Literature DB >> 22208456

PTPN22 polymorphisms may indicate a role for this gene in atopic dermatitis in West Highland white terriers.

Joana Barros Roque1, Caroline A O'Leary, Myat Kyaw-Tanner, David L Duffy, Puya Gharahkhani, Linda Vogelnest, Kenneth Mason, Michael Shipstone.   

Abstract

BACKGROUND: Canine atopic dermatitis is an allergic inflammatory skin disease common in West Highland white terriers. A genome-wide association study for atopic dermatitis in a population of West Highland white terriers identified a 1.3 Mb area of association on CFA17 containing canine protein tyrosine phosphatase non-receptor type 22 (lymphoid) PTPN22. This gene is a potential candidate gene for canine atopic dermatitis as it encodes a lymphoid-specific signalling mediator that regulates T-cell and possibly B-cell activity.
FINDINGS: Sequencing of PTPN22 in three atopic and three non-atopic West Highland white terriers identified 18 polymorphisms, including five genetic variants with a bioinformatically predicted functional effect. An intronic polymorphic repeat sequence variant was excluded as the cause of the genome-wide association study peak signal, by large-scale genotyping in 72 West Highland white terriers (gene-dropping simulation method, P = 0.01).
CONCLUSIONS: This study identified 18 genetic variants in PTPN22 that might be associated with atopic dermatitis in West Highland white terriers. This preliminary data may direct further study on the role of PTPN22 in this disease. Large scale genotyping and complementary genomic and proteomic assays would be required to assess this possibility.

Entities:  

Year:  2011        PMID: 22208456      PMCID: PMC3271996          DOI: 10.1186/1756-0500-4-571

Source DB:  PubMed          Journal:  BMC Res Notes        ISSN: 1756-0500


Findings

Canine atopic dermatitis (AD) is an allergic inflammatory skin disease that is common in West Highland white terriers (WHWTs) [1]. Following a genome-wide association (GWAS) in a group of related WHWTs, we found a 1.3 Mb area on CFA 17 which was significantly associated with the disease [2]. Based on its biological functions, expression patterns and proximity to this area of association, PTPN22 was selected as a candidate gene for AD in this population. This gene encodes a lymphoid tyrosine phosphatase (PTPN22), a signalling mediator that regulates generic and specialised immune functions in mammals [3]. Activation of T and B lymphocytes is a key event in the pathogenesis of atopic disease [4], and the disruption of these pathways could cause hyper-reactive pathogenic T-cell responses, as well as affect B-cell selection, maturation and function [5,6]. In humans and dogs, genetic variants in the gene PTPN22 have been associated with auto-immune diseases [7-9]. In humans, these include psoriasis, a chronic immune-mediated inflammatory skin disease that shares susceptibility loci with human AD [10,11]. To date, no association has been found between PTPN22 variants and atopic disease in humans [12]. The University of Queensland Animal and Human Ethics Committees, and the University of Sydney Animal Ethics Committee approved this study. Written consent was obtained from all participating dog owners. Criteria used to classify dogs in the present study are described elsewhere [1]. Fourteen set of primers were designed with primer3 [13], to sequence a total of 12.6 Kb of PTPN22 in 14 PCR products (Table 1). Amplification reactions used the HotStar HiFidelity PCR Kit (QIAGEN Pty Ltd, Doncaster, Vic, Australia) and 0.5 μM (PCR products 5 and 12), 1.5 μM (6 and 14) or 1 μM (remaining PCR products) of primers; at 55°C (PCR product 8), 57°C (3 and 14), 58°C (7, 10 and 13), 64°C (5) or 60°C (remaining products) annealing temperatures. PCR products were purified with MinElute PCR Purification Kit (QIAGEN Pty Ltd, Doncaster, Vic, Australia), and bi-directionally sequenced at the Australian Equine Genetics Research Centre using 0.5 μM (PCR product 3, 4, 5, 12, 14) or 1 μM (remaining PCR products) of forward and reverse amplification primers and 0.5 μM of internal sequencing primers (Table 1), and BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). Primers were supplied by GeneWorks (Hindmarsh, SA, Australia). Sequencing protocol was as recommended by the manufacturer, except annealing temperatures for PCR products 3, 9 and 11 were 50°C and 60°C for PCR products 4 and 5.
Table 1

Primer sequences used to amplify and sequence 12.6 Kb of canine PTPN22 in three atopic and three non-atopic WHWTs

PCR productForward amplification primerReverse amplification primerInternal forward sequencing primerInternal reverse sequencing primerPredicted gene regionProduct size
1CCTCATCAGGTGCTCTTCGTGGTTTTGCCTCTCTCCCTTCTGAAGTGGAAGAGTCTCAGAGCAGAAAAGGCAGAAGGCCAGT5'UTR, exon 11041

2GGCTCTGTCCTGAATTGGAGTCTGCCCTTACCAGGACACT--Exons 2,3858

3CCAAATAAGAGGTCGGGGTACTACTGGGAAAATGGGCAAAAGAAAAGGGAAGGAAGGACATCTGTCCTTCCTTCCCTTTTCExons 4,5863

4ACCACAGTTGACCTTGGATAAAGATGAAGGCACATCATGGTC-ACATCAAAGGTCCCCTACTCCExons 6,71182

5CCACTTGAACTGGTGAAGCAACCAGTCCTTCCACAACCAG-GGATGGAACCCCATATTGAAExons 81172

6TGCTCTGGGAAGTAGGGATGCAAGGCAAGGGACATAGGAAAATCCACCACAACCAAACCTAGCCCGTATTTCCAACTTCCExons 9,101267

7CCGAAATGAGGTAGGCAAACGCCCTGTCACTCACCCTTAT--Exons 11483

8TGGAAACTCACCTCTTTTGTGATTCTTTGAGAAGGAAAAGGAAGAACAGAGTGGGAGACAAAAGCACCAGCTCCTTGGTGTCTCTCExons 12,131296

9GAAGCAGCAGAAAACCTCCTAACCCCACATCCTCTAGCACAGATCCCCATTTGCATTGTTCTGGCCCAATTCTTAGGAGTGTExons 14,15889

10GGGTAAAGGATGCGTTTTCATGGGAGCTATTATGGGAACC--Exons 16332

11TGAGGCTCCAGTTATGGTTCACAGTCTTGTTCTCAATCTGCTTCAAGTGGGACCTAAATGGAAAAGCCTTTTCCATTTAGGTCCCACTExons 17,18747

12GGATGGGAAAAAGTAGCAAGGTTCTGATACAAAGAGCCATAGCA--Exon 19410

13TTCCCTTTAGTGTTGGGCTTTTTGGCTTTGGCTAGTCACATT--Exon 2092

14GGCTGAATTACCAAAGGTTGTTTCACAAATCCATCGTCAGGTCGCAAAATCTGACTTGTGGGGGAGATGTGCAAGGAATTTExon 21, 3'UTR550
Primer sequences used to amplify and sequence 12.6 Kb of canine PTPN22 in three atopic and three non-atopic WHWTs Sequence data were analyzed with ChromasPro v1.5 (Technylisium, Tewantin, Qld, Australia) and compared with the 1.5× poodle (version 1) and the boxer 7.6× whole-genome sequences (CanFam2.0). Among 18 variants identified [14], five variants showed a medium to high disease-associated risk as predicted by FASTSNP [15] and Mutation Taster [16]; three single-nucleotide polymorphisms (SNPs) in a predicted regulatory region of the gene, one synonymous SNP, and a variable sequence repeat in a predicted splice site (Table 2). These variants formed five different haplotypes (Table 3). There were no recombinant events within this 12.6 Kb interval.
Table 2

PTPN22 sequence variants identified by sequencing genomic DNA from three atopic and three non-atopic WHWTs.

Sequence variant identityPosition on CFA17 (bp)a,bPredicted location in geneNucleotide in reference databasebSequence of variantReference SNP identityPredicted functional effectcVariant risk score cAtopic dogsNon-atopic dogsCross-species conservation of variant nucleotide sequenceb,d
Dog 1Dog 2Dog 3Dog 4Dog 5Dog 6

154759173UTRCTrs22597162Transcription regulatory (score 86.5)1-3C/CC/TC/TC/CC/CC/CConserved in 10/10

254759006UTRAdelNew variant (dbSNP ss 315790492)Transcription regulatory (score 87.7)1-3del/deldel/Adel/AT/Adel/AA/AConserved in 9/10

354742593IntronicAGrs22597162NA0-2G/GG/AG/AG/GG/GG/GNot conserved

454742027IntronicATrs22559551NA0-2T/TT/AT/AA/AT/AA/AConserved in 6/10

554739568IntronicTCrs22559538NANo riskT/TC/TC/TC/CC/TC/CNot conserved

654739315IntronicAGNew variant (dbSNP ss 315790493)NA0-2G/GG/GG/GA/AA/GA/ANot conserved

754738923IntronicGdelNew variant (dbSNP ss 15790494)NANo riskdel/deldel/deldel/deldel/deldel/deldel/delNA

854738927Intronic-ANew variant (dbSNP ss 315790495)NANo riskA/AA/AA/AA/AA/AA/ANA

954734456IntronicTCrs22559532NA0-2C/CC/TC/TC/CC/CC/CNot conserved

1054734415IntronicAGrs22559522NANo riskA/AA/GA/GG/GA/GG/GConserved in 10/10

1154717953ExonicGANew variant (dbSNP ss 315790496)Synonymous Splicing regulatory (score 85.4)1-4G/GG/GG/GA/AA/AA/AConserved in 7/10

1254715779IntronicTCrs22578128NA0-2C/CC/TC/TT/TC/TT/TConserved in 2/10

1354709793Intronic (spice site)17-T repeat (wild)22-T repeat (variant)New variant (dbSNP ss 315790497)Alternative splicing regulatory (score 3.39)3-4variant/variantvariant/wildvariant/wildwild/wildvariant/wildwild/wildConserved in 10/10

1454699432UTRCTNew variant (dbSNP ss 315790498)NA0-2C/CC/CC/CT/TT/TT/TNot conserved

1554698793UTRGTNew variant (dbSNP ss 315790499)NA1-3T/TT/TT/TT/TT/TT/TNA

1654698788UTRCTNew variant (dbSNP ss 315790500)Transcription regulatory (score 85.4)1-3T/TT/TT/TC/CC/CC/CConserved in 7/10

1754698729UTRTCNew variant (dbSNP ss 315790501)NA1-3C/CC/CC/CC/CC/CC/CNA

1854698473UTRGTNew variant (dbSNP ss 315790502)NA0T/TT/TT/TG/GG/TG/GConserved in 9/10

Sequence variants with a predicted medium to high disease-associated functional effect, with strongly conserved sequence across 10 mammals (dog, human, pig, horse, mouse, rat, cattle, chimpanzee, gorilla and orangutan) and differential distribution between atopic and non-atopic dogs are underlined (Sequence variant identities 1, 2, 11, 13 and 16)

areverse strand; bbased on the 1.5× poodle genome (version 1) and the boxer 7.6× whole-genome sequences (CanFam2.0), accessed in March 2010 from http://www.ncbi.nlm.nih.gov and http://genome.ucsc.edu; cas predicted by FASTSNP [5]; disease-risk possibilities are 0 (no potential functional risk), 1 (very low risk), 2 (low risk), 3 (medium), 4 (high risk) and 5 (very high risk); FASTSNP provides a "risk score" for each SNP based on its putative biological function; danalyzed following genomic alignment of flanking regions containing the genetic variants in 10 possible species (dog, human, pig, horse, mouse, rat, cattle, chimpanzee, gorilla and orangutan); UTR: untranslated region (DNA); NA: not accessed; del: nucleotide deletion

Table 3

Haplotypes constructed using 18 genetic variants of PTPN22

HaplotypeaNumber of chromosomes

Atopic dogsNon-atopic dogs
AC-del-G-T-T-T-del-A-C-A-C-C-variantb-C-T-T-C-T4/60/6

BT-A-A-C-C-G-del-A-T-G-C-T-wildc-C-T-T-C-T2/60/6

CC-A-G-C-C-A-del-A-C-G-T-T-wildc-T-T-C-C-T0/64/6

DC-A-G-C-C-A-del-A-C-G-T-C-wildc-T-T-C-C-G0/61/6

EC-del-G-T-T-G-del-A-C-A-C-T-variantc-T-T-C-C-T0/61/6

amaximum-likelihood (Log likelihood = - 108.87) haplotype assignment for the dogs as predicted by Superlink [7]; b22-T repeat allele; c17-T repeat allele; del: nucleotide deletion

PTPN22 sequence variants identified by sequencing genomic DNA from three atopic and three non-atopic WHWTs. Sequence variants with a predicted medium to high disease-associated functional effect, with strongly conserved sequence across 10 mammals (dog, human, pig, horse, mouse, rat, cattle, chimpanzee, gorilla and orangutan) and differential distribution between atopic and non-atopic dogs are underlined (Sequence variant identities 1, 2, 11, 13 and 16) areverse strand; bbased on the 1.5× poodle genome (version 1) and the boxer 7.6× whole-genome sequences (CanFam2.0), accessed in March 2010 from http://www.ncbi.nlm.nih.gov and http://genome.ucsc.edu; cas predicted by FASTSNP [5]; disease-risk possibilities are 0 (no potential functional risk), 1 (very low risk), 2 (low risk), 3 (medium), 4 (high risk) and 5 (very high risk); FASTSNP provides a "risk score" for each SNP based on its putative biological function; danalyzed following genomic alignment of flanking regions containing the genetic variants in 10 possible species (dog, human, pig, horse, mouse, rat, cattle, chimpanzee, gorilla and orangutan); UTR: untranslated region (DNA); NA: not accessed; del: nucleotide deletion Haplotypes constructed using 18 genetic variants of PTPN22 amaximum-likelihood (Log likelihood = - 108.87) haplotype assignment for the dogs as predicted by Superlink [7]; b22-T repeat allele; c17-T repeat allele; del: nucleotide deletion Variant sequence repeat c.2137-20 T(17_22) (Figure 1) has not been previously reported in dogs or other species and was bioinformatically predicted to have indirect structural effects on PTPN22. Comparable intronic repeat variations might interfere with normal gene expression [17-19] and have been associated with alternative splicing and disease in humans [20-23]. Thus, fluorescently labelled, amplified-fragment length genotyping of this variant was performed in 72 WHWTs, including 54 dogs from the GWAS. Primers and PCR conditions for amplification of PCR product 11 were used. Genotyping was performed on a 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and analyzed using Genemapper (Applied Biosystems, Foster City, CA, USA). SIB-PAIR [24] showed no significant evidence for allelic association between this variant and the trait (gene-dropping simulation method, P = 0.01). Large scale genotyping and complementary genomic and proteomic assays would be required to assess any potential effect of the remaining genetic variants in PTPN22.
Figure 1

Relative location of the variant sequence repeat c.2137-20 T(17_22) in canine . Exons in the gene are marked in yellow, variants annotated in web-based databases are in green and the new intronic variant identified by sequencing in three atopic and three non-atopic WHWTs is highlighted in pink. Line numbering is relative to coordinate system.

Relative location of the variant sequence repeat c.2137-20 T(17_22) in canine . Exons in the gene are marked in yellow, variants annotated in web-based databases are in green and the new intronic variant identified by sequencing in three atopic and three non-atopic WHWTs is highlighted in pink. Line numbering is relative to coordinate system.

Availability of supporting data

The data set supporting the results of this article is available in the National Center for Biotechnology Information Reference Assembly dbSNP repository, http://www.ncbi.nlm.nih.gov/SNP/snp_viewTable.cgi?handle=O_LEARY_ATOPY.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

JBR was responsible for all experimental procedures, analysis and interpretation of data, manuscript writing and editing; CAO conceived and coordinated the study, contributed to the experimental design and to manuscript drafting and editing; MKT contributed to manuscript editing; DLD contributed to the experimental design, statistical analyses and manuscript editing; PG contributed to experimental procedures and analysis of data; LV, KM and MS were responsible for the diagnosis and recruitment of dogs. All authors contributed to the critical revision and approved the final manuscript.
  21 in total

Review 1.  The ACVD task force on canine atopic dermatitis (V): biology and role of inflammatory cells in cutaneous allergic reactions.

Authors:  P B Hill; T Olivry
Journal:  Vet Immunol Immunopathol       Date:  2001-09-20       Impact factor: 2.046

2.  Optimizing exact genetic linkage computations.

Authors:  Ma'ayan Fishelson; Dan Geiger
Journal:  J Comput Biol       Date:  2004       Impact factor: 1.479

3.  MutationTaster evaluates disease-causing potential of sequence alterations.

Authors:  Jana Marie Schwarz; Christian Rödelsperger; Markus Schuelke; Dominik Seelow
Journal:  Nat Methods       Date:  2010-08       Impact factor: 28.547

4.  The tryptophan 620 allele of the lymphoid tyrosine phosphatase (PTPN22) gene predisposes to autoimmune Addison's disease.

Authors:  Matthew Roycroft; Marta Fichna; David McDonald; Kate Owen; Magdalena Zurawek; Maria Gryczyńska; Danuta Januszkiewicz-Lewandowska; Piotr Fichna; Heather Cordell; Peter Donaldson; Jerzy Nowak; Simon Pearce
Journal:  Clin Endocrinol (Oxf)       Date:  2008-08-15       Impact factor: 3.478

5.  Cutting edge: the PTPN22 allelic variant associated with autoimmunity impairs B cell signaling.

Authors:  Adrian F Arechiga; Tania Habib; Yantao He; Xian Zhang; Zhong-Yin Zhang; Andrew Funk; Jane H Buckner
Journal:  J Immunol       Date:  2009-03-15       Impact factor: 5.422

6.  An inverse association between history of childhood eczema and subsequent risk of type 1 diabetes that is not likely to be explained by HLA-DQ, PTPN22, or CTLA4 polymorphisms.

Authors:  Lars C Stene; Kjersti S Rønningen; Marit Bjørnvold; Dag E Undlien; Geir Joner
Journal:  Pediatr Diabetes       Date:  2009-11-04       Impact factor: 4.866

7.  Atopic dermatitis in West Highland white terriers is associated with a 1.3-Mb region on CFA 17.

Authors:  Joana B Roque; Caroline A O'Leary; David L Duffy; Myat Kyaw-Tanner; Puya Gharahkhani; Linda Vogelnest; Kenneth Mason; Michael Shipstone; Melanie Latter
Journal:  Immunogenetics       Date:  2011-10-12       Impact factor: 2.846

8.  Breed and site predispositions of dogs with atopic dermatitis: a comparison of five locations in three continents.

Authors:  K Jaeger; M Linek; H T Power; S V Bettenay; S Zabel; R A W Rosychuk; Ralf S Mueller
Journal:  Vet Dermatol       Date:  2010-02       Impact factor: 1.589

Review 9.  PTPN22: its role in SLE and autoimmunity.

Authors:  Sharon A Chung; Lindsey A Criswell
Journal:  Autoimmunity       Date:  2007-12       Impact factor: 2.815

Review 10.  Protein tyrosine phosphatases in autoimmunity.

Authors:  Torkel Vang; Ana V Miletic; Yutaka Arimura; Lutz Tautz; Robert C Rickert; Tomas Mustelin
Journal:  Annu Rev Immunol       Date:  2008       Impact factor: 28.527

View more
  2 in total

1.  Current Knowledge on Canine Atopic Dermatitis: Pathogenesis and Treatment.

Authors:  Catherine A Outerbridge; Tyler J M Jordan
Journal:  Adv Small Anim Care       Date:  2021-09-29

Review 2.  Cannabinoid Signaling in the Skin: Therapeutic Potential of the "C(ut)annabinoid" System.

Authors:  Kinga Fanni Tóth; Dorottya Ádám; Tamás Bíró; Attila Oláh
Journal:  Molecules       Date:  2019-03-06       Impact factor: 4.927

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.