Literature DB >> 22439976

Relationship between quantity of IFNT estimated by IFN-stimulated gene expression in peripheral blood mononuclear cells and bovine embryonic mortality after AI or ET.

Shuichi Matsuyama1, Takatoshi Kojima, Satoru Kato, Koji Kimura.   

Abstract

BACKGROUND: Interferon tau (IFNT), which is secreted into the uterine cavity during the maternal recognition period (MRP), is a key factor for establishment of pregnancy. The present study aims to clarify the relationship between the ability of a bovine conceptus to produce IFNT during the MRP and the conceptus's ability to establish pregnancy.
METHODS: In the first experiment, IFNT (0, 500, or 1000 micrograms) was administered into the uterine horn ipsilateral to the CL 16 or 17 d after standing estrus, and mRNA levels of IFN-stimulated gene 15-kDa protein (ISG15) and Mx2 in peripheral blood mononuclear cells (PBMCs) were determined. In the second experiment, we investigated ISG15 mRNA expression in PBMCs during the MRP in cattle after either artificial insemination (AI) or embryo transfer (ET).
RESULTS: Intrauterine administration of IFNT stimulated ISG15 and Mx2 gene expressions in PBMCs in cattle, and there was a positive correlation between the expressions of peripheral markers and the quantity of IFNT administered. In pregnant and normal interestrous interval (< 25 d) cattle (nIEI cattle), expression levels of the ISG15 gene showed similar patterns after AI and ET, and ISG15 mRNA expression was increased in pregnant cattle but unchanged in nIEI cattle. In contrast, ISG15 gene expression in extended interestrous interval (greater than or equal to 25 d) cattle (eIEI cattle) differed after ET compared with AI. In eIEI cattle after ET, ISG15 gene expression increased, such that the value on day 18 was intermediate between those of pregnant and nIEI cattle. In eIEI cattle after AI, ISG15 gene expression did not increase throughout the observation period.
CONCLUSIONS: The results of the current study indicate that the quantity of conceptus-derived IFNT can be estimated by measuring ISG15 mRNA levels in PBMCs from cattle. Using this approach, we demonstrate that ISG15 gene expression during the MRP in eIEI cattle differed after ET compared with AI. In addition, the modest increase in ISG15 gene expression in eIEI cattle after ET suggests that late embryo losses were due to delayed or insufficient growth of the conceptus during the MRP in cattle.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22439976      PMCID: PMC3364858          DOI: 10.1186/1477-7827-10-21

Source DB:  PubMed          Journal:  Reprod Biol Endocrinol        ISSN: 1477-7827            Impact factor:   5.211


Background

In most mammalian species, an embryo must signal its presence to the mother to establish a successful pregnancy. The signaling molecule in ruminants is interferon tau (IFNT), which is secreted from the trophectoderm of the conceptus beginning at the blastocyst stage [1] and increases with elongation of the conceptus [2-5]. The production of IFNT peaks just before the conceptus attaches to the uterine epithelium (implantation) [6,7]; after implantation, the secretion of IFNT attenuates. IFNT interacts with its receptor on the uterine endometrium and modulates the secretion of prostaglandin F2α from the endometrium, thereby maintaining the function of the corpus luteum (CL) [8-12]. Consequently, the IFNT level during the maternal recognition period (MRP) is considered to be important for successful establishment of pregnancy in ruminants [13-15]. For many years, IFNT had been thought to be secreted exclusively within the uterus and to not enter the peripheral circulation. However, some reports have suggested that the expression of various interferon-stimulated genes is upregulated in peripheral blood cells in pregnant cattle during the MRP [16-18]. Recent studies clearly demonstrate that a portion of the IFNT secreted into the uterine cavity enters the uterine vein and directly upregulates the expression of IFN-stimulated genes in both peripheral blood cells and the CL [19,20]. This upregulation of IFN-stimulated gene expression in peripheral blood is a potential target for new methods of early diagnosis of pregnancy. For example, mRNA levels of Mx, an IFN-stimulated gene, are increased in the peripheral blood mononuclear cells (PBMCs) of pregnant ewes from 15 through 30 d after insemination [17]. In addition, gene expression levels of Mx1, Mx2, and interferon-stimulated gene 15-kDa protein (ISG15) during the MRP are greater in pregnant compared with bred, nonpregnant cows [18]. A reliable method of measuring IFN-stimulated gene expression for early pregnancy detection potentially could be applied as early as 18 d after insemination of heifers [21]. In addition to its use for early pregnancy detection, a method measuring IFN-stimulated gene expression might be effective for evaluating embryo survival [16]. Embryonic mortality is a key factor causing pregnancy loss in cattle [22-26]. In classifying pregnancy loss according to luteolysis and interestrous intervals, a return to estrus before day 24 indicates 'early embryonic loss,' that occurring between days 24 to 50 is referred to as 'late embryonic loss,' and pregnancy loss detected after day 50 is characterized as 'fetal loss' [27]. Losses of pregnancy are characterized by early embryonic death, which occurs between days 8 and 16 of gestation [22,23]. Moreover, embryonic death in the case of late embryonic loss has been suggested to occur beyond day 16 of gestation, because the lifespan of the CL is extended in this case [27]. Indeed, the expression levels of ISG15 mRNA during the MRP differ between cattle that have undergone early compared with late embryonic loss after artificial insemination (AI) [16]. Most of the studies on embryo mortality involve cattle that have undergone AI, and the incidence and manner of pregnancy loss after embryo transfer (ET) might differ from those after AI, for which failure of fertilization is included in the calculation of pregnancy loss. Therefore, we first sought to confirm the positive relationship between IFNT levels in the uterus and ISGs mRNA expression in the PBMCs of cattle. To demonstrate the relationship between production of IFNT by a bovine conceptus and embryonic mortality, we investigated ISG15 mRNA expression in PBMCs during the MRP of cattle after either AI or ET.

Methods

Animals

All cattle were fed a grass silage-based diet ad libitum. All experimental procedures involving animals were approved by the committee for the Care and Use of Experimental Animals at the National Institute of Livestock and Grassland Science.

Experiment 1: Relationship between the quantity of IFNT administered into the uterus and the expressions of ISG15 and Mx2 mRNAs in PBMCs

Six female multiparous crossbred (Japanese Black × Holstein-Friesian) beef cows weighing 610 to 730 kg were used in a randomized crossover design. Estrus was synchronized among these cows by providing each with two injections of prostaglandin F2α (0.5 mg i.m.; cloprostenol, Nihon Zenyaku Kogyo, Fukushima, Japan) separated by an interval of 14 d. Recombinant bovine IFNT (bTP-509A) produced by E. coli. [28] was diluted with PBS to a concentration of 0, 1, or 2 mg/ml; BSA (Nacalai Tesque, Kyoto, Japan) was added as needed to bring the total protein concentration of the IFNT-containing mixture to 2 mg/ml. Aliquots (500 μl each) of the IFNT solutions were enclosed in plastic semen straws for administration into the uterine horn ipsilateral to the CL 16 or 17 d after standing estrus. For determination of ISG15 and Mx2 mRNA expressions, blood samples (5 ml) were obtained at 2 h before and 0, 2, 4, 6, 8, 10, 12, 16, 20, and 24 h after administration of IFNT. Blood samples were collected through a 16-gauge jugular catheter (Unitika, Osaka, Japan) that had been implanted on the day before IFNT administration.

Experiment 2: ISG15 gene expression during the MRP after AI or ET

Dried primiparous or multiparous cattle weighing 291 to 755 kg each either underwent AI at standing estrus (d 0) or received a frozen-thawed in-vivo-derived embryo into the uterine horn ipsilateral to the CL at 7 d after standing estrus. In order to compare the production of IFNT by a bovine conceptus among the pregnancy status, cattle after AI or ET were classified into 3 groups: pregnant cattle; extended interestrous interval (≥ 25 d) cattle (eIEI cattle); and normal interestrous interval (< 25 d) cattle (nIEI cattle) [29]. In this experiment, all eIEIs cattle (AI; n = 9, ET; n = 11) were used because the incidence of late embryonic loss was very low [27,30,31]. On the other hand, pregnant (AI; n = 13, ET; n = 16) and nIEIs (AI; n = 19, ET; n = 17) cattle were selected randomly. Untreated cycling cattle (n = 15) were used as controls. Jugular blood samples were collected as described at 7, 16, 18, 21, and 25 d after standing estrus for analysis of ISG15 mRNA expression and at 7, 12, 16, 18, 21, and 25 d after standing estrus for analysis of plasma progesterone (P4) concentrations. Pregnancy was diagnosed by transrectal ultrasonography at 30 to 50 d after standing estrus.

Embryos

Embryos were collected nonsurgically from superovulated Japanese Black cattle on day 7 after standing estrus, as described previously [32]. Embryos staged at grade 1 or 2 blastocysts according to the IETS manual [33] were cryopreserved by using ethylene glycol as a cryoprotectant [34]. After being thawed, the embryos were cultured in TCM199 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% FBS (ICN Biomedicals, Aurora, OH, USA) at 38.5°C in 5% CO2, 5% O2, 90% N2. After 6 h of culture, the quality of viable embryos was reevaluated and only grade 1 or 2 embryos were used for ET.

Blood sample processing

Blood samples for the determination of plasma P4 concentrations were collected into heparin-containing tubes (Terumo, Tokyo, Japan), and plasma was separated by centrifugation at 4°C for 30 min and stored at -30°C until assayed. Blood samples for RNA extraction were collected into tubes containing potassium EDTA (Terumo). Samples were centrifuged at 4°C for 30 min, and buffy coat fractions were collected. Contaminating red blood cells were removed by hemolysis, and PBMCs were isolated. The PBMCs were resuspended in TRIzol reagent (Invitrogen) and stored at -80°C until analysis.

RNA extraction, cDNA synthesis, and quantitative real-time RT-PCR

Total RNA was extracted from PBMC samples by using TRIzol (Invitrogen) in accordance with the manufacturer's protocol. Single-stranded cDNA was synthesized from 1 μg of RNA by using SuperScript II Reverse Transcriptase (Invitrogen) with oligo-dT12-18 primer (Invitrogen) in accordance with the manufacturer's instructions. The resulting cDNA was used as a template for quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) analysis. The sequences of primers and probes for ISG15, Mx2 and GAPDH are listed in Table 1. Each reaction mixture consisted of cDNA, forward and reverse primers (200 to 500 nM each), probes (100 to 300 nM each), Brilliant II QPCR Master Mix (Agilent Technologies, Palo Alto, CA, USA), and nuclease-free water in a total reaction volume of 20 μl. Thermocycling conditions included initial sample incubation at 50°C for 2 min, then 95°C for 10 min, followed by 50 cycles of 30 sec at 95°C followed by 90 sec at 60°C. Serial dilutions of plasmid containing ISG15, Mx2 or GAPDH were used as standards. Results are reported as the n-fold difference relative to a calibrator cDNA (i.e., experiment 1: transcript of sample at 2 h before IFNT administration; experiment 2: transcript of sample on day 7 after standing estrus) after normalization of the transcript signals to the endogenous control GAPDH.
Table 1

Oligonucleotide primers and probes used for real-time RT-PCR analysis

GeneGenBank accession no.SequencePosition(nucleotide no.)
ISG15NM_174366Forward primer5' GGGACCTGACGGTGAAGATG 3'67-86
Reverse primer5' GAAAGCAGGCACATTGATCTTCT 3'160-182
TaqMan probe5' TCCTGGTGCCTCTGAGGGACTCCAT 3'103-127
Mx2NM_173941Forward primer5' AAATCACCTACCGCAACATTACG 3'772-794
Reverse primer5' GCCAAGTCCATTCCCAGCTA 3'853-872
TaqMan probe5' ATGTTCTGGGCTCTCCGA 3'833-850
GAPDHU85042Forward primer5' GGCACAGTCAAGGCAGAGAAC 3'238-258
Reverse primer5' GGATCTCGCTCCTGGAAGATG 3'291-311
TaqMan probe5' CATCAATGGAAAGGCCA 3'270-286
Oligonucleotide primers and probes used for real-time RT-PCR analysis

P4 assay

Plasma P4 concentrations were determined by using a double-antibody enzyme immunoassay as described previously [35]. Briefly, 100 μl of plasma sample was extracted twice with 2 ml diethyl ether in a glass tube. After evaporation of the diethyl ether, the residue was dissolved in 500 μl of assay buffer (0.01 M PBS, pH 7.0, containing 1% [w/v] BSA) and used for the assay. Microtiter plates were coated with anti rabbit γ globulin goat serum (50 ng/well in 0.1 M carbonate buffer, pH 9.6; Cappel, MP Biomedicals, Solon, Ohio, USA) as the priming antiserum. A rabbit antiserum raised against 11α-hydroxy-progesterone-HS-BSA (a gift from Dr. Takenouchi) was diluted to 1:800,000. Progesterone-3-CMO-HRP (Cosmo Bio, Tokyo, Japan) diluted to 1:500,000 was used as the steroid-enzyme conjugate for visualization of the signal. Assay sensitivity was 0.1 ng/ml for 100-μl plasma samples; therefore, a sample yielding a signal below this threshold was assigned a value of 0.1 ng/ml. The intra- and interassay coefficients of variation were 7.8% at 4.8 ng/ml and 2.8% at 5.0 ng/ml, respectively.

Statistical analysis

Statistically significant differences (P < 0.05) in relative ISG15 and Mx2 mRNA expression levels were determined by using one-way ANOVA for repeated measures followed by Dunnett's test. Regression analysis was used to evaluate the relationship between the levels of relative ISG15 and Mx2 mRNA expressions at 4 h after administration of IFNT and the dose (μg/kg body weight) of IFNT administered into the uterus. The estrus was decided by standing behavior or sharp decline in plasma P4 values. In addition, untreated cycling cattle were used as controls. Statistically significant differences (P < 0.05) in relative ISG15 mRNA expression and plasma P4 concentrations on days 16, 18, and 21 were determined by using one-way ANOVA followed by the Tukey HSD test within each day, and those on day 25 were determined by using Student's t test. Mean estrous cycle length in eIEI cattle were analyzed by using Student's t test.

Results

Relationship between the quantity of IFNT administered into the uterus and the ISG15 and Mx2 mRNA expression levels in PBMCs

Intrauterine administration of IFNT significantly (P < 0.05) increased ISG15 and Mx2 mRNA expressions in the PBMCs of cattle relative to pretreatment values. ISG15 (Figure 1A) and Mx2 (Figure 1C) mRNA levels began to increase at 2 h after administration of IFNT, peaked at 4 h, and subsequently decreased and returned to the basal. The ISG15 (r = 0.88, P < 0.01) and Mx2 (r = 0.83, P < 0.01) mRNA expression levels at 4 h after IFNT treatment were positively correlated with the dose of IFNT administered into the uterus (Figure 1B and 1D).
Figure 1

. ISG15 (A) and Mx2 (C) mRNA expressions (mean ± S.E.M.) in PBMCs of cattle after intrauterine administration of IFNT (arrow; 0, 500, or 1000 μg); data are presented as relative fold change from the amount at 2 h before IFNT administration. *, P < 0.05 compared with value at 2 h before IFNT administration. Regression line of ISG15 (B) and Mx2 (D) mRNA expressions at 4 h after IFNT administration and concentration of IFNT administered into the uterus.

. ISG15 (A) and Mx2 (C) mRNA expressions (mean ± S.E.M.) in PBMCs of cattle after intrauterine administration of IFNT (arrow; 0, 500, or 1000 μg); data are presented as relative fold change from the amount at 2 h before IFNT administration. *, P < 0.05 compared with value at 2 h before IFNT administration. Regression line of ISG15 (B) and Mx2 (D) mRNA expressions at 4 h after IFNT administration and concentration of IFNT administered into the uterus.

ISG15 mRNA expression during the MRP after AI or ET

Among cattle that underwent AI, the average ISG15 mRNA expression in PBMCs on days 18, 21, and 25 was significantly (P < 0.05) higher in pregnant cattle (n = 13) than in any other group on the same day (Figure 2A). ISG15 mRNA expression on days 18 and 21 after AI did not differ among eIEI (n = 9), nIEI (n = 19), and cycling control cattle (n = 15).
Figure 2

. ISG15 mRNA expression (mean ± S.E.M.) on days 16, 18, 21, and 25 after standing estrus in pregnant, extended interestrous interval (≥ 25 d, eIEI), and normal interestrous interval (< 25 d, nIEI) cattle after AI (A) or ET (B). Data are presented as relative fold change from value on day 7; comparisons were made within each day. Different letters indicate a significant (P < 0.05) difference between values.

. ISG15 mRNA expression (mean ± S.E.M.) on days 16, 18, 21, and 25 after standing estrus in pregnant, extended interestrous interval (≥ 25 d, eIEI), and normal interestrous interval (< 25 d, nIEI) cattle after AI (A) or ET (B). Data are presented as relative fold change from value on day 7; comparisons were made within each day. Different letters indicate a significant (P < 0.05) difference between values. Among cattle that underwent ET, the mean ISG15 mRNA on day 18 was significantly (P < 0.05) higher in pregnant cattle (n = 16) than in nIEI (n = 17) and cycling control cattle (n = 15) (Figure 2B). ISG15 mRNA expression on day 18 after ET in eIEI cattle (n = 11) was intermediate between the value for pregnant cattle and both of those for nIEI and cycling control cattle, although none of these differences reached significance.

Changes in plasma P4 concentrations after AI or ET

After AI or ET, plasma P4 concentration on days 7, 12, 16, and 25 did not differ between pregnant and eIEI cattle (Figure 3). On day 18 after AI, nIEI cattle had significantly lower plasma P4 concentrations than pregnant cattle, and numerically but not significantly lower concentrations than eIEI and control cattle. On day 18 after ET, plasma P4 concentrations in nIEI cattle were significantly lower than those in both pregnant and eIEI cattle. Furthermore, plasma P4 concentration on day 21 after AI or ET was significantly (P < 0.05) lower in nIEI and control cattle than in pregnant and eIEI cattle.
Figure 3

Plasma progesterone concentrations in each pregnancy status of cattle after AI or ET. Plasma progesterone concentration (mean ± S.E.M.) on days 7, 12, 16, 18, 21, and 25 after standing estrus in pregnant, extended interestrous interval (≥ 25 d, eIEI), and normal interestrous interval (< 25 d, nIEI) cattle after AI (A) or ET (B). Comparisons were made within each day. Different letters indicate a significant (P < 0.05) difference between values.

Plasma progesterone concentrations in each pregnancy status of cattle after AI or ET. Plasma progesterone concentration (mean ± S.E.M.) on days 7, 12, 16, 18, 21, and 25 after standing estrus in pregnant, extended interestrous interval (≥ 25 d, eIEI), and normal interestrous interval (< 25 d, nIEI) cattle after AI (A) or ET (B). Comparisons were made within each day. Different letters indicate a significant (P < 0.05) difference between values.

Return to estrus in eIEI cattle after AI or ET

In eIEI cattle after AI and ET, the mean length of the estrous cycle was 35.1 ± 3.8 and 39.5 ± 1.8 d, respectively (Table 2); these values did not differ significantly. The distribution of return to estrus in eIEI cattle was 25 to 29 d (44.4% of the group) for AI and 40 to 44 d (36.4%) for ET.
Table 2

Estrous cycle length in eIEI cattle after AI or ET

Estrous cycle length (d)a
Group mean ± SEM25-2930-3435-3940-4445-4950-
AI (n = 9)35.1 ± 3.844.4% (4)11.1% (1)22.2% (2)0% (0)11.1% (1)11.1% (1)
ET (n = 11)39.5 ± 1.89.1% (1)18.2% (2)27.3% (3)36.4% (4)9.1% (1)0% (0)

aValues are given as % of group (n).

Estrous cycle length in eIEI cattle after AI or ET aValues are given as % of group (n).

Discussion

Although IFNT is a key factor for the first step of establishment of pregnancy, whether the ability of a bovine embryo to produce IFNT reflects its capacity to establish pregnancy has not been clarified. Measuring the expression of IFN-stimulated genes has been suggested as a possible method for assessing embryo survival as well as for early detection of pregnancy [16]. However, the correlation between the quantity of IFNT secretion excreted into the uterus and the levels of IFN-stimulated gene expression in PBMCs had not been determined previously. Therefore, we measured the levels of ISG15 and Mx2 mRNAs in bovine PBMCs after intrauterine administration of recombinant IFNT. Intrauterine administration of IFNT stimulated ISG15 and Mx2 gene expressions in PBMCs in cattle, and there were positive correlations between the expressions of peripheral markers and the quantity of IFNT administered. In addition, the correlation coefficient between Mx2 and IFNT (r = 0.83) was slightly lower than that between ISG15 and IFNT (r = 0.88). These results suggest that the quantity of conceptus-produced IFNT could be monitored by measuring ISG15 and Mx2 mRNA expressions in PBMCs, thereby providing a powerful noninvasive tool to evaluate embryonic mortality. The present study is the first to report changes in ISG15 mRNA expression in PBMCs in cattle after ET. In pregnant and nIEI cattle, ISG15 gene expression after ET followed a similar pattern as the expression after AI. In the current study, ISG15 mRNA expression in pregnant cattle was increased during the MRP as reported previously [18,21]. In cattle, a portion of the IFNT secreted by the developing conceptus during the MRP enters into the uterine vein and directly upregulates the expression of IFN-stimulated genes in peripheral blood cells [20]. The present study revealed that the amount of IFNT administered into the uterus is positively correlated with ISG15 mRNA expression in PBMCs. In addition, some studies have demonstrated that the quantity of IFNT production parallels the degree of trophoblastic elongation in cattle [2-4] and sheep [5]. Therefore, the magnitude of increase in ISG15 mRNA expression in PBMCs likely reflects the amounts of conceptus elongation and IFNT secretion. nIEI cattle lacked any increase in ISG15 mRNA expression during the MRP. Previous investigations [22,36] indicate that fertilization rates are high (on the order of 90%) in cattle, suggesting that embryonic death is responsible for the majority of reproductive failure. Moreover, the greatest incidence of embryonic death is considered to occur between days 8 and 16 after insemination [22]. These previous findings might well explain the results of the current study, such that early embryonic loss (that is, before the MRP) would account for the observed lack of increase in ISG15 gene expression in nIEI cattle. Unlike those in pregnant and nIEI cattle, the changes in ISG15 gene expression in eIEI cattle differed depending on whether the animal underwent AI or ET. In eIEI cattle after ET, ISG15 gene expression increased somewhat, with the value on day 18 intermediate to those of pregnant and nIEI cattle. This result suggests that even if the conceptus can secrete IFNT during the MRP, pregnancy is not always established. As mentioned earlier, the ISG15 mRNA expression in PBMCs reflects not only the quantity of conceptus-produced IFNT but also the degree of conceptus growth. Therefore, it is possible that the comparatively limited increase in ISG15 gene expression in eIEI cattle results from delayed conceptus growth, as previously suggested to occur in dairy cows [16]. As another possibility, the comparatively low IFNT production in eIEI cattle suggests insufficient growth and low viability of conceptuses, which consequently die beyond the MRP. In addition, because IFNT acts on the endometrium to regulate genes important for uterine receptivity and conceptus growth [37-39], the comparatively low IFNT quantity in eIEI cattle might be insufficient to induce endometrial functions necessary for conceptus growth. Moreover, in eIEI cattle after ET, there was no correlation between ISG15 mRNA expression and plasma P4 on the same day (data not shown). In addition, plasma P4 concentrations during the MRP after ET were not different between eIEI and pregnant cattle, indicating that there was no difference on the CL function. Taken together, these findings suggest that CL regression is inhibited regardless of the quantity of IFNT. Further study is needed to clarify the mechanism of beginning of CL regression in eIEI cattle after ET. Since ISG15 responds to not only various types of IFNs but also viral infection [40,41], increase of ISG15 gene expression found in this study might attribute to viral infection. Moreover, it was reported that uterine infections in cows can extend IEIs independent of pregnancy status [42,43]. Therefore, it could not deny the possibility that the elevation of ISG15 gene expression was induced by the subclinical uterine infection in eIEI cattle after ET, although the clinical uterine infection was not detected in the present study. The effect of the subclinical uterine infection on the IEIs and ISG15 gene expression must be investigated in future. In contrast to the scenario after ET, ISG15 gene expression did not increase during the MRP of eIEI cattle after AI, and the values did not differ compared with those in nIEI and cycling control cattle. The reason for the invariable level of ISG15 gene expression is unclear, but perhaps our method for measuring ISG15 mRNA expression in PBMCs was insufficiently sensitive to detect slight increases. In addition, plasma P4 concentrations did not differ between eIEI and pregnant cattle after AI. These results suggest that CL function was maintained during the MRP in eIEI cattle after AI and that estrous cycle length was extended even though embryonic loss occurred before the MRP. Although it was not clarified how estrous cycle length was extended in eIEI cattle after AI, we speculate that embryonic death in eIEI cattle after AI occurred somewhat later than in nIEI cattle after AI. In the present study, the most frequent range of return to estrus in eIEI cattle after AI was 25 to 29 d (44.4%). This slightly extended interestrous period in many eIEI cattle after AI supports our speculation that later embryonic death in eIEI than nIEI cattle is associated with inhibition of CL regression and delay of return to estrus. Moreover, regardless of breeding method, the number of days until return to estrus in eIEI cattle was not correlated with ISG15 mRNA level during the MRP (data not shown). Accordingly, the distribution of estrous cycle length might be influenced by the stage of follicular development at the beginning of CL regression rather than by the quantity of IFNT secreted by the conceptus.

Conclusion

The results of the present study indicate that the quantity of conceptus-derived IFNT in cattle can be estimated by measuring ISG15 gene expression in PBMCs. Using this approach, we demonstrate that ISG15 gene expression during the MRP in eIEI cattle differed depending on whether cows underwent AI or ET. In addition, the slight increase in ISG15 gene expression in eIEI cattle after ET suggests that late embryonic losses were due to delayed or insufficient conceptus growth during the MRP.

Abbreviations

AI: Artificial insemination; CL: Corpus luteum; ET: Embryo transfer; IFNT: Interferon tau; ISG15: Interferon-stimulated gene 15-kDa protein; MRP: Maternal recognition period; PBMC: Peripheral blood mononuclear cell; PBS: Phosphate buffered saline; BSA: Bovine serum albumin; P4: Progesterone; FBS: Fetal bovine serum; RT-PCR: Real-time reverse transcription-polymerase chain reaction; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; eIEI cattle: Cattle with extended interestrous interval (≥ 25 d); nIEI cattle: Cattle with normal interestrous interval (< 25 d).

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

SM carried out quantitative real-time RT-PCR assays, P4 assays, AI, ET, and statistical analysis; participated in the design of the study; and drafted the manuscript. TK performed quantitative real-time RT-PCR assays and participated in the design of the study. SK carried out AI and ET and participated in the design of the study. KK performed administration of IFNT into the uterus, recovery of embryos, AI, and ET; participated in the design of the study; and helped to draft the manuscript. All authors read and approved the final manuscript.
  41 in total

1.  Use of pregnancy specific proteins and progesterone assays to monitor pregnancy and determine the timing, frequencies and sources of embryonic mortality in ruminants.

Authors:  P Humblot
Journal:  Theriogenology       Date:  2001-12-01       Impact factor: 2.740

2.  Gene induction pathways mediated by distinct IRFs during viral infection.

Authors:  T Nakaya; M Sato; N Hata; M Asagiri; H Suemori; S Noguchi; N Tanaka; T Taniguchi
Journal:  Biochem Biophys Res Commun       Date:  2001-05-25       Impact factor: 3.575

3.  Conceptus signals for establishment and maintenance of pregnancy.

Authors:  T E Spencer; R C Burghardt; G A Johnson; F W Bazer
Journal:  Anim Reprod Sci       Date:  2004-07       Impact factor: 2.145

4.  Expression of the antiviral protein Mx in peripheral blood mononuclear cells of pregnant and bred, non-pregnant ewes.

Authors:  S J Yankey; B A Hicks; K G Carnahan; A M Assiri; S J Sinor; K Kodali; J N Stellflug; J N Stellflug; T L Ott
Journal:  J Endocrinol       Date:  2001-08       Impact factor: 4.286

5.  Direct transfer of bovine embryos frozen-thawed in the presence of propylene glycol or ethylene glycol under on-farm conditions in an integrated embryo transfer program.

Authors:  O Dochi; Y Yamamoto; H Saga; N Yoshiba; N Kano; J Maeda; K Miyata; A Yamauchi; K Tominaga; Y Oda; T Nakashima; S Inohae
Journal:  Theriogenology       Date:  1998-04-01       Impact factor: 2.740

6.  Extent, pattern and factors associated with late embryonic loss in dairy cows.

Authors:  V Silke; M G Diskin; D A Kenny; M P Boland; P Dillon; J F Mee; J M Sreenan
Journal:  Anim Reprod Sci       Date:  2002-05-15       Impact factor: 2.145

7.  Relationship between maternal endocrine environment, early embryo development and inhibition of the luteolytic mechanism in cows.

Authors:  G E Mann; G E Lamming
Journal:  Reproduction       Date:  2001-01       Impact factor: 3.906

8.  Measurement of interferon-tau (IFN-tau) stimulated gene expression in blood leukocytes for pregnancy diagnosis within 18-20d after insemination in dairy cattle.

Authors:  J C Green; C S Okamura; S E Poock; M C Lucy
Journal:  Anim Reprod Sci       Date:  2010-05-20       Impact factor: 2.145

Review 9.  Mechanism of action of interferon-tau in the uterus during early pregnancy.

Authors:  T R Hansen; K J Austin; D J Perry; J K Pru; M G Teixeira; G A Johnson
Journal:  J Reprod Fertil Suppl       Date:  1999

10.  The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs.

Authors:  J E P Santos; W W Thatcher; R C Chebel; R L A Cerri; K N Galvão
Journal:  Anim Reprod Sci       Date:  2004-07       Impact factor: 2.145

View more
  13 in total

1.  Bovine endometrium responds differentially to age-matched short and long conceptuses†.

Authors:  José María Sánchez; Daniel J Mathew; Susanta K Behura; Claudia Passaro; Gilles Charpigny; Stephen T Butler; Thomas E Spencer; Pat Lonergan
Journal:  Biol Reprod       Date:  2019-07-01       Impact factor: 4.285

2.  Uterine influences on conceptus development in fertility-classified animals.

Authors:  Joao G N Moraes; Susanta K Behura; Thomas W Geary; Peter J Hansen; Holly L Neibergs; Thomas E Spencer
Journal:  Proc Natl Acad Sci U S A       Date:  2018-02-05       Impact factor: 11.205

3.  Impact of fetal vs. maternal contributions of Bos indicus and Bos taurus genetics on embryonic and fetal development1.

Authors:  Pedro L P Fontes; Nicola Oosthuizen; Francine M Ciriaco; Carla D Sanford; Luara B Canal; Ky G Pohler; Darren D Henry; Vitor R G Mercadante; Claire L Timlin; Alan D Ealy; Sally E Johnson; Nicolas DiLorenzo; G Cliff Lamb
Journal:  J Anim Sci       Date:  2019-04-03       Impact factor: 3.159

4.  Exacerbated conceptus signaling does not favor establishment of pregnancy in beef cattle.

Authors:  T Martins; M Sponchiado; O A Ojeda-Rojas; A M Gonella-Diaza; E O S Batista; B O Cardoso; C C Rocha; A C Basso; M Binelli
Journal:  J Anim Sci Biotechnol       Date:  2018-12-07

5.  Gene expression of CCL8 and CXCL10 in peripheral blood leukocytes during early pregnancy in cows.

Authors:  Ryosuke Sakumoto; Kosuke Iga; Ken-Go Hayashi; Shiori Fujii; Hiroko Kanahara; Misa Hosoe; Tadashi Furusawa
Journal:  J Anim Sci Biotechnol       Date:  2018-06-20

6.  Interferon-Tau Exerts Direct Prosurvival and Antiapoptotic Actions in Luteinized Bovine Granulosa Cells.

Authors:  Raghavendra Basavaraja; Senasige Thilina Madusanka; Jessica N Drum; Ketan Shrestha; Svetlana Farberov; Milo C Wiltbank; Roberto Sartori; Rina Meidan
Journal:  Sci Rep       Date:  2019-10-11       Impact factor: 4.379

7.  Downregulated luteolytic pathways in the transcriptome of early pregnancy bovine corpus luteum are mimicked by interferon-tau in vitro.

Authors:  Raghavendra Basavaraja; Jessica N Drum; Jackson Sapuleni; Lonice Bibi; Gilgi Friedlander; Sai Kumar; Roberto Sartori; Rina Meidan
Journal:  BMC Genomics       Date:  2021-06-16       Impact factor: 3.969

8.  Differential neutrophil gene expression in early bovine pregnancy.

Authors:  Keiichiro Kizaki; Ayumi Shichijo-Kizaki; Tadashi Furusawa; Toru Takahashi; Misa Hosoe; Kazuyoshi Hashizume
Journal:  Reprod Biol Endocrinol       Date:  2013-02-05       Impact factor: 5.211

9.  Successful nonsurgical transfer of bovine elongating conceptuses and its application to sexing.

Authors:  Koji Kimura; Shuichi Matsuyama
Journal:  J Reprod Dev       Date:  2014-03-21       Impact factor: 2.214

10.  PreImplantation factor (PIF) detection in maternal circulation in early pregnancy correlates with live birth (bovine model).

Authors:  Sivakumar Ramu; Christopher Stamatkin; Leo Timms; Marshall Ruble; Roumen G Roussev; Eytan R Barnea
Journal:  Reprod Biol Endocrinol       Date:  2013-11-15       Impact factor: 5.211

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.