Literature DB >> 22272149

Development and characterization of 20 microsatellite mrkers for Chinese back sleeper, Bostrychus sinensis.

Hang-Jun Wang1, Hung-Du Lin, Li-Yan Zhang, Shao-Xiong Ding.   

Abstract

Twenty microsatellite markers were isolated and characterized from the Chinese black sleeper, Bostrychus sinensis. Loci were screened in 30 individuals from Taiwan. For each locus, the number of alleles varied from 4 to 22 with mean expected and observed heterozygosity of 0.79 and 0.66, respectively. One locus significantly deviated from Hardy-Weinberg equilibrium after Bonferroni correction and no significant linkage disequilibrium was detected. This set of microsatellites will provide a suitable tool for population genetic studies of Chinese black sleeper.

Entities:  

Keywords:  Bostrychus sinensis; microsatellites; population genetic

Mesh:

Substances:

Year:  2011        PMID: 22272149      PMCID: PMC3257146          DOI: 10.3390/ijms120x000x

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   5.923


1. Introduction

The Chinese black sleeper, Bostrychus sinensis (Lacepede 1801), is one of the most widespread species of Indo-Pacific eleotrids, manifesting on the northern Indian Ocean coast, reaching east to the Pacific, Melanesia and Polynesia, north to Japan, and south to Australia [1,2]. In China, it is distributed in the coastal area of the East China Sea, Taiwan Strait and South China Sea. Chinese black sleepers are burrowing amphibians. They live in a limited territory, spawn in their burrow, and exhibit egg-guarding behavior. These factors suggest that populations will be sensitive to local environmental conditions and have a low rate of dispersal. Therefore, Bostrychus sinensis can be a useful biological indicator of the effects of long-term historical vicariant events and short-term human activities on intertidal habitats. In order to facilitate its population genetic studies, we developed and characterized 20 polymorphic microsatellite markers from Chinese black sleeper.

2. Results and Discussion

The number of observed alleles per locus ranged from 4 to 22. The observed and expected heterozygosity values ranged from 0.200 to 0.889 and 0.186 to 0.933, respectively. One locus (S98W83) significantly deviated from Hardy-Weinberg equilibrium after Bonferroi correction (P < 0.0025) and no significant genotypic linkage disequilibrium (LD) was found between all pairs of these 20 loci after Bonferroni correction (P > 0.0025). The levels of polymorphism uncovered at these loci suggest that they should be useful for population genetics as well as phylogeographic studies.

3. Experimental Section

3.1. Isolation of Microsatellite Markers

Microsatellites from B.sinensis were isolated using a modified enrichment technique described by Ding [3]. Genomic DNA was extracted from the muscle tissue using a standard traditional phenol-chloroform procedure [4] and digested with Sau3AI at 37 °C overnight. Fragments from 500–2000 bp were excised from agarose gels using a QIAqucik Gel Extraction Kit (QIAGEN) and ligated to two oligo adapters (Oligo A 5′-GATCGTCGACGGTACCGAATTCT-3′ and Oligo B 5′-GTCAAGAATTCGGTACCGTCGAC-3′) to facilitate amplification by PCR. The amplified genomic fragments were subsequently hybridized with the 5′-biotinylated oligo probes ATA(CA)22C and fragments containing potential repeat motifs were captured with steptavidin-coated magnetic beads (Dynabeads® M-280, Invitrogen). To increase the amount of potential repeat motifs, a “recovery” PCR was performed using oligo B as the PCR primer. The PCR products were then purified and ligated into PMD19-T vector (TAKARA) and transformed into DH5α competent cells. Cells were then plated onto LB agar, X-gal and ampicillin and incubated overnight at 37 °C. The positive clones were identified by PCR with vector-specific primers. After being identified, 196 positive clones were randomly selected for sequencing using ABI3730XL sequencer (Applied Biosystems). Chromatograms were assembled and edited using SEQUENCHER 4.9 (Gene Codes Corporation), and 70 primers were designed for each unique amplicon containing a target microsatellite repeat. Initially, eight samples from different localities were used to test amplification of loci and evaluate polymorphic content. The PCR amplification was performed in 15 μL volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 0.2 mM each dNTPs, 0.4 μM each primer, 1 U Taq polymerase (TAKARA) and 30 ng genomic DNA. After denaturation for 5 min at 94 °C, followed by amplication for 30 cycles (94 °C for 30 s, annealing temperature for each pair of primers (Table 1) for 30 s, 72 °C for 30 s) and a final step at 72 °C for 5 min. PCR products were mixed with the GS500LIZ size standard (Applied Biosystems) and formamide and run on an ABI3130xl DNA Analyzer. Fragment analysis and genotyping were performed using Genemapper version 4.0 (Applied Biosystems). Out of the 70 primer pairs tested, 20 pairs were successfully amplified by PCR and further characterized using additional samples at Chiku Lagoon (23°55′05″ N-120°02′57″ E) from Taiwan (n = 30).
Table 1

Details for 20 polymorphic microsatellite loci developed for Bostrychus sinensis.

Locus Genbank no.Repeat motifPrimer sequence(5′-3′)Ta (°C)Size range (bp)NaHo/HeP-value

BSD026(CA)61F: CATAAAAGACCCATTGTAACTGCT58256–28080.865/0.8250.0505
JN806116R: CTGTAGCCCTCAGGAGCACATA
BSD121(AC)19F: CGCACTGTCATCATAGCACTC58131–17580.444/0.7600.0060
JN806117R: CCACCTGACAATGATTTAGTT
BSD137(TG)23F: CTGACCTGGACTTCCCCTGG58202–330220.879/0.9331.0000
JN806118R: CTGGGACAGGAGATGAGTTTT
BSB006(TG)6C(GT)13F: TATTCTGTAATTACTGATATGTGCA60172–22290.742/0.8430.2209
JN806119R: TACACAAGACCAAAAAGGTTAGGAA
BSW045(CT)6…(AC)70F: ACTTTTTTCTCAATTTGGTTTCTAA52128–220140.833/0.8670.9975
JN806120R: TGTGCTCAGGGGTACCGGGA
BSW068(AC)16F: CTACAACAGCATCAGCCAACC58113–13370.684/0.7660.3483
JN806121R: ACTCCCAAACACTGTCCAAGAAC
BSSD14(TG)43F: ATTTAGCGAGGCTTTATGTT55200–244110.567/0.7540.5198
JN806122R: GGCTGGCTTCCATCTTTTCT
BSSD21(TG)38F: GATCCATTCTTAAAACACTCGTTAT55267–31390.774/0.8330.6818
JN806123R: CAGGAGCAGTATCCAGACAAAA
BSSW83(TG)16F: CCAGCAGCACCTGACACTCCAT58144–15680.452/0.8080.0000 *
JN806124R: TCCAGTGTTTGAAACTCCTGCC
BSE020(GT)25F: GATTTTCAGAGCAGCAGCGTTGGC66239–339100.769/0.8240.9217
JN806125R: CCACAAACGGAGCGTCCCAAATCT
BSSW87(GT)35F: CGCACAGTTGACGCTTCCTTTA64314–388100.680/0.8600.7399
JN806126R: GCCTCCCTGTCAGCCTTCACT
BSSW89(GT)33F: TTGTAGCATTCCTTCTGCCTGT52182–246100.583/0.8840.1589
JN806127R: CTCACTCCATCGGAATGTGTCTA
BSD106(CA)20T(AC)9F: GAGATGAGCAACAGGTGAGTC56338–388100.667/0.8420.5932
JN806128R: CTGGCAGAAGAGGATTGATGG
BSD045(GT)35F: AAATGGATGTGTGAGAATGTGAGGCA62258–384100.467/0.7200.4404
JN806129R: TGTGAACTCGAATGTGGGAGGTACT
BSW115(GT)37C(TG)17F: TGTGATGTGTGTTTTGGGTGGTTA64437–54170.708/0.7640.8613
JN806130R: TGTGTCCTCTGAAGTACCTGAAGC
BSW053(AC)5… (CA)7… (AC)50F: TGCCCCCCAGATACCGACATTA66308–394170.889/0.9120.9997
JN806131R: CGAGAGGTGAGCCAGGTTCAGGACT
BSD125(CA)6CGCACG(CA)35F: CGCTTCAGTTCTGTGGAGGTA56137–18590.714/0.8270.9570
JN806132R: CTGTCTGCCAAAGTTCCTGTTA
BSC001(GT)48F: CTTGTTATGTCAAACCGTAGCCTTA56341–401150.615/0.9090.4762
JN806133R: CCCTATCGTCCCCTGTAGACCG
BSE008(TG)19F: GCTGCTCATAAACAATCACTTC58138–15460.656/0.7340.7305
JN806134R:GTTGTCTGTAATCAGTGGCTCTA
BSC002(ACT)18F: ATCAGCATCACAATGACCTGGGAG55247–27140.200/0.1860.9926
JN806135R: CTTGGTGGAACTACAGACTTTTACA

Ta Annealing temperature (°C), Na Number of alleles, Ho/He Observed heterozygosity and Expected heterozygosity, P-value, P-values for exact tests for Hardy-Weinberg equilibrium(HWE),

Show significant deviation from HWE after Bonferroni correction (P < 0.0025)

3.2. Data Analysis

The number of alleles, observed and expected heterozygosities, P value of Hardy-Weinberg and linkage disequilibria were estimated by using POPGENE [5].

4. Conclusions

In the present study, we describe 20 polymorphic microsatellite loci shown as the first set of microsatellite markers designed specifically for Bostrychus sinensis. These loci would be useful in providing an effective tool for investigating genetic variation and population structure in B. sinensis. Microsatellites are an excellent choice of genetic marker for genome mapping due to their hyper-variability and abundance throughout most vertebrate genomes. In our results, there are some strong heterozygosities for microsatellite loci, like BSD137/BSW045/BSW053/BSC001, which are suitable for identifying genetic mapping in B.sinensis. These markers will prove helpful in the management of fisheries and in the design of conservation strategies.
  1 in total

1.  Characterization of eight polymorphic microsatellite loci for the giant grouper (Epinephelus lanceolatus Bloch).

Authors:  Hua-Song Zeng; Shao-Xiong Ding; Jun Wang; Yong-Quan Su
Journal:  Mol Ecol Resour       Date:  2008-07       Impact factor: 7.090

  1 in total
  4 in total

1.  Cloning and olfactory expression of progestin receptors in the Chinese black sleeper Bostrichthys sinensis.

Authors:  Yu Ting Zhang; Dong Teng Liu; Yong Zhu; Shi Xi Chen; Wan Shu Hong
Journal:  Gen Comp Endocrinol       Date:  2016-03-24       Impact factor: 2.822

2.  Characterization of hybridization within a secondary contact region of the inshore fish, Bostrychus sinensis, in the East China Sea.

Authors:  Shaoxiong Ding; Mrinal Mishra; Haohao Wu; Shuang Liang; Michael M Miyamoto
Journal:  Heredity (Edinb)       Date:  2017-11-10       Impact factor: 3.821

3.  Isolation and characterization of new 24 microsatellite DNA markers for golden cuttlefish (Sepia esculenta).

Authors:  Yanjiao Yuan; Shufang Liu; Cuicui Bai; Hongbo Liu; Zhimeng Zhuang
Journal:  Int J Mol Sci       Date:  2012-01-20       Impact factor: 6.208

4.  Molecular characterization of severin from Clonorchis sinensis excretory/secretory products and its potential anti-apoptotic role in hepatocarcinoma PLC cells.

Authors:  Xueqing Chen; Shan Li; Lei He; Xiaoyun Wang; Pei Liang; Wenjun Chen; Meng Bian; Mengyu Ren; Jinsi Lin; Chi Liang; Jin Xu; Zhongdao Wu; Xuerong Li; Yan Huang; Xinbing Yu
Journal:  PLoS Negl Trop Dis       Date:  2013-12-19
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.