Literature DB >> 22405847

Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products.

Xiaojie Cui1, Sen Lin, Gu Yuan.   

Abstract

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene.
Copyright © 2012 Elsevier B.V. All rights reserved.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22405847     DOI: 10.1016/j.ijbiomac.2012.02.029

Source DB:  PubMed          Journal:  Int J Biol Macromol        ISSN: 0141-8130            Impact factor:   6.953


  8 in total

1.  ESI mass spectrometric exploration of selective recognition of G-quadruplex in c-myb oncogene promoter using a novel flexible cyclic polyamide.

Authors:  Xiaojie Cui; Qiang Zhang; Han Chen; Jiang Zhou; Gu Yuan
Journal:  J Am Soc Mass Spectrom       Date:  2014-01-23       Impact factor: 3.109

Review 2.  Interaction of the putative anticancer alkaloid chelerythrine with nucleic acids: biophysical perspectives.

Authors:  Anirban Basu; Gopinatha Suresh Kumar
Journal:  Biophys Rev       Date:  2020-10-31

3.  Guanine polynucleotides are self-antigens for human natural autoantibodies and are significantly reduced in the human genome.

Authors:  Ittai Fattal; Noam Shental; Shifra Ben-Dor; Yair Molad; Armando Gabrielli; Elisheva Pokroy-Shapira; Shirly Oren; Avi Livneh; Pnina Langevitz; Gisele Zandman-Goddard; Ofer Sarig; Raanan Margalit; Uzi Gafter; Eytan Domany; Irun R Cohen
Journal:  Immunology       Date:  2015-09-07       Impact factor: 7.397

4.  Recognition of chelerythrine to human telomeric DNA and RNA G-quadruplexes.

Authors:  Li-Ping Bai; Masaki Hagihara; Kazuhiko Nakatani; Zhi-Hong Jiang
Journal:  Sci Rep       Date:  2014-10-24       Impact factor: 4.379

5.  LINCRNA00273 promotes cancer metastasis and its G-Quadruplex promoter can serve as a novel target to inhibit cancer invasiveness.

Authors:  Samarjit Jana; Jagannath Jana; Kartick Patra; Soma Mondal; Jyotsna Bhat; Arnab Sarkar; Pallabi Sengupta; Anindya Biswas; Meghomukta Mukherjee; Satya Prakash Tripathi; Rahul Gangwal; Joyita Hazra; Abhay T Sangamwar; Gopeswar Mukherjee; Shamee Bhattacharjee; Deba Prasad Mandal; Subhrangsu Chatterjee
Journal:  Oncotarget       Date:  2017-11-17

6.  Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

Authors:  Federica Moraca; Jussara Amato; Francesco Ortuso; Anna Artese; Bruno Pagano; Ettore Novellino; Stefano Alcaro; Michele Parrinello; Vittorio Limongelli
Journal:  Proc Natl Acad Sci U S A       Date:  2017-02-23       Impact factor: 11.205

7.  Chelerythrine down regulates expression of VEGFA, BCL2 and KRAS by arresting G-Quadruplex structures at their promoter regions.

Authors:  Jagannath Jana; Soma Mondal; Payel Bhattacharjee; Pallabi Sengupta; Tanaya Roychowdhury; Pranay Saha; Pallob Kundu; Subhrangsu Chatterjee
Journal:  Sci Rep       Date:  2017-01-19       Impact factor: 4.379

8.  Carbazole Derivatives' Binding to c-KIT G-Quadruplex DNA.

Authors:  Agata Głuszyńska; Bernard Juskowiak; Martyna Kuta-Siejkowska; Marcin Hoffmann; Shozeb Haider
Journal:  Molecules       Date:  2018-05-10       Impact factor: 4.411

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.