Literature DB >> 22205923

Analysis of inducible nitric oxide synthase gene polymorphisms in vitiligo in Han Chinese people.

Ying Zhang1, Chunying Li, Kai Li, Ling Liu, Zhe Jian, Tianwen Gao.   

Abstract

BACKGROUND: Vitiligo is a chronic depigmented skin disorder with regional melanocytes depletion. The pathogenesis was not completely clarified. Recently, more and more evidence suggested that polymorphisms of some genes are associated with vitiligo risk. Here, we want to examine the association between the inducible nitric oxide synthase (iNOS) gene polymorphisms and the risk of vitiligo in Chinese populations. METHODS AND PRINCIPAL
FINDINGS: In a hospital-based case-control study of 749 patients with vitiligo and 763 age- and sex-matched healthy controls, three polymorphisms of iNOS gene were genotyped by using the PCR-restriction fragment length polymorphism (PCR-RFLP) and mutagenically separated PCR (MS-PCR) methods, respectively. We found the iNOS-954 polymorphism was associated with a significantly higher risk of vitiligo (adjusted OR = 1.36, 95% CI = 1.02-1.81). Furthermore, this association is more pronounced in vulgaris vitiligo, active vitiligo and vitiligo without other autoimmune diseases in the stratification study. Analysis of haplotypes showed increased risk for the C₋₁₁₇₃C₋₉₅₄C(Ex₁₆+₁₄) (OR = 1.44, 95% CI = 1.01-1.74). In addition, the serum iNOS activity is significantly associated with iNOS-954 combined genotype (GC+CC) and is much higher in vitiligo patients than in the controls (P<0.01). Logistic regression analysis of iNOS activity showed increased risk between higher activity and iNOS-954 G→C variant genotype carriers (P(trend)<0.001). CONCLUSIONS AND SIGNIFICANCE: INOS gene polymorphisms may play an important role in the genetic susceptibility to the development of vitiligo.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 22205923      PMCID: PMC3244382          DOI: 10.1371/journal.pone.0027077

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Vitiligo is an acquired depigmentary disorder characterized by the appearance of white patches resulting from the loss of functional melanocytes and melanin from the skin and mucous. It affects 0.1–2% of the world population [1] without preference for a specific gender [2]. Several theories about the pathomechanism of vitiligo have been suggested, including: autoimmune, neural, radical, self destruction and inherent defect theories [3]. However, none of them can explain the pathomechanism of vitiligo perfectly. Nitric oxide (NO), a short-lived, free radical gas, act as an intercellular messenger in most or all mammalian organs, playing a major role in diverse physiologic processes and pathologic conditions [4], [5]. Many studies suggest that NO is involved in the inhibition of cell proliferation, differentiation, and apoptosis and, thus, may contribute to the pathogenesis of various autoimmune diseases [2], [6], [7]. NO is synthesized by a group of enzymes called NO synthase (NOS). NOS catalyses the production of NO and L-citrulline from L-arginine, O2 and NADPH. NOS family consists of three isoforms: neuronal NOS (nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS) [8], [9], [10], [11]. ENOS and nNOS produce NO within seconds and its activities are direct and short acting, whereas iNOS produces very large, toxic amounts of NO in a sustained manner. Expression of iNOS is under the regulation of several cytokines such as interferon gamma (IFN-γ), tumor necrosis factor (TNF-α), and interleukin 1 beta (IL-1β) and its function is part of the macrophage-mediated response to infectious agents. It has reported that normal human melanocytes will express iNOS following incubation with LPS, TNF-α, and IFN-γ, then high doses of NO can result in self-destroy of cultured normal human melanocytes and pigment loss [12], [13], [14]. Moreover, NO is reported as a regulatory mediator involved in the development of autoimmune disease [15] and Ivanova et al. [14] also reported that NO can affect adherence of melanocyte and cell matrix, inhibiting melanocyte proliferation, changing melanocyte form and induced melanocyte death ultimately. Therefore, it is conceivable that iNOS is involved in the pathogenesis of vitiligo. The human iNOS gene is located on the chromosome 17q11.2–q12, has a genomic size of 48 kb, and encodes a protein of 131 kDa [16]. Among several single nucleotide polymorphisms (SNPs) in iNOS that have been reported previously, the promoter polymorphisms iNOS-1173 C→T and -954 G→C have been shown to modify iNOS transcription and mRNA levels [17], [18]. A C-to-T transition at exon 16 was located only six amino acids N-terminally from the deletion reported by Daff [19], and the amino acid substitution (from serine to leucine) in exon 16 might be of functional interest. Considering the important role that iNOS plays in the production of NO and, thus, in the pathogenesis of vitiligo, we hypothesized that the functional polymorphisms in the iNOS gene may be associated with the risk of vitiligo. However, to date, there has been no research about the polymorphisms of iNOS gene in the etiology of vitiligo. We genotyped the three reported functional single nucleotide polymorphisms of the iNOS gene (i.e., -1173 C→T, -954 G→C, and Ex16+14 C→T) to test this hypothesis in our ongoing hospital-based, case-control study on vitiligo in a Chinese population.

Materials and Methods

Subjects

This study included 749 Han Chinese patients with vitiligo and 763 age- and sex-matched controls. Because genotype frequencies can vary among ethnic groups, only Han Chinese patients (more than 90% of population of China) and controls were included in this analysis. All the patients had not subjected to any therapy in recent 6 months. All the healthy subjects did not show clinical evidence or family history of vitiligo or of any other autoimmune disorder. Vitiligo was clinically characterized in patients as segmental and non-segmental [20]. Segmental vitiligo was diagnosed if the disease followed a dermatomal distribution. Active vitiligo was defined as the appearance of new lesions or the enlargement of existing lesions in the 3 months before presentation. The protocols used in the study were approved by the Hospital's Protection of Human Subjects Committee (Xijing Hospital, Fourth Military Medical University, Clinical Ethics Committee). We have obtained informed consent from all participants involved in our study. This consent was written and saved in our department.

Genotyping

Genomic DNA was extracted from cell pellets by using a blood genomic DNA purification kit (Tiangen, Beijing, China). The iNOS-954 G→C and Ex16+14 C→T polymorphisms were determined using the PCR-RFLP method, whereas the iNOS-1173 C→T polymorphism was carried out using MS-PCR. Genomic DNA was prepared from venous blood samples using a DNA extract kit (Tiangen, Beijing, China). DNA purity and concentration were determined by spectrophotometric measurement of absorbance at 260 and 280 nm. PCR was used to amplify the fragments that contained the select iNOS polymorphic sites. The primers of iNOS-954 G→C were as follows: 5′- CATATGTATGGGAATACTGTATTTCAG -3′ (forward) and 5′- TCTGAACTAGTCACTTGAGG -3′ (reverse), as previously reported [18]. The Ex16+14 C→T was amplified with following primers: 5′- CATATGTAAACCAACTTCCGTG -3′ (forward) and 5′- GGCAGGGCTAGGAGTAGGAC -3′ (reverse), as previously reported [21]. The primers of iNOS-1173 C→T are as follows: 5′- GACAAGAAGGAAATGAGTGGACACAGGTAGCAAAGTGTTGAGAC -3′ (MS-P2F), 5′- GCATTTTTCCATCATAAAAGTAA -3′ (MS-P3R) and 5′- GTGGTAGCAAATGTTGGAAT -3′ (MS-P4F), as previously reported [22].The amplified PCR products for the iNOS-954 G→C and Ex16+14 C→T polymorphisms were 573 bp and 219 bp, respectively. Then we used BsaI and Tsp509I restriction enzymes (New England Biolabs, Beverly, Mass) to delineate the iNOS-954 G→C and Ex16+14 C→T polymorphisms, respectively. Cuts by these enzymes resulted in 573-bp and 446-bp fragments in the case of the iNOS-954 G allele, 175-bp and 44-bp fragments in the case of the iNOSEx16+14 C allele. The amplified PCR products of the iNOS-1173 C and iNOS-1173 T alleles were 131 and 102 bp, respectively. About 10% of the samples were randomly selected and genotyped again with the same method to test the discrepancy rate, and the results were 100% concordant. In addition, every genotype was sequenced to confirm its authenticity.

Serum iNOS activity analysis

We used computer-generated random numbers to assign 89 vitiligo patients from experimental group and 89 normal samples from control group for serum iNOS activity analysis. The statistical analysis of the epidemiologic feature and genotype frequency between the selected 89 vitiligo patients and experimental group did not show significance. The unit of serum NOS activity is defined as: one milliliter serum generates 1 nmol NO per minute is defined as one unit of activity. NOS has three major types: neuronal NOS (nNOS), endothelial NOS (eNOS) and inducible (iNOS). nNOS' and eNOS' existence is depended on the calcium and resided in the neuron and the endotheliocyte; however, iNOS resided in the macrophage and its existence has no relationship with the calcium. According to this principle, we could type the NOS easily. Here, we used the NOS examining kit (The first substation of Jiang Cheng bioengineering institute, Nanking) to detect the serum iNOS activity in differential samples, the experimental process was performed according to the instruction manual and previously reported [23]. Briefly, under the 530 nm wavelength, we first detected the absorbance of differential samples with the chromatometry method, then according the following formula to calculate the iNOS activity. The calculating formula is: iNOS (U/mL) = (iNOS measuring tube OD value – blank tube OD value)/coloration material nanomole absorbancy index×(bulk volume of the reaction liquid/sampling volume)×(1/optical path of the shade selection×reation time)/1 000.

Statistical analysis

The chi-square test was used to evaluate the differences in frequency distribution for the selected demographic variables, including each allele and genotype of the iNOS polymorphisms and the serum iNOS activity between the vitiligo cases and controls. Unconditional univariate analyses and multivariate logistic regression analyses were performed to obtain the crude and adjusted odds ratios (ORs) for the risk of vitiligo as well as the 95% confidence intervals (CIs). The multivariate adjustment included age and gender. The D′ value for linkage disequilibrium between the three iNOS polymorphisms and the haplotypes frequencies were calculated by SHEsis (http://analysis.bio-x.cn/myAnalysis.php) [24]. The genotype data for each polymorphism was further stratified by subgroups of sex, stage, type, onset age, family history, and with/without other autoimmune diseases. The interaction between the three iNOS polymorphisms was evaluated by using multivariate logistic regression models. Statistical significance was established at a P value of 0.05. Two-side tests of statistical significance were performed by using the SAS software (version 9.1; SAS Institute, Inc., Cary, North Carolina).

Results

Characteristics of the Study Population

The frequency distributions of selected characteristics of the controls and vitiligo patients are summarized in table 1 (Table 1). The age of the patients ranged from 2 to 95 years (24.9±13.9, mean±SD) and the controls are from 1 to 75 years (26.2±13.7) (P = 0.703). The frequency distributions in men and women were 55.3 and 44.7%, respectively in the cases, and 54.1 and 45.9%, respectively in the controls (P = 0.675). Among the cases were 43 (5.8%) segmental vitiligo and 706 (94.2%) nonsegmental vitiligo patients and 623 (83.2%) active and 126 (16.8%) stable vitiligo patients. One hundred and twenty eight (17%) vitiligo patients were considered to have a family history and 28 (4.2%) cases have other auto-immune diseases. Patients were considered to have early onset vitiligo (n = 384, 61.4%) if the age of onset was prior to 20 years old [25].
Table 1

Clinical characteristics of the 749 Chinese vitiligo patients and 763 healthy controls.

Vitiligo(N/%) (N = 749)Healthy controls (n/%) (n = 763)
Average age (year, mean±S.D.)24.9±13.926.2±13.7
Number of female/male335(0.45)/414(0.55)350(0.46)/413(0.54)
Early onset/late onset462(0.62)/287(0.38)
Active/stable623(0.83)/126(0.17)
Nonsegmental/segmental706(0.94)/43(0.06)
With/without family history128(0.17)/621(0.83)
With/without other autoimmune diseases28(0.04)/721(0.96)

Association between iNOS Genotypes and the Risk of Vitiligo

As shown in Table 2, the distribution of all genotypes among controls was compatible with the Hardy-Weinberg equilibrium (χ2: P = 0.877 for iNOS-1173 C→T; P = 0.133 for iNOS-954 G→C; P = 0.080 for iNOSEx16+14 C→T). The differences in iNOS-1173 and Ex16+14 genotyping distributions between vitiligo cases and controls were not statistically significant (P = 0.542 and P = 0.736, respectively). Similarly, the iNOS-1173 T allele and Ex16+14 T allele did not differ significantly between cases and controls (12.6% vs.11.4%, P = 0.329 and 13.1% vs.15.5%, P = 0.068, respectively). However, the iNOS-954 variant C allele frequency was significantly higher among cases than among controls (8.9% vs.6.7%, P = 0.028), and the frequency of the iNOS-954 (GC+CC) combined genotype was also significantly higher in cases than in controls (16.6% vs.12.6%, P = 0.029).
Table 2

Genotypic frequencies of iNOS polymorphisms in cases and controls and their associations with risk of vitiligo.

GenotypesCases (N = 749)Controls (n = 763)a adjusted OR (95% CI)b P c
N%n%
iNOS-954
GG 62583.466787.41.000.087
GC 11515.49011.81.35(1.01–1.81)
CC 91.260.81.49(0.52–4.23)
GC+CC 12416.69612.61.36(1.02–1.81)0.029
C allele8.96.70.028
iNOS-1173
CC 57476.659978.51.000.542
CT 16121.515420.21.09(0.85–1.40)
TT 141.9101.31.42(0.62–3.23)
CT+TT 59779.763783.51.11(0.87–1.41)0.058
T allele12.611.40.329
iNOSEx16+14
CC 57176.256974.61.000.736
CT 16021.417322.70.92(0.72–1.18)
TT 182.4212.80.84(0.44–1.60)
CT+TT 17823.719425.40.91(0.72–1.16)0.453
T allele13.115.50.068

CI, confidence interval; OR, odds ratio.

The observed genotype frequencies among the controls were in agreement with the Hardy–Weinberg equilibrium (χ2: P = 0.977 for iNOS-1173 C→T; P = 0.133 for iNOS-954 G→C; P = 0.080 for iNOSEx16+14 C→T).

ORs were obtained from a multivariate logistic regression model with adjustment for age and sex.

Adjustment for age and sex.

CI, confidence interval; OR, odds ratio. The observed genotype frequencies among the controls were in agreement with the Hardy–Weinberg equilibrium (χ2: P = 0.977 for iNOS-1173 C→T; P = 0.133 for iNOS-954 G→C; P = 0.080 for iNOSEx16+14 C→T). ORs were obtained from a multivariate logistic regression model with adjustment for age and sex. Adjustment for age and sex. When we used the iNOS-954 GG genotype as the reference group, we found a statistically significant increased risk of vitiligo was associated with the -954 combined (GC+CC) genotype (adjusted OR = 1.39; 95% CI = 1.11–1.74). However, when iNOSEx16+14 CC and iNOS-1173 CC were used as reference groups, no significant risk was associated with any other genotypes.

Stratification analysis of the iNOS Polymorphisms and Known Risk Factors of Vitiligo

To investigate the effects of iNOS polymorphisms on vitiligo, we performed an additional stratification analysis with the dichotomized genotypes groups. We observed significant association with iNOS-954 combined (GC+CC) genotype in subgroups that were with active vitiligo (adjusted OR = 1.35; 95% CI = 1.01–1.82), that were diagnosed with nonsegmental vitiligo (adjusted OR = 1.36; 95% CI = 1.02–1.82) and that had no other autoimmune diseases (adjusted OR = 1.39; 95% CI = 1.04–1.85) (Table 3). We also performed the stratified analysis for iNOS-1173 and Ex16+14, but no statistically significant results were found (data not shown).
Table 3

Stratification analysis of the iNOS -954 genotypes and vitiligo risk by selected variables.

Variables iNOS-954 (case/control)Adjusted OR (95% CI)a P b
GG GC+CC
N%n%
Total625/66748.4/51.6124/9656.4/43.61.36 (1.02–1.81)0.029
Onset age(years)
≤20384/66761.4/- 78/9662.9/- 1.08 (0.76–1.53)0.087
>20241/66738.6/- 46/9637.1/- 1.47 (0.97–2.22)0.146
Sex
Male345/36255.2/54.369/5155.6/53.11.39 (0.93–2.05)0.078
Female280/30544.8/45.755/4544.4/46.91.32 (0.86–2.02)0.187
Stage
Stable105/66716.8/- 21/9616.9/- 1.32 (0.79–2.22)0.209
Active520/66783.2/- 103/9683.1/- 1.35 (1.00–1.82)0.037
Type
Nonsegmental589/66794.2/- 117/9694.4/- 1.36 (1.02–1.82)0.030
Segmental36/6675.8/- 7/965.6/- 1.09 (0.46–2.55)0.480
Family history
Yes105/66716.8/- 23/9618.5/- 1.42 (0.86–2.35)0.097
No520/66783.2/- 101/9681.5/- 1.33 (0.98–1.80)0.051
Autoimmune diseases
With26/6674.2/- 2/961.6/- 0.57 (0.13–2.44)0.391
Without599/66795.8/- 122/9698.4/- 1.39 (1.04–1.85)0.018

Odds ratios (ORs) were obtained from a multivariate logistic regression model with adjustment for age and sex. 95% CI, 95% confidence interval.

Adjustment for age and sex.

Odds ratios (ORs) were obtained from a multivariate logistic regression model with adjustment for age and sex. 95% CI, 95% confidence interval. Adjustment for age and sex.

Association between iNOS Haplotypes and the Risk of Vitiligo

The Linkage Disequilibrium tests showed that the three polymorphisms of iNOS gene were in Linkage Disequilibrium (D′ = 0.897, P<0.01 for iNOS-1173 and -954; D′ = 0.613, P<0.01 for iNOS-1173 and Ex16+14; D′ = 0.392, P<0.01 for iNOS -954 and Ex16+14). There were eight possible iNOS haplotypes derived from the known genotypes, whereas those frequency<0.03 were ignored in analysis (i.e. C -1173 C -954 T 16+14, T -1173 G -954 T 16+14, T -1173 C -954 T 16+14, T -1173 C -954 C 16+14). As shown in Table 4, the iNOS C -1173 C -954 C 16+14 haplotype frequency was significantly different between vitiligo cases and controls (7.3% vs.5.3%, respectively; P = 0.016). Moreover, the haplotype C -1173 C -954 C 16+14 was associated with a significantly increased risk of vitiligo (adjusted OR = 1.44, 95% CI = 1.01–1.74).
Table 4

Frequencies of the iNOS haplotypes among the cases and controls and their associations with risk of vitiligo.

iNOS HaplotypeCase(%)a Control(%)a χ2 P OR(95%CI)
C-1173G-954CEx16+14 1021(68.1)1060(69.4)0.0830.7720.98 (0.83–1.14)
C-1173G-954TEx16+14 172(11.5)200(13.1)1.4550.2280.88 (0.70–1.09)
T-1173G-954CEx16+14 155(10.3)163(10.7)0.0320.8590.98 (0.78–1.24)
C-1173C-954CEx16+14 109(7.3)80(5.3)5.7530.0161.44 (1.01–1.74)

Frequency<0.03 (i.e., C -1173 C -954 T 16+14, T -1173 G -954 T 16+14, T -1173 C -954 T 16+14, T -1173 C -954 C 16+14) in both control & case has been ignored in analysis.

Frequency<0.03 (i.e., C -1173 C -954 T 16+14, T -1173 G -954 T 16+14, T -1173 C -954 T 16+14, T -1173 C -954 C 16+14) in both control & case has been ignored in analysis.

The Interaction among the iNOS Polymorphisms and Association between iNOS Combined Genotypes and Risk of Vitiligo

Considering the potential joint effects of the three polymorphisms of iNOS, we further evaluated the interaction among the iNOS polymorphisms and the association between the combined genotypes of iNOS-1173, -954, and Ex16+14 and the risk of vitiligo, with the multivariate logistic regression models. Firstly, we analyzed any two of the three polymorphisms. We found the interaction between iNOS-1173, -954, and Ex16+14 was not statistically significant (P = 0.311, P = 0.150, P = 0.202, respectively). We next analyzed the combined genotypes of the three iNOS polymorphisms, but we found no statistically significant relationship between any two of the three polymorphisms or among the three iNOS polymorphisms (data not shown).

Association between Serum iNOS Activity and the Risk of Vitiligo

In order to analysis the serum iNOS activity and risk of vitiligo, we compared the serum iNOS activity in 89 vitiligo patients with the 89 normal control samples. We found the serum iNOS activity in vitiligo patients' group is significantly higher than that in the normal control group (15.40±3.98 U/ml vs.13.29±2.45 U/ml; u = 6.58, P<0.01) (Figure 1A). Furthermore, to examine the relationship between the iNOS-954 gene polymorphism and the serum iNOS activity in vitiligo patients, we also studied the serum iNOS activity in differential genotype of iNOS-954. Because the number of risk genotype CC group is very small (3 samples), we only examined the serum iNOS activity in iNOS-954 protective genotype GG group with the risk genotype (GC+CC) group. Our results showed that compared with the iNOS-954 protective genotype GG group, the risk genotype (GC+CC) group has the higher serum iNOS activity (16.87±4.20 U/ml vs.13.83±3.56 U/ml; t = 7.48, P<0.01) (Figure 1B).
Figure 1

Serum iNOS activity and correlations to vitiligo genetype.

(A) The serum iNOS activity in vitiligo patients' group is significantly higher than that in the normal control group (P<0.01). (B) Compared with the iNOS–954 protective genotype GG group, the risk genotype (GC+CC) group has the higher serum iNOS activity (P<0.01).

Serum iNOS activity and correlations to vitiligo genetype.

(A) The serum iNOS activity in vitiligo patients' group is significantly higher than that in the normal control group (P<0.01). (B) Compared with the iNOS–954 protective genotype GG group, the risk genotype (GC+CC) group has the higher serum iNOS activity (P<0.01).

Logistic Regression Analysis of iNOS Activity in Vitiligo Patients and Controls

As shown in Table 5, we performed a logistic regression analysis of serum iNOS activity in vitiligo patients and controls. When we dichotomized the iNOS activity by the median activity of the controls, we found an increased risk for vitiligo was associated with the higher activity (adjusted OR = 2.14, 95% CI = 1.88–2.45). According to the iNOS activity of controls, we further divided the iNOS activity into three decile. When we used efficient (lower tertile) activity as the reference, the suboptimal (upper tertile) activity was associated with an increased risk of vitiligo (adjusted OR = 1.64, 95% CI = 1.35–1.86; P trend<0.001).
Table 5

Logistic regression analysis of iNOS activity in vitiligo patients and controls.

ActivityCases(N = 89)Controls(n = 89)adjusted ORa (95% CI)
N%n%
By median
<14.052831.44853.91.00
≥14.056168.64146.12.14(1.88–2.45)
By tertile
≤13.171516.93236.01.00
13.17–14.833337.13539.31.14(0.88–1.36)
≥14.834146.02224.71.64(1.35–1.86)
Trend test---- P b<0.001

Odds ratios (ORs) were obtained from a logistic regression model with adjustment for age and sex; 95% CI, 95% confidence interval.

Adjusted for age and sex.

Odds ratios (ORs) were obtained from a logistic regression model with adjustment for age and sex; 95% CI, 95% confidence interval. Adjusted for age and sex.

Risk of Vitiligo Associated with iNOS-954 G→C Genotypes by iNOS Activity

Furthermore, we estimated the risk of vitiligo associated with iNOS-954 genotypes by iNOS activity (Table 6). We divided iNOS-954 G→C genotypes into two categories, 0 risk genotype (-954 GG) and 1–2 risk genotypes (-954 GC or -954 CC). When the -954 GG was used as the reference, the individuals with 1–2 risk genotypes (-954 GC or -954 CC) and higher iNOS activity (≥14.05) showed more increased risk of vitiligo (adjusted OR = 4.53, 95% CI = 2.71–7.44). When we divided the iNOS activity into three decile according to the controls' activity, the -954 GC or CC genotype combined higher iNOS activity was associated with increased risk of vitiligo (≥14.83, adjusted OR = 2.40, 95% CI = 1.35–4.03).
Table 6

Risk of vitiligo associated with iNOS-954 G→C genotypes by iNOS activity.

Activity iNOS-954 GC (case/control)
0 risk genotypeOR(95% CI)a 1–2 risk genotypeOR(95% CI)a
By median
<14.0518/501.006/120.81(0.25–2.68)
≥14.0545/221.17(0.33–1.62)20/54.53(2.71–7.44)
By tertile
≤13.1711/381.002/60.41(0.14–2.76)
13.17–14.8319/221.02(0.84–1.32)10/51.07(0.74–1.80)
≥14.8333/121.61(0.21–2.06)14/42.40(1.35–4.03)
Trend test--- P b<0.001

Odds ratios (ORs) were obtained from a logistic regression model with adjustment for age and sex; 95% CI, 95% confidence interval.

Adjusted for age and sex.

Odds ratios (ORs) were obtained from a logistic regression model with adjustment for age and sex; 95% CI, 95% confidence interval. Adjusted for age and sex.

Discussion

In this hospital-based case-control study, we investigated the associations of the iNOS-1173 C→T, -954 G→C, and Ex16+14C→T polymorphisms with risk of vitiligo in Han Chinese populations. We found that compared to the iNOS-954 GG genotype, the iNOS-954 combined (GC+CC) genotypes were associated with an increased risk of vitiligo. The association was more pronounced in patients with active vitiligo, nonsegmental vitiligo and vitiligo without other autoimmune disorders. This suggests that iNOS-954 gene polymorphism may have a greater effect on these subgroups. The differences maybe due to the reduction in the number of observations in some strata or may reflect true susceptible subgroups. Further exploration is needed to determine whether the effects found here are an aberration, and what the exact mechanisms underlying such effects are. Compared with the previously published data, the iNOSEx16+14 T allele frequencies were similar to the frequencies in other Chinese controls and Japanese [26], [27]. However, we found the iNOS-954 C allele frequency was lower in Han Chinese than in African [22], which indicated that the genotype distributions of the iNOS-954 polymorphism vary with ethnicity. The iNOS-954 polymorphism is located in the iNOS promoter region, which could be an activator of gene expression [22]. INOS-954 C allele, but not the iNOS-954 G allele, may have a higher affinity to a DNA binding protein, thus, transcriptional activity and mRNA levels were increased in the iNOS-954 C allele. Then the NOS activity and NO production were increased. Our result certified iNOS-954 C allele can increase iNOS activity. To the best of our knowledge, this is the first study on the association between the iNOS polymorphisms and vitiligo in the Han Chinese population. An early event in the onset of vitiligo appears to involve the overproduction of tetrahydrobiopterin, which leads to the accumulation of a potent inhibitor of melanin biosynthesis [28]. The synthesis of tetrahydrobiopterin is cytokine induced and it is an essential cofactor in the enzymatic activity of iNOS [29]. LPS/cytokines can stimulate normal human melanocytes express iNOS. This enzyme might therefore be involved in the altered melanin production associated with post-inflammatory hypopigmentation [30]. In vitiligo, the increase of iNOS activity caused by overexpression of the tetrahydrobiopterin or LPS/cytokines can produce plenty of NO generation. NO has been reported to contribute to the loss of melanocytes in vitiligo by reducing de novo attachment of melanocytes to the extracellular matrix components. Moreover, increased iNOS activity induces NO production and O2 −, which result in the accumulation of hydrogen peroxide. High of hydrogen peroxide can lead to melanocytes destruct and depigmentation ultimately [31]. The increased NOS activity had been confirmed in vitiligo affected/nonaffected melanocytes and keranocytes. Our study also confirmed that the increased iNOS activity was related with the onset of vitiligo indirectly. However, the specific mechanisms of iNOS involved in the pathogenesis of vitiligo still need further research. In summary, we provide evidence that iNOS polymorphisms may influence the risk and clinical progression of vitiligo in Han Chinese populations. A statistically significantly increased risk of vitiligo was associated with the iNOS-954 (GC+CC) genotype compared with the -954 GG genotype, which was more pronounced among vitiligo patients with the following characteristics: non-segmental, active vitiligo and without other autoimmune diseases. But no evident risk was associated with the iNOS-1173 and Ex16+14 polymorphisms. Furthermore, we found the serum iNOS activity was significantly higher in vitiligo and was increased in iNOS-954 combined genotype (GC+CC) compared with -954 GG genotype. Nevertheless, better-designed and larger prospective studies are needed to confirm these findings, and more detailed environmental exposure data are necessary to further test potential gene-environment interactions.
  31 in total

1.  Transient nitric oxide synthase neurons in embryonic cerebral cortical plate, sensory ganglia, and olfactory epithelium.

Authors:  D S Bredt; S H Snyder
Journal:  Neuron       Date:  1994-08       Impact factor: 17.173

2.  A web-accessible digital atlas of the distribution of nitric oxide synthase in the mouse brain.

Authors:  R J Cork; M L Perrone; D Bridges; J Wandell; C A Scheiner; R R Mize
Journal:  Prog Brain Res       Date:  1998       Impact factor: 2.453

3.  Parallel induction of nitric oxide and tetrahydrobiopterin synthesis by cytokines in rat glial cells.

Authors:  N Sakai; S Kaufman; S Milstien
Journal:  J Neurochem       Date:  1995-08       Impact factor: 5.372

4.  High iNOS mRNA and protein levels during early third trimester suggest a role for NO in prelabor cervical ripening in the bovine.

Authors:  Marian Aalberts; Federica M F van Dissel-Emiliani; Helena T A van Tol; Marcel A M Taverne; Vidya N A Breeveld-Dwarkasing
Journal:  Mol Reprod Dev       Date:  2007-03       Impact factor: 2.609

5.  Linkage of the human inducible nitric oxide synthase gene to type 1 diabetes.

Authors:  J Johannesen; A Pie; F Pociot; O P Kristiansen; A E Karlsen; J Nerup
Journal:  J Clin Endocrinol Metab       Date:  2001-06       Impact factor: 5.958

6.  Nitric oxide synthase type 2 promoter polymorphisms, nitric oxide production, and disease severity in Tanzanian children with malaria.

Authors:  M C Levesque; M R Hobbs; N M Anstey; T N Vaughn; J A Chancellor; A Pole; D J Perkins; M A Misukonis; S J Chanock; D L Granger; J B Weinberg
Journal:  J Infect Dis       Date:  1999-12       Impact factor: 5.226

7.  Polymorphisms of the neuronal and inducible nitric oxide synthase genes and the risk of cutaneous melanoma: a case-control study.

Authors:  Chunying Li; Zhibin Hu; Zhensheng Liu; Li-E Wang; Jeffrey E Gershenwald; Jeffrey E Lee; Victor G Prieto; Madeleine Duvic; Elizabeth A Grimm; Qingyi Wei
Journal:  Cancer       Date:  2007-04-15       Impact factor: 6.860

8.  Association between achalasia and nitric oxide synthase gene polymorphisms.

Authors:  Fermín Mearin; María-Asunción García-González; Michael Strunk; Natalia Zárate; Juán-Ramón Malagelada; Angel Lanas
Journal:  Am J Gastroenterol       Date:  2006-07-18       Impact factor: 10.864

9.  A novel genetic polymorphism of inducible nitric oxide synthase is associated with an increased risk of gastric cancer.

Authors:  Jing Shen; Run-Tian Wang; Li-Wei Wang; Yao-Chu Xu; Xin-Ru Wang
Journal:  World J Gastroenterol       Date:  2004-11-15       Impact factor: 5.742

10.  Defective tetrahydrobiopterin and catecholamine biosynthesis in the depigmentation disorder vitiligo.

Authors:  K U Schallreuter; J M Wood; I Ziegler; K R Lemke; M R Pittelkow; N J Lindsey; M Gütlich
Journal:  Biochim Biophys Acta       Date:  1994-05-25
View more
  6 in total

1.  Inducible nitric oxide synthase (iNOS) regulatory region variation in non-human primates.

Authors:  Morteza Roodgar; Cody T Ross; Nicholas J Kenyon; Gretchen Marcelino; David Glenn Smith
Journal:  Infect Genet Evol       Date:  2015-02-09       Impact factor: 3.342

Review 2.  Modern vitiligo genetics sheds new light on an ancient disease.

Authors:  Richard A Spritz
Journal:  J Dermatol       Date:  2013-05       Impact factor: 4.005

3.  Differential Expression of Nitric Oxide Synthase Isoforms nNOS and iNOS in Patients with Non-Segmental Generalized Vitiligo.

Authors:  Mario Vaccaro; Natasha Irrera; Giuseppina Cutroneo; Giuseppina Rizzo; Federico Vaccaro; Giuseppe P Anastasi; Francesco Borgia; Serafinella P Cannavò; Domenica Altavilla; Francesco Squadrito
Journal:  Int J Mol Sci       Date:  2017-11-26       Impact factor: 5.923

4.  Prevalence of polymorphisms in glucose-6-phosphate dehydrogenase, sickle haemoglobin and nitric oxide synthase genes and their relationship with incidence of uncomplicated malaria in Iganga, Uganda.

Authors:  Catherine Nassozi Lwanira; Fred Kironde; Mark Kaddumukasa; Göte Swedberg
Journal:  Malar J       Date:  2017-08-09       Impact factor: 2.979

5.  Inducible Nitric Oxide Synthase iNOS-954-G>C and Ex16+14-C>T Gene Polymorphisms and Susceptibility to Vitiligo in the Saudi Population.

Authors:  Fahad Al-Harthi; Ghaleb Bin Huraib; Md Mustafa; Yasser Al-Qubaisy; Naif Al-Nomair; Nour Abdurrahman; Abdulrahman Al-Asmari
Journal:  Pharmgenomics Pers Med       Date:  2022-06-13

6.  Association of a NOS3 gene polymorphism with Behçet's disease but not with Vogt-Koyanagi-Harada syndrome in Han Chinese.

Authors:  Yan Zhou; Hongsong Yu; Shengping Hou; Jing Fang; Jieying Qin; Gangxiang Yuan; Aize Kijlstra; Peizeng Yang
Journal:  Mol Vis       Date:  2016-04-03       Impact factor: 2.367

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.