Literature DB >> 22470459

Rapamycin ameliorates kidney fibrosis by inhibiting the activation of mTOR signaling in interstitial macrophages and myofibroblasts.

Guochun Chen1, Huihui Chen, Chang Wang, Youming Peng, Lin Sun, Hong Liu, Fuyou Liu.   

Abstract

Interstitial fibrosis is an inevitable outcome of all kinds of progressive chronic kidney disease (CKD). Emerging data indicate that rapamycin can ameliorate kidney fibrosis by reducing the interstitial infiltrates and accumulation of extra cellular matrix (ECM). However, the cellular mechanism that regulates those changes has not been well understood yet. In this study, we revealed the persistent activation of mammalian target of rapamycin (mTOR) signaling in the interstitial macrophages and myofibroblasts, but rarely in injured proximal epithelial cells, CD4+ T cells, neutrophils, or endothelial cells, during the development of kidney fibrosis. Administration of rapamycin to unilateral ureteral obstruction (UUO) mice significantly suppressed the immunoreactivity of mTOR signaling, which decreased the inflammatory responses and ECM accumulation in the obstructed kidneys. Isolated macrophages from rapamycin-treated obstructed kidneys presented less inflammatory activity than vehicle groups. In vitro study confirmed that rapamycin significantly inhibited the fibrogenic activation of cultured fibroblasts (NIH3T3 cells), which was induced by the stimulation of TGF-β(1). Further experiment revealed that rapamycin did not directly inhibit the fibrogenesis of HK2 cells with aristolochic acid treatment. Our findings clarified that rapamycin can ameliorate kidney fibrosis by blocking the mTOR signaling in interstitial macrophages and myofibroblasts.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22470459      PMCID: PMC3314672          DOI: 10.1371/journal.pone.0033626

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Tubulointerstitial fibrosis is the final common pathway of a wide variety of chronic progressive kidney diseases. Intense studies have focused on the molecular and cellular pathogenesis of interstitial fibrosis due to the strong correlation between the degree of interstitial fibrosis and renal functional loss in CKD. Recently, studies in a wide variety of animal models confirmed that treatment of rapamycin to inhibit mTOR could markedly ameliorate the interstitial inflammation, fibrosis, and loss of renal function associated with CKD [1]–[7]. However, little has been clarified in these studies upon the cellular targets of rapamycin, regarding its protective role in kidney fibrosis. Progression of renal fibrosis can initially be characterized as induction of inflammatory response and ultimately result in widespread fibrotic changes. Multiple cell types within the interstitium, including kidney resident cells and infiltrates from circulation, directly contribute to the induction of inflammatory cascade and the fibrogenic process as a source of various proinflammatory and profibrotic molecules [8]–[10]. To date, the regulatory mechanism in these effector cells still remains obscure in kidney fibrosis, which limits the prevention and early interruption in the disease development. mTOR is a major effector of cell growth and protein synthesis via the direct functional control of its downstream targets, ribosomal protein S6 kinase (S6k) and eukaryotic initiation factor 4E-binding protein-1 (4EBP-1) [11]. Recently, novel regulation of mTOR signaling has been identified in various pathological conditions, including activation of macrophages [12], [13] and myofibroblasts [14]–[16], indicating the importance of mTOR in the regulation of kidney fibrosis. However, it is unclear which cell types have mTRO activation and where rapamycin works on during the development of kidney fibrosis. In this study, we looked into each specific cell type in the kidney to evaluate the role of rapamycin in renal fibrosis. We characterized the activation pattern of mTOR signaling in different renal cell types during kidney injury-fibrosis; we also evaluated the effect of rapamycin on the fibrogenic activity of cultured fibroblasts, HK2 cells and macrophages isolated from the fibrotic kidneys.

Materials and Methods

Ethics statement

All experiments were performed in accordance with the animal experimental guidelines issued by the Animal Care and Use Committee at Xiangya Medical School of Central South University. This study was approved by the Animal Care and Use Committee of the 2nd Xiangya Hospital (protocol approval number 2008-S 062).

Animals

C57BL/6 mice were obtained from the animal facility in the 2nd Xiangya hospital and maintained under specific pathogen-free conditions. Rapamycin (2 mg/kg·day) (LC laboratories, Woburn, USA) was administered to a subgroup of UUO mice by daily intraperitoneal injections starting one day prior to surgery and continuing until termination of the experiment.

Induction of kidney injury in mice

Female C57BL/6 mice aged 8–10 weeks weighing 20–22 g were used for induction of kidney injury. In brief, ischemia-reperfusion-injury (IRI) was induced by the retroperitoneal approach on both kidneys for 28 min at 37°C (moderate IRI). One milliliter of warm saline (37°C) was injected intraperitoneally after surgery for volume supplement. Sham operations were performed with exposure of both kidneys but without induction of ischemia. To generate the UUO mice, the left kidney and ureter were exposed via a flank incision. The ureter was ligated at two points proximal to the kidney with 6–0 silk. The wound was closed in layers. Sham animals had kidney exposed but ureter was not tied.

Kidney tissue preparation

Mice were anesthetized, sacrificed and immediatlely perfused via the left ventricle with ice-cold PBS for 2 min. Kidneys were hemi-sectioned and portions were snap frozen in liquid nitrogen for later western blot and real-time qPCR analysis. Some kidneys were fixed in 10% neutral buffered formalin at 4°C for 12 hr, processed, embedded in paraffin wax, sectioned in 4 µm and stored at room temperature for use. Some kidneys were fixed in 4% PLP fixative (4% paraformaldehyde, 75 mM L-lysine, 10 mM sodium periodate) for 4 hr at 4°C, cryoprotected in 30% sucrose and snap frozen in optimal cutting temperature (OCT, Sakura FineTek). Frozen kidneys were sectioned in 7 µm for immunofluorescent stainging.

Renal histological analysis

Kidney paraffin sections were stained with hematoxylin-eosin (HE) using standard procedures. HE-stained paraffin sections were assessed by quantitative measurement of tubular injury in 10 individual high-power fields (magnification ×400) per kidney. A percentage of the area affected was estimated for the number of necrotic cells, loss of brush border, cast formation, and tubule dilation as follows: 0, 0 to 5%; 1, 5 to 10%; 2, 11 to 25%; 3, 26 to 45%; 4, 46 to 75%, and 5, >76%. The matrix score for collagen-I deposition in the renal cortical interstitium was determined by procedures in accordance with previous reports [17]. The fields analyzed in each section were selected randomly. Ten separate, nonoverlapping microscopic fields of each kidney section were averaged to yield the score of each kidney. The scores for 3–6 separate animals for each group were then averaged.

Immunofluorescence and immunohistochemical staining

All stainings of kidney were performed on 4 µm paraffin setions or 7 µm cryosections as previously described [18]. In brief, cryosections were air-dried for 15 min, then primary antibodies against the following proteins were used: pS6K (rabbit, 1∶100, Cell signaling, USA), F4/80 (rat, 1∶100, Abcam, USA), CD3 (rabbit 1∶100, Vectorlab, USA), CD4 (mouse, 1∶100, Abcam, USA), anti-neutrophil (rat, 1∶50, Santa Cruz, USA), αSMA (mouse, 1∶200, Abcam, USA), collagen-I (rabbit, 1∶500, Abcam, USA), Kim-1 (goat, 1∶100, R&D, USA), Lotus tetragonolobus lectin (LTL, 1∶1000, Vectorlab, USA). The slides were then exposed to FITC (1∶200) or Cy3-labeled (1∶500) secondary antibodies (Jackson ImmunoResearch, USA). Sections were mounted in Vectashield medium containing DAPI (Invitrogen, USA). Representative images were taken with confocal microscopes (Leica TCS SP5). Immunohistochemical stains were performed on formalin fixed, paraffin embedded 4 µm sections. Sections were rehydrated and antigens retrieved using heated citrate. Incubation of primary antibodies was performed same as decribed above. Staining was visualized using horseradish-peroxidase coupled secondary antibodies (Vectastain elite, Vector Labs). Related isotype immunoglobulins (Jackson ImmunoResearch, USA) were used as negative controls in all stainings. All immunohistochemical analyses were repeated at least three times and representative images were presented.

Isolation of F4/80+ macrophges from obstructed kidneys

At day 1 post-obstruction, kidneys derived from either vehicle or rapamycin-treated groups were harvested, minced, and homogenized, followed by incubation with 0.1% collagenase (Worthington, USA) and 20 g/ml DNase I (Qiagen, USA) for 30 min at 37°C. Following the manufacture's instruction, mononuclear cells were obtained by density separation using Lympholyte M (Cedarlane, USA). Macrophages were labeled with biotin-conjugated rat anti-mouse F4/80, purified and enriched using MACS (Miltenyi Biotec). Total RNA was extracted from enriched F4/80 macrophages and reverse transcribed for real-time qPCR analysis of gene expression.

Cell culture and immunocytochemical staining

The NIH 3T3 fibroblast cell line and HK2 cell line from ATCC (American Type Culture Collection) were cultured in DMEM medium supplemented with 10% FBS until the cells were 80% confluent. Cells were then incubated in DMEM medium containing 0.2% FBS for 24 hr. NIH3T3 cells and HK2 cells were cultured for 24 to 48 hr in the presence of 10 ng/ml recombinant human TGF-β1 (PeproTech, NJ, USA) or 5 µg/ml aristolochic acid (AA, Sigma), with or without addition of 50 nmol rapamycin (LC lab, MA, USA) for 12 hr. Portions of NIH3T3 cells and HK2 cells were cultured in four-chamber glass and immunocytochemical staining was performed as previously described [18]. In brief, Cells were fixed and blocked before immunocytochemical staining. Cells were then incubated in primary antibodies (including αSMA and pS6K) at 4°C overnight, followed by incubation in secondary antibodies consisting of anti-rabbit-Cy3 and anti-mouse-FITC. After rinsing in PBS, slides were mounted with Vectashield mounting medium containing DAPI (Invitrogen) and visualized under a confocal microscope (Leica TCS SP5). All immunocytochemical analyses were repeated 3 or more times and related isotype immunoglobulins were used as negative controls.

Western blot analysis

Lysates of kidney or cultured cells were prepared as previously described [19]. Membranes were incubated with the following primary antibodies, respectively: rabbit antibody to p-mTOR and pS6K (Cell signaling, 1 in 1000), mouse antibody to αSMA and vimentin (Abcam, 1∶1000), rabbit antibody to collagen-I (Abcam, 1∶1000). β-actin–specific antibody (Abcam, 1∶1000) was used for loading controls on stripped membranes. Horseradish peroxidase–conjugated secondary antibodies were applied, and enhanced chemiluminescence (Thermo, IL, USA) was used to visualize bands.

Evaluation of mRNA expression by real-time qPCR

To determine the gene expression profiles of kidney tissues, real-time qPCR was performed as previously described [19], to compare designated mRNA expression of obstructive kidneys in different groups. In brief, total RNA was extracted from the kidney cortexes using an RNA isolation kit (Qiagen, RNeasy Mini Kit). To ensure samples without genomic DNA contamination, total RNA was treated with DNase (Qiagen, RNase-Free DNase Set) and cDNA was synthesized using a Synthesis Kit (Bio-rad, USA). Total cDNA (1 µl) was loaded in each well, mixed with PCR master mix (TaqMan Universal, Applied Biosystems, USA) and pre-designed primers (IDT, San Diego, USA) for TNF-α, IL-1β, CXCL-1, MCP-1, TGF-β1 CTGF and Col1α2, respectively (Listed in Table 1). The procedure for real-time qPCR included 2 min at 50°C, 15 min at 95°C, followed by 40 cycles of 15 s at 95°C, 30 s at 55°C, and 30 s at 72°C (ABI PRISM 7900 HT; Applied Biosystems). Expression (evaluated as fold change for each target gene) was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a housekeeping gene) following the well-established delta-delta method. All assays were performed in triplicate. In addition, a non-template control was included in the experiment to estimate DNA contamination of isolated RNA and reagents.
Table 1

Applied Primers for Real-time qPCR.

GenesGenBank accessionSense primers (5′ – 3′)Anti-sense primers (5′ –3′)
CXCL1NM_008176 CTGGGATTCACCTCAAGAACATC CAGGGTCAAGGCAAGCCTC
IL-1βNM_008361 GAAATGCCACCTTTTGACAGTG CTGGATGCTCTCATCAGGACA
MCP-1NM_011333 TAAAAACCTGGATCGGAACCAAA GCATTAGCTTCAGATTTACGGGT
TNF-αNM_013693 CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG
CTGFNM_010217 GACCCAACTATGATGCGAGCC TCCCACAGGTCTTAGAACAGG
TGF-β1 NM_011577 GAGCCCGAAGCGGACTACTA GTTGTTGCGGTCCACCATT
Col1α2NM_007743 AGCTTTGTGGATACGCGGAC TAGGCACGAAGTTACTGCAAG
GAPDHNM_008084 AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA

Abbreviations: CXCL1 - chemokine (C-X-C motif) ligand 1, IL-1β - interleukin 1 beta, MCP-1 - chemokine (C-C motif) ligand 2, TNF-α - tumor necrosis factor alpha, CTGF - connective tissue growth factor, TGF-β1 - transforming growth factor beta 1, Col1α2 - collagen type I alpha 2, GAPDH - glyceraldehyde-3-phosphate dehydrogenase.

Abbreviations: CXCL1 - chemokine (C-X-C motif) ligand 1, IL-1β - interleukin 1 beta, MCP-1 - chemokine (C-C motif) ligand 2, TNF-α - tumor necrosis factor alpha, CTGF - connective tissue growth factor, TGF-β1 - transforming growth factor beta 1, Col1α2 - collagen type I alpha 2, GAPDH - glyceraldehyde-3-phosphate dehydrogenase.

Data analysis

Statistical analysis was performed using the SPSS12.0 software package. Results were expressed as mean ± SE (standard error of mean). Differences among groups were tested by using One-Way ANOVA followed up with Tukey's test or t-test, as appropriate, and two-tailed p values are reported.

Results

Activation of mTOR signaling in kidney development and fibrogenesis

mTOR signaling highly activated, indicated by the expression of pS6K, in all kidney components (including renal parenchyma and interstitium) during the kidney development (Figure 1A(A′)–B(B′)), but declined to baseline in adult kidneys where its expression is mostly limited in small portion tubules (Figure 1C 6-week, Figure 1C′ 16-month). The protein amount of pS6K and p-mTOR in the kidneys derived from post-natal mice was significantly higher than adult kidneys (left column in Figure 1J), indicating mTOR signaling is essential for kidney development (i.e. cells growth) and might have some basic physiological functions (i.e. protein synthesis) in adult kidneys. The expression of pS6K can be significantly induced by either ischemic (Figure 1D and middle column in Figure 1J) or obstructive injury (Figure 1G and right column in Figure 1J) immediately. The activation of mTOR signaling returned to normal level along with the recovery of reversible kidney injury (Figure 1D–F and middle images in Figure 1J), but in irreversible obstructed nephropathy, activation of mTOR signaling kept increasing along with the progression of fibrosis (Figure 1G–I and right images in Figure 1J).
Figure 1

Assessment of immunoreactivity of mTOR signaling in normal and pathological kidneys.

Kidney tissues derived from wide type C57BL/6J mice, moderate IRI and UUO mouse models were used for analysis. Animals were treated as described in Methods. A(A′)–C(C′): Costaining of pS6K (red) and LTL (green) in renal sections from post-natal day 1(P1, A: low-power and A′: high-power), post-natal day 7 (P7, B: low-power and B′: high-power), 6-week (6w, C) and 16-week mice (16w, C′). D–F: Representative costaining images of pS6K (red) and LTL (green) in kidney sections derived from moderate IRI mice, including 48-hour (IR-48 hr, D), 7-day (IR-7d, E) and 2-week (IR-2w, F) after operation. G–I: Representative costaining images of pS6K (red) and LTL (green) in kidney sections derived from UUO models, including 1-day (U1d, G), 3-day (U3d, H) and 7-day (U7d, I) post-obstruction. J: Western blot and quantitative analysis of p-mTOR and pS6K in developing kidneys (right panel), moderate IRI model (middle panel) and UUO model (left panel). n = 5 animals in each group. *P<0.05, **P<0.01, NS, no significance. Error bars represent S.E.

Assessment of immunoreactivity of mTOR signaling in normal and pathological kidneys.

Kidney tissues derived from wide type C57BL/6J mice, moderate IRI and UUO mouse models were used for analysis. Animals were treated as described in Methods. A(A′)–C(C′): Costaining of pS6K (red) and LTL (green) in renal sections from post-natal day 1(P1, A: low-power and A′: high-power), post-natal day 7 (P7, B: low-power and B′: high-power), 6-week (6w, C) and 16-week mice (16w, C′). D–F: Representative costaining images of pS6K (red) and LTL (green) in kidney sections derived from moderate IRI mice, including 48-hour (IR-48 hr, D), 7-day (IR-7d, E) and 2-week (IR-2w, F) after operation. G–I: Representative costaining images of pS6K (red) and LTL (green) in kidney sections derived from UUO models, including 1-day (U1d, G), 3-day (U3d, H) and 7-day (U7d, I) post-obstruction. J: Western blot and quantitative analysis of p-mTOR and pS6K in developing kidneys (right panel), moderate IRI model (middle panel) and UUO model (left panel). n = 5 animals in each group. *P<0.05, **P<0.01, NS, no significance. Error bars represent S.E.

Improvement of kidney fibrosis by administration of rapamycin

Expression of pS6K (red) and specific proximal tubule marker Lotus tetragonolobus lectin (LTL, green) were determined by immunofluorescent staining. Significant activation of mTOR signaling was observed in dilated tubules and interstitium of obstructed kidneys, but little in glomeruli (Figure 2A–D). Rapamycin significantly suppressed expression of pS6K in injured kidneys (Figure 2E–H). Quantitative assessment of pS6K by western-blot further confirmed that activation of mTOR signaling was highly induced after kidney injury and reached the peak around 7-day post-obstruction, whereas administration of rapamycin resulted in a significant inhibition of pS6K expression (Figure 2I).
Figure 2

Inhibition of mTOR signaling by Rapamyicn in UUO mice.

UUO mice received daily i.p. injections of rapamycin (2 mg/kg of body weight) or vehicle respectively, starting 1 day prior to operation and continuing until termination of the experiment. A–H: Representative co-staining images of pS6K (red) and LTL (green) in UUO kideny sections with (E–H) or without (A–D) rapamycin treatment, from day 0 (A, E), day 3 (B, F), day 7(C, G) and day 14(D, H). Nuclei were labeled with DAPI (blue). Scale bar = 50 µm. I: Representative western blot (panel left) and quantitative analysis (panel right) of pS6K expression in renal sections from vehicle-treated or rapamycin-treated UUO mice. *P<0.05, **P<0.01 vs. vehicle treated groups. Error bars represent S.E.

Inhibition of mTOR signaling by Rapamyicn in UUO mice.

UUO mice received daily i.p. injections of rapamycin (2 mg/kg of body weight) or vehicle respectively, starting 1 day prior to operation and continuing until termination of the experiment. A–H: Representative co-staining images of pS6K (red) and LTL (green) in UUO kideny sections with (E–H) or without (A–D) rapamycin treatment, from day 0 (A, E), day 3 (B, F), day 7(C, G) and day 14(D, H). Nuclei were labeled with DAPI (blue). Scale bar = 50 µm. I: Representative western blot (panel left) and quantitative analysis (panel right) of pS6K expression in renal sections from vehicle-treated or rapamycin-treated UUO mice. *P<0.05, **P<0.01 vs. vehicle treated groups. Error bars represent S.E. Immunohistochemical analysis with HE staining revealed progressive tubular dilation tubules atrophy, interstitial infiltrates and matrix deposition in mouse obstructed kidneys (Figure 3A–D, A′–D′: magnification of representative areas). Rapamycin markedly reduced these pathological changes. (Figure 3E–H and E′–H′). Co-staining of collagen-I and LTL showed that administration of rapamycin resulted in less collgen-I expression in the renal interstitium (Figure 3M–P), compared with the vehicle-treated group (Figure 3I–L). Quantitative analysis of kidney injury in UUO mice further confirmed that inhibition of mTOR signaling by rapamycin remarkably improved tubular injury (Figure 3Q), interstitial infiltrates (Figure 3R) and collogen-I deposition (Figure 3S).
Figure 3

Rapamycin reduces tubulointerstitial injuries and collagen deposition in obstructed kidneys.

Animals were treated as decribed above. A(A′)–H(H′): Representative sections of vehicle (A–D:low power, inserted A′–D′: high power) or rapamycin-treated (E-H: low power, inserted E′–H′: high power) kidney with hematoxylin-eosin staining. Scale Bar: 200 µm. I–P: Representative costaining sections of obstructed kidneys with vehicle (M–P) or rapamycin (I–L) treatment, using anti-collagen I (red) and anti-LTL (green) as primary antibodies. Scale bar: 50 µm. Q–S: Quantitative assessment of tubular injuries (Q), interstitial infiltrates (R) and collogen-I deposition (S) in kidneys derived from UUO mice with or without administration of rapamycin. **P<0.01 vs. vehicle treated groups, NS no significance. n = 5 animals for each group. Error bars represent S.E.

Rapamycin reduces tubulointerstitial injuries and collagen deposition in obstructed kidneys.

Animals were treated as decribed above. A(A′)–H(H′): Representative sections of vehicle (A–D:low power, inserted A′–D′: high power) or rapamycin-treated (E-H: low power, inserted E′–H′: high power) kidney with hematoxylin-eosin staining. Scale Bar: 200 µm. I–P: Representative costaining sections of obstructed kidneys with vehicle (M–P) or rapamycin (I–L) treatment, using anti-collagen I (red) and anti-LTL (green) as primary antibodies. Scale bar: 50 µm. Q–S: Quantitative assessment of tubular injuries (Q), interstitial infiltrates (R) and collogen-I deposition (S) in kidneys derived from UUO mice with or without administration of rapamycin. **P<0.01 vs. vehicle treated groups, NS no significance. n = 5 animals for each group. Error bars represent S.E.

Rapamycin suppressed the proliferative activity of tubular and interstitial cells in obstructed kidneys

We analyzed the influence of rapamycin on the cells proliferation in fibrotic kidneys by immunohistochemical staining of anti-ki67 (brown). Only sporadic ki67-positive cells were observed in the normal kidneys of adult animals (Figure 4A–A′). However, a substantial increase of cell proliferation, including in tubules and interstium, was induced by ureter obstruction (Figure 4B–C, B′–C′), in accordance with the activation of mTOR signaling. Administration of rapamycin resulted in a significant decrease of cell proliferation, as well as tubulointerstitial involvement, in the obstructed kidneys (Figure 4D–F and D′–F′). Quantitative assessment of cell counting further confirmed that proliferation in both tubular (Figure 4G) and interstitial cells (Figure 4H) was significantly suppressed in rapamycin groups.
Figure 4

Rapamycin reduces proliferation in obstructed kidneys.

Animals were treated as decribed in Methods. A(A′)–F(F′): Representative sections from kidneys with [D(D′)–F(F′)] or without [A(A′)–C(C′)] rapamycin treatment, using anti-ki67 for immunohistochemistry. Ki67 postive cells are labeled with brown staining. High-power micrographs are presented as inserted images (A′–F′). Scale bar: 50 µm. G–H: Quantitative analysis of Ki67+ tubular cells (G) and interstitial cells(H) in representative kidney sections. n = 5 animals for each group. **P<0.01 vs. vehicle-treated groups. NS no significance. Error bars represent S.E.

Rapamycin reduces proliferation in obstructed kidneys.

Animals were treated as decribed in Methods. A(A′)–F(F′): Representative sections from kidneys with [D(D′)–F(F′)] or without [A(A′)–C(C′)] rapamycin treatment, using anti-ki67 for immunohistochemistry. Ki67 postive cells are labeled with brown staining. High-power micrographs are presented as inserted images (A′–F′). Scale bar: 50 µm. G–H: Quantitative analysis of Ki67+ tubular cells (G) and interstitial cells(H) in representative kidney sections. n = 5 animals for each group. **P<0.01 vs. vehicle-treated groups. NS no significance. Error bars represent S.E.

The regulation of rapamycin on interstitial inflammatory cells during kidney fibrosis

Quantitative analysis by immunofluorescent and immunohistochemical staining revealed the marked infiltrates of F4/80+ macrophages (Figure 5A–B) and CD3+ T lymphocytes (Figure 5C–D) in obstructed kidneys since one day post obstruction, which aggravated along with the progression of interstitial fibrosis. Significantly, administration of rapamycin reduced the interstitial infiltrates of macrophasges and T lymphocytes in obstructed kidneys (Figure 5A–D). Further examination with real-time qPCR revealed that obstructed kidneys developed progressive inflammatory responses, indicated by elevating the expression of mutiple proinflammatory chemokines (IL-1β, TNF-α, CXCL-1 and MCP-1) in a time-dependent manner post-obstruction, which was dramatically reduced by rapamycin (Figure 5E). Real-time qPCR also revealed a lower expression of pro-fibrotic cytokines, including TGF-β1 and CTGF, in rapamycin treated groups (Figure 5F).
Figure 5

Rapamycin attenuates inflammatory responses in obstructed kidneys.

A–B: Immunoflurescent staining (A) and quantitative assessment (B) of F4/80+ macrophages in kidney sections from UUO mouse models. anti-F4/80 (green) was used to label macrophages in kidney tissues, costaining with DAPI (blue). Scale bar: 20 µm. ** P<0.01 vs. vehicle treated groups. n = 5 animals in each group. C–D: Immunohistochemical staining (C) and quantitative assessment (D) of CD3+ T cells in kidney sections from UUO mice. anti-CD3 was used to label T cells in the kidneys, counterstained with hematoxylin (blue). Representative areas were magnified in the inserted images(C). Scale bar: 50 µm. *P<0.05 vs. vehicle treated groups. n = 5 animals in each group. E–F. Analysis of proinflammatory (E) and fibrotic (F) profiles of kidney tissues from UUO models, using quantitative realtime-PCR. IL-1β, TNF-α, CXCL-1 and MCP-1 were selected as pro-inflammatory chemokines for detection (E). **P<0.01, vs control group (sham operation); ##P<0.01, rapamycin vs. vehicle treated groups; §§P<0.01 vs U1d-vehicle group; ¶¶P<0.01 vs U3d-vehicle group. n = 5 animals in each group. TGF-β and CTGF were selected as fibrotic cytokines for detection (F). *P<0.05, **P<0.01, vs control group (sham operation); #P<0.05, ##P<0.01 rapamycin vs vehicle-treated group. NS no significance, n = 5 animals in each group. Error bars represent S.E.

Rapamycin attenuates inflammatory responses in obstructed kidneys.

A–B: Immunoflurescent staining (A) and quantitative assessment (B) of F4/80+ macrophages in kidney sections from UUO mouse models. anti-F4/80 (green) was used to label macrophages in kidney tissues, costaining with DAPI (blue). Scale bar: 20 µm. ** P<0.01 vs. vehicle treated groups. n = 5 animals in each group. C–D: Immunohistochemical staining (C) and quantitative assessment (D) of CD3+ T cells in kidney sections from UUO mice. anti-CD3 was used to label T cells in the kidneys, counterstained with hematoxylin (blue). Representative areas were magnified in the inserted images(C). Scale bar: 50 µm. *P<0.05 vs. vehicle treated groups. n = 5 animals in each group. E–F. Analysis of proinflammatory (E) and fibrotic (F) profiles of kidney tissues from UUO models, using quantitative realtime-PCR. IL-1β, TNF-α, CXCL-1 and MCP-1 were selected as pro-inflammatory chemokines for detection (E). **P<0.01, vs control group (sham operation); ##P<0.01, rapamycin vs. vehicle treated groups; §§P<0.01 vs U1d-vehicle group; ¶¶P<0.01 vs U3d-vehicle group. n = 5 animals in each group. TGF-β and CTGF were selected as fibrotic cytokines for detection (F). *P<0.05, **P<0.01, vs control group (sham operation); #P<0.05, ##P<0.01 rapamycin vs vehicle-treated group. NS no significance, n = 5 animals in each group. Error bars represent S.E. In UUO and IRI mouse models, large portion of infiltrated F4/80+ macrophages in interstitium highly expressed pS6K on day-1 after the initiation of kidney injury (Figure 6A–A′″ and Figure 6B–B′″, representative cells indicated by white arrows). The obstructed kidneys also featured progressive infiltrates of CD4+ T cell and neutrophils, however, little expression of pS6K was observed in either CD4+ T cells (Figure 6C–E) or neutrophils (Figure 6F) in UUO mice. Therefore, the activation pattern of mTOR signaling in kidney inflammatory cells, revealed by immunoreactivity assessment, indicated that macrophages, instead of CD4+ T cells or neutrophils, may be direct targets of rapamycin in its anti-inflammation effects.
Figure 6

Activation profiles of mTOR signaling in the interstitial inflammatory cells.

Kidney sections derived from either UUO or IRI models were analyzed by immunohistochemistry using antibodies against pS6K, F4/80, CD4 or anti-neutrophil. A–A′″ and B–B′″: Expression of pS6K (red) is immediately induced in F4/80+ macrophages (green) after kidney injury. Large portions of interstitial macrophages in obstructed kidney (A–A′″) and IRI kidney (B–B″) are co-stained with F4/80 and pS6K (indicated by arrwos). C–E: Co-staining of CD4 (green) and pS6K in obstructed kidneys. F: Costaining of anti-neutrophil and pS6K in obstructed kidneys. Scale bar: 20 µm.

Activation profiles of mTOR signaling in the interstitial inflammatory cells.

Kidney sections derived from either UUO or IRI models were analyzed by immunohistochemistry using antibodies against pS6K, F4/80, CD4 or anti-neutrophil. A–A′″ and B–B′″: Expression of pS6K (red) is immediately induced in F4/80+ macrophages (green) after kidney injury. Large portions of interstitial macrophages in obstructed kidney (A–A′″) and IRI kidney (B–B″) are co-stained with F4/80 and pS6K (indicated by arrwos). C–E: Co-staining of CD4 (green) and pS6K in obstructed kidneys. F: Costaining of anti-neutrophil and pS6K in obstructed kidneys. Scale bar: 20 µm. To further confirm whether the mTOR signaling really regulates the activity of macrophages in the initiation of kidney fibrosis, we isolated macrophages from both vehicle (Figure 7A–A′″) and rapamycin-treated (Figure 7B–B′″) kidneys on day-1 post-obstruction and characterized their mRNA profiles of inflammatory chemokines, including IL-1β, TNF-α and MCP-1. Real-time qPCR analysis revealed that macrophages from rapamycin-treated groups presented much less inflammatory activity than vehicle groups (Figure 7C).
Figure 7

Rapamycin inhibits inflammatory activity of macrophages isolated from obstructed kidneys.

A–B: Co-immunostainging images of kidney sections from day-1 post-obstruction with administration of rapamycin (A–A′″) or vehicle (B–B′″), using anti-pS6K (red), anti-F4/80 (green) and DAPI (blue) for immunofluorescent staining. Representative areas in A″ and B″ (indicated by white square) are magnified in A′″ and B′″, respectively. Scale bar: 50 µm. C. Assessment of inflammatory activity of isolated macrophages from obstructed kidney on day-1 post-operation. mRNA level of proinflammatory chemokines, including TNF-α, IL-1β and MCP-1, were determined by realtime-PCR. *P<0.05, **P<0.01, vs control group (sham operation); #P<0.05, ##P<0.01 vs vehicle-treated group. n = 5 animals in each group. Ctrl: control group, U1d-Ve: 1-day post UUO operation with administration of vehicle, U1d-Rp: 1-day post UUO operation with administration of rapamycin. Error bars represent S.E.

Rapamycin inhibits inflammatory activity of macrophages isolated from obstructed kidneys.

A–B: Co-immunostainging images of kidney sections from day-1 post-obstruction with administration of rapamycin (A–A′″) or vehicle (B–B′″), using anti-pS6K (red), anti-F4/80 (green) and DAPI (blue) for immunofluorescent staining. Representative areas in A″ and B″ (indicated by white square) are magnified in A′″ and B′″, respectively. Scale bar: 50 µm. C. Assessment of inflammatory activity of isolated macrophages from obstructed kidney on day-1 post-operation. mRNA level of proinflammatory chemokines, including TNF-α, IL-1β and MCP-1, were determined by realtime-PCR. *P<0.05, **P<0.01, vs control group (sham operation); #P<0.05, ##P<0.01 vs vehicle-treated group. n = 5 animals in each group. Ctrl: control group, U1d-Ve: 1-day post UUO operation with administration of vehicle, U1d-Rp: 1-day post UUO operation with administration of rapamycin. Error bars represent S.E.

The inhibition on the activation of myofibroblasts by rapamycin

In normal kidney, αSMA expression was only observed in arteries and arterioles (Figure 8A–A′″ indicated by arrow-head). Low expression of pS6K was found in tubules and sporadic interstitial cells but little overlapped with the αSMA (Figure 8A–A′″). However, activation of fibroblasts and mTOR signaling were markedly induced on day-1 post ureteral obstruction, indicating by de novo expression of αSMA and pS6K within the interstitium (Figure 8B–B′). Merged images showed the co-expression of αSMA and pS6K in a large portion of interstitial myofibroblasts (Figure 8B″–B′″). Representative areas (Figure 8C–C′″) were maginified to further confirm the expression of pS6K in active myofibroblasts (white arrow), but not in arterial cells (asterisk). In rapamycin treated group, the expression of αSMA and pS6K in obstructed kidneys was significantly suppressed (Figure 8D–D′″). Given the pivotal role of TGF-β1 in kidney fibrosis, we further investigated the effect of rapamycin on TGF-β1-induced myofibroblast activation. NIH3T3 cells cultured in regular condition slightly expressed αSMA and pS6K (Figure 8E–E″). Stimulation of TGF-β1 in NHI3T3 cells resulted in marked expression of αSMA and pS6K (Figure 8F–F″), which was significantly suppressed by rapamycin (Figure 8G–G″). Western blot analysis further confirmed these changes (Figure 8H–I).
Figure 8

Rapamycin suppresses activation of mTOR signaling in active myofibroblasts.

Immunofluorescent staining of kidney sections derived from UUO models on day-1 post-obstruction was performed, using anti-αSMA (green, A–D) and anti-pS6K (red, A′–D′). Images were merged (A″–D″) and co-labeled with DAPI (A′″–D′″). Representative areas in B–B′″ (white square) were magnified in C–C′″. Arrow heads (A–A′″) and asterisks (C–C′″) indicate arterioles in the kidneys Arrows indicate representative myofibroblasts expressing pS6K (C–C′″). Scale bar: 50 µm. NIH3T3 cells were cultured for 24 hours in the absence (E–E″) or presence of 20 ng/ml recombinant human TGF-β1 (F–F′″, G–G′″), with administration of vehicle (F–F′″) or rapamycin (G–G′″). The cells were stained for αSMA (green) and pS6K (red). DAPI was used to stain the nuclei. Magnification was 400×. (H–I): Representative Western blot and quantitative assessment for expression of αSMA and pS6K in NIH3T3 cells. β-actin was used in this experiment to control for equal protein loading. *P<0.05, **P<0.01 vs. control groups. #P<0.05, ##P<0.01 vs. TGF-β+vehicle groups. Error bars represent S.E.

Rapamycin suppresses activation of mTOR signaling in active myofibroblasts.

Immunofluorescent staining of kidney sections derived from UUO models on day-1 post-obstruction was performed, using anti-αSMA (green, A–D) and anti-pS6K (red, A′–D′). Images were merged (A″–D″) and co-labeled with DAPI (A′″–D′″). Representative areas in B–B′″ (white square) were magnified in C–C′″. Arrow heads (A–A′″) and asterisks (C–C′″) indicate arterioles in the kidneys Arrows indicate representative myofibroblasts expressing pS6K (C–C′″). Scale bar: 50 µm. NIH3T3 cells were cultured for 24 hours in the absence (E–E″) or presence of 20 ng/ml recombinant human TGF-β1 (F–F′″, G–G′″), with administration of vehicle (F–F′″) or rapamycin (G–G′″). The cells were stained for αSMA (green) and pS6K (red). DAPI was used to stain the nuclei. Magnification was 400×. (H–I): Representative Western blot and quantitative assessment for expression of αSMA and pS6K in NIH3T3 cells. β-actin was used in this experiment to control for equal protein loading. *P<0.05, **P<0.01 vs. control groups. #P<0.05, ##P<0.01 vs. TGF-β+vehicle groups. Error bars represent S.E. To further evaluate the effect of mTOR signaling on myofibroblasts transition, we quantify αSMA and vimentin expression in obstructed kidney using immunohistochemical staining and western blot analysis. In sham-operated kidney, a-SMA was found only in arteries and arterioles. However, along with the progression of interstitial fibrosis in obstructed kidneys, substantial accumulation of αSMA was found increasing within the interstium. The amount of αSMA deposition and renal histological changes were significantly ameliorated in rapamycin-treated kidneys (Figure 9A), indicating inhibiton of mTOR signaling markedly reduced myofibroblasts activation. Co-staining of vimentin (red) and LTL (green) further revealed the progressive accumulation of vimentin in the interstitium as a hallmark of fibrotic kidneys, which could be significantly attenuated by rapamycin (Figure 9B). Western blot of kidney lysates further confirmed that inhibition of mTOR signaling by rapamycin markedly reduced αSMA and vimentin production in UUO mice.
Figure 9

Assessment of myofibroblasts activation in obstructed nephropathy.

Animals were treated as described in Methods and Materials. A. Representative sections of vehicle or rapamycin-treated kidneys stained with anti-αSMA by immunohistochemistry. Scale bar: 100 µm. B. Representative confocal images of vehicle or rapamycin-treated kidneys costained with anti-vimentin (red) and anti-LTL(green). Scale bar: 100 µm. C–F: Representative western blot and densitometric analyses for αSMA (C–D) and vimentin (E–F) expression in UUO kidneys. β-actin was used in this experiment to control for equal protein loading. Data were presented as mean ± S.E.M. n = 5 animals in each group. *P<0.05, **P<0.01 vs. vehicle-treated groups. NS no significance. Error bars represent S.E.

Assessment of myofibroblasts activation in obstructed nephropathy.

Animals were treated as described in Methods and Materials. A. Representative sections of vehicle or rapamycin-treated kidneys stained with anti-αSMA by immunohistochemistry. Scale bar: 100 µm. B. Representative confocal images of vehicle or rapamycin-treated kidneys costained with anti-vimentin (red) and anti-LTL(green). Scale bar: 100 µm. C–F: Representative western blot and densitometric analyses for αSMA (C–D) and vimentin (E–F) expression in UUO kidneys. β-actin was used in this experiment to control for equal protein loading. Data were presented as mean ± S.E.M. n = 5 animals in each group. *P<0.05, **P<0.01 vs. vehicle-treated groups. NS no significance. Error bars represent S.E.

The effect of rapamycin on fibrogenic phenotype of tubular epithelial cells

To determine whether the tubular epithelial cells remain potential targets of rapamycin in the progression of renal fibrosis, we studied the relationship between tubular fibrogenic activity and mTOR signaling. Kidney Injury Molecule-1 (Kim-1) was markedly up-regulated in either obstructed (Figure 10A) or ischemic kidneys (Figure 10B), where it localized to the apical surface of injured proximal tubule epithelial cells. These surviving epithelial cells, indicated by Kim-1 staining, were surrounded by abundant interstitial αSMA-positive myofibroblasts (Figure 10A) and CD11b-positive macrophages (Figure 10B), which revealed profibrogenic and proinflammatory roles of active epithelial cells after kidney injury. However, few Kim-1 positive epithelial cells co-expressed pS6K, although these tubules was surrounded by pS6K-positive intersitial cells (Figure 10C), indicating the mTOR signaling may play little role in the fibrogenic pathway conducted by active epithelial cells.
Figure 10

Rapamycin has little effect on the fibrogenic phenotype of tubular epithelial cells.

HK2 cells or Animals were treated as described in Methods and Materials. A–C. Representative immunofluorescent costaining images of kidney sections derived from UUO mice or IRI mice, using anti-Kim-1 and anti-αSMA (A), anti-Kim-1 and anti-CD11b (B), anti-pS6K and anti-Kim-1 (C). Nuclei were labeled with DAPI (blue). Scale bar: 50 µm. D. HK2 cells were cultured for 48 hours in the absence or presence of aristolochic acid (AA), with or without administration of rapamycin. The cells were stained for Ki67 or pS6K. DAPI was used to stain the nuclei. E. Representative western blot and densitometric analyses for expression of CTGF, Collagen-I, and pS6K in cultured HK2 cells. β-actin was used in this experiment for equal protein loading control. Data were presented as mean ± SE. ** P<0.01, NS no significance. F. Assessment of proinflammatory and profibrogenic gene expression in culture HK2 cells. mRNA level of MCP-1, TGF-β, CTGF and Collagen-I were determined by realtime-PCR. ** P<0.01, NS no significance. Error bars represent S.E.

Rapamycin has little effect on the fibrogenic phenotype of tubular epithelial cells.

HK2 cells or Animals were treated as described in Methods and Materials. A–C. Representative immunofluorescent costaining images of kidney sections derived from UUO mice or IRI mice, using anti-Kim-1 and anti-αSMA (A), anti-Kim-1 and anti-CD11b (B), anti-pS6K and anti-Kim-1 (C). Nuclei were labeled with DAPI (blue). Scale bar: 50 µm. D. HK2 cells were cultured for 48 hours in the absence or presence of aristolochic acid (AA), with or without administration of rapamycin. The cells were stained for Ki67 or pS6K. DAPI was used to stain the nuclei. E. Representative western blot and densitometric analyses for expression of CTGF, Collagen-I, and pS6K in cultured HK2 cells. β-actin was used in this experiment for equal protein loading control. Data were presented as mean ± SE. ** P<0.01, NS no significance. F. Assessment of proinflammatory and profibrogenic gene expression in culture HK2 cells. mRNA level of MCP-1, TGF-β, CTGF and Collagen-I were determined by realtime-PCR. ** P<0.01, NS no significance. Error bars represent S.E. To further determine whether rapamycin could functionally affect the fibrogenic phenotype of epithelial cells, we examined the effect of rapamycin on the generation of profibrotic factors in cultured HK2 cells after exposure to aristotochic acid (AA). Immunocytochemistry confirmed that rapamycin markedly inhibited the proliferation and mTOR signaling in cultured HK2 cells (Figure 10D). AA treatment for 48 hr resulted in marked upregulation of CTGF and collagen-I in HK2 cells. Adminstration of rapamycin significantly inhibited pS6K expression but had little effect on the production of above fibrotic factors (Figure 10E). Real-time qPCR results confirmed that AA treatment induced the activation of fibrogenic and proinflammatory genes in HK2 cells, including TGF-β1, CTGF, Col1α2 and MCP-1. Administration of rapamycin did not improve the fibrogenic and inflammatory phenotype of HK2 cells, induced by AA treatment (Figure 10F).

Discussion

Although the inhibitory effect of rapamycin on renal fibrosis has been reported in previous studies [1], [2], little was elucidated upon its cellular targets and regulatory mechanism. This study, for the first time, clarified that which cell types have mTOR activation in renal fibrosis and where rapamycin works on to protect the kidney. Infiltration of inflammatory cells has long been established as an early and characteristic feature of renal fibrosis in virtually all situations [20]. We suggested that mTOR signaling might play an important role in the initiation and progression of kidney inflammation. To test this hypothesis, we characterized the activation profiles of mTOR signaling in different inflammatory cells types, including macrophages, CD4+ lymphocytes and neutrophils. Activation of mTOR and significant inflammatory response were induced in infiltrated macrophages post ischemic or obstructed injury, which could be significantly blocked by rapamycin (Figure 6 and Figure 7). Interestingly, little expression of pS6K was observed in either CD4+ lymphocytes or neutrophils in UUO mice, although rapamycin reduced the infiltrates of those inflammatory cells in the kidneys (Figure 5 and Figure 6). Therefore, the activation pattern of mTOR signaling in kidney inflammatory cells, revealed by immunoreactivity assessment, indicated that interstitial macrophages, instead of CD4+ T cells or neutrophils, might be direct targets of rapamycin. As multiple studies suggested that rapamycin presented a paradoxical aspect in regulating T cells immunobiology, depending on the subgroups of targeted T cell [21] and the conditions under which T cells are stimulated [22], it is difficult to conclude the role of rapamycin in regulating T cells in fibrotic kidneys based on our current observation. Furthermore, future experiments are also necessary to elucidate the role of mTOR signaling in the subgroups of macrophages, as macrophages present totally different phenotypes during kidney injury and repair progress, depending on the local inflammatory milieu [9], [23] and rapamycin might accordingly have different regulatory effects on them. The presence of activated myofibroblasts is considered as a hallmark of kidney fibrosis in CKD [10]. In our study, colocalization of pS6K and αSMA in fibrotic kidneys revealed the activation of mTOR signaling in interstitial myofibroblasts, which was also supported by the experiment of TGF-β1 induced transition of fibroblasts into myofibroblasts (Figure 8). We further confirmed that the expression of αSMA and vimentin in obstructed kidney were significantly ameliorated in rapamycin-treated kidneys (Figure 9), indicating inhibiton of mTOR signaling markedly reduced myofibroblasts activation. Taken together, our studies revealed that rapamycin could ameliorate renal fibrosis by inhibiting the mTOR signaling in activated myofibroblasts. Recently, emerging evidence indicated that tubular epithelial cells had an active role in the progression of renal fibrosis via generation of various proinflammatory and profibrotic factors, including cytokines, growth factors and matrix proteins [8], [24], [25]. To determine whether rapamycin protects the kidney from fibrosis partly by inhibiting the fibrogenic role of tubular epithelial cells, we labeled the surviving proximal tubules in both obstructed and ischemic kidneys, using anti-Kim-1, which has been widely identified as a sensitive and specific biomarker for injured proximal epithelial cells [26], [27]. After kidney injuries, significant infiltration of myofibroblast and macrophage was observed around the Kim-1 positive tubules (Figure 10 A–B), indicating surviving tubular epithelial cells recruited these effector cells and contributed to the interstitial fibrosis. However, little pS6K expression could be detected in the active tubular epithelial cells (Figure 10C), suggesting that mTOR signaling has not been activated in the fibrogenic epithelial cells. To further assess the effect of rapamycin on epithelial fibrogenesis, we established a cellular fibrotic model with HK2 cells secondary to AA exposure, which has been widely used to induce kidney interstitial fibrosis [28]–[30]. HK2 cells with AA treatment showed increased activity in pro-fibrogenesis and pro-inflammation, indicating by elevated protein and mRNA levels of TGF-β1, CTGF, Collagen-1 and MCP-1, but these levels were not lowered down by rapamycin (Figure 10E–F), providing further evidence that rapamycin does not directly block the fibrogenic activity of tubular epithelial cells during the progression of kidney interstitial fibrosis. Activation of mTOR within the kidney has been reported in different kinds of kidney diseases, including acute ischemic injury [31], polycystic kidney disease [32], [33], diabetic nephropathy [34], [35] and other causes of progressive kidney disease [2], [36]. Although the overall effects of mTOR inhibitors on glomerular hypertrophy, interstitial inflammation and fibrosis, prove to be protective in CKD, the different function that mTOR signaling acts in acute and chronic kidney injury are significant [31], [37]. In this study, we observed the different expression pattern of mTOR signaling between reversible IRI and progressive fibrotic models (Figure 1), which indicated the induction of mTOR activation after kidney injury might therefore serve a dual purpose. Firstly, it is able to activate the innate immune effector cells at the early stage of injury, such as macrophages, which thereby clear apoptotic cells and debris at a site of tissue damage. Secondly, persistent mTOR activation in these effectors at an extended stage of injury, however, might be maladaptive by promoting chronic inflammation and ultimately renal fibrosis. Therefore, the balance of mTOR signaling activation could be a key to control the outcome of kidney injuries. Our data are in accordance with the current views that tightly balanced mTOR activity is required in kidney homeostasis and the role of rapamycin in kidney diseases is context dependent [1], [38]. In conclusion, this study confirmed the interstitial macrophages and myofibroblasts as the cellular targets of rapamycin for its protection of kidney fibrosis. Suppression of mTOR signaling in active macrophages and myofibroblasts leads to amelioration of kidney inflammation and fibrosis. A better understanding of the underlying mechanisms of mTOR signaling in renal fibrosis might help to find out a way to halt the fibrotic progression.
  38 in total

Review 1.  Upstream and downstream of mTOR.

Authors:  Nissim Hay; Nahum Sonenberg
Journal:  Genes Dev       Date:  2004-08-15       Impact factor: 11.361

Review 2.  Cellular and molecular mechanisms of renal fibrosis.

Authors:  Youhua Liu
Journal:  Nat Rev Nephrol       Date:  2011-10-18       Impact factor: 28.314

Review 3.  Toward a unified theory of renal progression.

Authors:  Raymond C Harris; Eric G Neilson
Journal:  Annu Rev Med       Date:  2006       Impact factor: 13.739

4.  Kidney injury molecule-1 (KIM-1), a putative epithelial cell adhesion molecule containing a novel immunoglobulin domain, is up-regulated in renal cells after injury.

Authors:  T Ichimura; J V Bonventre; V Bailly; H Wei; C A Hession; R L Cate; M Sanicola
Journal:  J Biol Chem       Date:  1998-02-13       Impact factor: 5.157

5.  Urinary kidney injury molecule-1: a sensitive quantitative biomarker for early detection of kidney tubular injury.

Authors:  Vishal S Vaidya; Victoria Ramirez; Takaharu Ichimura; Norma A Bobadilla; Joseph V Bonventre
Journal:  Am J Physiol Renal Physiol       Date:  2005-09-20

6.  The mTOR pathway is regulated by polycystin-1, and its inhibition reverses renal cystogenesis in polycystic kidney disease.

Authors:  Jonathan M Shillingford; Noel S Murcia; Claire H Larson; Seng Hui Low; Ryan Hedgepeth; Nicole Brown; Chris A Flask; Andrew C Novick; David A Goldfarb; Albrecht Kramer-Zucker; Gerd Walz; Klaus B Piontek; Gregory G Germino; Thomas Weimbs
Journal:  Proc Natl Acad Sci U S A       Date:  2006-03-27       Impact factor: 11.205

7.  Role of TNFR1 and TNFR2 receptors in tubulointerstitial fibrosis of obstructive nephropathy.

Authors:  G Guo; J Morrissey; R McCracken; T Tolley; S Klahr
Journal:  Am J Physiol       Date:  1999-11

8.  Mammalian target of rapamycin pathway blockade slows progression of diabetic kidney disease in rats.

Authors:  Núria Lloberas; Josep M Cruzado; Marcella Franquesa; Immaculada Herrero-Fresneda; Joan Torras; Gabriela Alperovich; Inés Rama; August Vidal; Josep M Grinyó
Journal:  J Am Soc Nephrol       Date:  2006-04-05       Impact factor: 10.121

9.  Rapamycin ameliorates proteinuria-associated tubulointerstitial inflammation and fibrosis in experimental membranous nephropathy.

Authors:  Ramon G B Bonegio; Robert Fuhro; Zhiyong Wang; C Robert Valeri; Christopher Andry; David J Salant; Wilfred Lieberthal
Journal:  J Am Soc Nephrol       Date:  2005-05-25       Impact factor: 10.121

10.  Mammalian target of rapamycin positively regulates collagen type I production via a phosphatidylinositol 3-kinase-independent pathway.

Authors:  Daniel Shegogue; Maria Trojanowska
Journal:  J Biol Chem       Date:  2004-03-26       Impact factor: 5.157

View more
  50 in total

1.  Rapamycin promotes podocyte autophagy and ameliorates renal injury in diabetic mice.

Authors:  Tangli Xiao; Xu Guan; Ling Nie; Song Wang; Lei Sun; Ting He; Yunjian Huang; Jingbo Zhang; Ke Yang; Junping Wang; Jinghong Zhao
Journal:  Mol Cell Biochem       Date:  2014-05-22       Impact factor: 3.396

2.  The MEK Inhibitor Trametinib Ameliorates Kidney Fibrosis by Suppressing ERK1/2 and mTORC1 Signaling.

Authors:  Petros Andrikopoulos; Julius Kieswich; Sabrina Pacheco; Luxme Nadarajah; Steven Michael Harwood; Caroline E O'Riordan; Christoph Thiemermann; Muhammad M Yaqoob
Journal:  J Am Soc Nephrol       Date:  2018-12-10       Impact factor: 10.121

3.  Mechanistic Target of Rapamycin Complex 1 (mTORC1) and mTORC2 as Key Signaling Intermediates in Mesenchymal Cell Activation.

Authors:  Natalie M Walker; Elizabeth A Belloli; Linda Stuckey; Kevin M Chan; Jules Lin; William Lynch; Andrew Chang; Serina M Mazzoni; Diane C Fingar; Vibha N Lama
Journal:  J Biol Chem       Date:  2016-01-11       Impact factor: 5.157

Review 4.  Links between coagulation, inflammation, regeneration, and fibrosis in kidney pathology.

Authors:  Beatriz Suárez-Álvarez; Helen Liapis; Hans-Joachim Anders
Journal:  Lab Invest       Date:  2016-01-11       Impact factor: 5.662

5.  Genetic disruption of Npr1 depletes regulatory T cells and provokes high levels of proinflammatory cytokines and fibrosis in the kidneys of female mutant mice.

Authors:  Venkateswara Reddy Gogulamudi; Indra Mani; Umadevi Subramanian; Kailash N Pandey
Journal:  Am J Physiol Renal Physiol       Date:  2019-04-03

Review 6.  Molecular determinants of mesenchymal cell activation in fibroproliferative diseases.

Authors:  Loka R Penke; Marc Peters-Golden
Journal:  Cell Mol Life Sci       Date:  2019-09-28       Impact factor: 9.261

Review 7.  Macrophages in Tissue Repair, Regeneration, and Fibrosis.

Authors:  Thomas A Wynn; Kevin M Vannella
Journal:  Immunity       Date:  2016-03-15       Impact factor: 31.745

8.  Metabolic variations in normal and fibrotic human laryngotracheal-derived fibroblasts: A Warburg-like effect.

Authors:  Garret Ma; Idris Samad; Kevin Motz; Linda X Yin; Madhavi V Duvvuri; Dacheng Ding; Daryan R Namba; Jennifer H Elisseeff; Maureen R Horton; Alexander T Hillel
Journal:  Laryngoscope       Date:  2016-09-01       Impact factor: 3.325

9.  Rapamycin inhibits human laryngotracheal stenosis-derived fibroblast proliferation, metabolism, and function in vitro.

Authors:  Daryan R Namba; Garret Ma; Idris Samad; Dacheng Ding; Vinciya Pandian; Jonathan D Powell; Maureen R Horton; Alexander T Hillel
Journal:  Otolaryngol Head Neck Surg       Date:  2015-03-09       Impact factor: 3.497

10.  mTOR inhibition and BMP signaling act synergistically to reduce muscle fibrosis and improve myofiber regeneration.

Authors:  Shailesh Agarwal; David Cholok; Shawn Loder; John Li; Christopher Breuler; Michael T Chung; Hsiao Hsin Sung; Kavitha Ranganathan; Joe Habbouche; James Drake; Joshua Peterson; Caitlin Priest; Shuli Li; Yuji Mishina; Benjamin Levi
Journal:  JCI Insight       Date:  2016-12-08
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.