL-22/STAT3-Induced Increases in SLURP1 Expression within Psoriatic Lesions Exerts Antimicrobial Effects against Staphylococcus aureus.

Authors:  Yasuhiro Moriwaki; Kiyoko Takada; Toshinori Nagasaki; Natsuki Kubo; Tomohiro Ishii; Kazuaki Kose; Taihei Kageyama; Shoutaro Tsuji; Koichiro Kawashima; Hidemi Misawa
Journal:  PLoS One       Date:  2015-10-16       Impact factor: 3.240

4.  Sperm-associated antigen 11A is expressed exclusively in the principal cells of the mouse caput epididymis in an androgen-dependent manner.

Authors:  Dwi A Pujianto; Evelyn Loanda; Puji Sari; Yurnadi H Midoen; Purnomo Soeharso
Journal:  Reprod Biol Endocrinol       Date:  2013-07-01       Impact factor: 5.211

5.  In Silico and Biochemical Characterization of Lysozyme-Like Proteins in the Rat.

Authors:  Ganapathy Narmadha; Suresh Yenugu
Journal:  PLoS One       Date:  2016-09-09       Impact factor: 3.240

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.