Literature DB >> 22174904

Transcriptome analysis of H2O2-treated wheat seedlings reveals a H2O2-responsive fatty acid desaturase gene participating in powdery mildew resistance.

Aili Li1, Rongzhi Zhang, Lei Pan, Lichuan Tang, Guangyao Zhao, Mingzhu Zhu, Jinfang Chu, Xiaohong Sun, Bo Wei, Xiangqi Zhang, Jizeng Jia, Long Mao.   

Abstract

Hydrogen peroxide (H(2)O(2)) plays important roles in plant biotic and abiotic stress responses. However, the effect of H(2)O(2) stress on the bread wheat transcriptome is still lacking. To investigate the cellular and metabolic responses triggered by H(2)O(2), we performed an mRNA tag analysis of wheat seedlings under 10 mM H(2)O(2) treatment for 6 hour in one powdery mildew (PM) resistant (PmA) and two susceptible (Cha and Han) lines. In total, 6,156, 6,875 and 3,276 transcripts were found to be differentially expressed in PmA, Han and Cha respectively. Among them, 260 genes exhibited consistent expression patterns in all three wheat lines and may represent a subset of basal H(2)O(2) responsive genes that were associated with cell defense, signal transduction, photosynthesis, carbohydrate metabolism, lipid metabolism, redox homeostasis, and transport. Among genes specific to PmA, 'transport' activity was significantly enriched in Gene Ontology analysis. MapMan classification showed that, while both up- and down- regulations were observed for auxin, abscisic acid, and brassinolides signaling genes, the jasmonic acid and ethylene signaling pathway genes were all up-regulated, suggesting H(2)O(2)-enhanced JA/Et functions in PmA. To further study whether any of these genes were involved in wheat PM response, 19 H(2)O(2)-responsive putative defense related genes were assayed in wheat seedlings infected with Blumeria graminis f. sp. tritici (Bgt). Eight of these genes were found to be co-regulated by H(2)O(2) and Bgt, among which a fatty acid desaturase gene TaFAD was then confirmed by virus induced gene silencing (VIGS) to be required for the PM resistance. Together, our data presents the first global picture of the wheat transcriptome under H(2)O(2) stress and uncovers potential links between H(2)O(2) and Bgt responses, hence providing important candidate genes for the PM resistance in wheat.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 22174904      PMCID: PMC3236209          DOI: 10.1371/journal.pone.0028810

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Hydrogen peroxide (H2O2) is a well known toxic molecule and is also a specific component of several biotic and abiotic signaling pathways [1]. In plants, H2O2 production causes oxidative stress during external stimuli such as chilling [2], drought [3], salinity [4], UV irradiation [5], ozone exposure [6], heavy metal [7], and wounding [8]. H2O2 is also produced upon phytohormone treatments such as abscisic acid (ABA) [9] and jasmonic acid (JA) [8], as well as during elicitor and pathogen challenges [10]–[11]. In almost all cases, H2O2 seems to be positively employed by plants to activate certain stress-responsive genes that help them cope with adverse environmental changes. Global gene expression profiling experiments on H2O2-treated plants have revealed a large number of genes in Arabidopsis and tobacco that are mostly involved in response to oxidative stress [12]–[14]. Such treatments, however, not only affect genes involved in reactive oxygen species (ROS) detoxification, but also drive the expression of genes involved in signal transduction, transcriptional regulation and protein, carbohydrate or lipid metabolism, illustrating the complexity of the transcriptional responses to H2O2. Recently, a proteomics investigation of proteins that are differentially accumulated responding to exogenous H2O2 was performed in rice [15]. The study identified proteins that are involved in various cellular responses and metabolic processes, redox homeostasis, signal transduction, protein synthesis and degradation, photosynthesis and photorespiration, and carbohydrate/energy metabolism. Production of ROS has been observed during pathogen infection and is also a hallmark of successful recognition of infection and activation of plant defense systems. Oxidative burst is one of the fastest defense responses activated in plants to resist pathogen and parasite attacks. It consists of the production of ROS, mainly H2O2, at the first site of pathogen invasion: the plant cell wall, and incurs a number of events before the transcription-dependent defense mechanisms are activated [16]. Subsequently, H2O2 works as a selective signal for the induction of a subset of defense genes including phosphorylation cascades [17]–[18], cyclic oxylipins of the jasmonate type [19], phytoalexins and secondary metabolites [20], as well as genes associated with programmed cell death [21] and plant hormone signaling [22]. Phyto-oxylipins are metabolites produced in plants by the oxidative transformation of unsaturated fatty acids via a series of diverse metabolic pathways and are believed to play a pivotal role in plant defenses as signal molecules and/or protective compounds [23]. Along with salicylic acid (SA), JA, and ethylene (Et) are hormones usually associated with the induction of defenses where they antagonistically interact with SA [24]. ROS are proposed to be the central component of a self-amplifying loop that regulates the interaction between SA, JA and Et to mediate the response to ozone and possibly some defense and cell death processes [25]–[26]. Wheat (Triticum aestivum L.) is one of the most important crops to feed the world's population. Each year, wheat powdery mildew (PM) causes serious yield loss worldwide. H2O2 has been shown to accumulate in the mesophyll cells during the early stage of the wheat-PM incompatible interaction [11], [27]–[28], suggesting that H2O2 signaling plays a role in PM defense. In Arabidopsis, the co-regulation of H2O2 signaling and defense responses was reported. For example, H2O2 regulates the coordinated action of the Arabidopsis TGA1 (TGACG motif-binding factor 1) and NPR1 (non expressor of pathogenesis-related genes 1) genes that are required for defense gene expression and systemic acquired disease resistance [18], [29]. Similarly, a serine/threonine kinase gene, Stpk-V introgressed from Haynaldia villosa, a wild relative of wheat, is recently reported to be induced by both Blumeria graminis s.sp. tritici (Bgt) and exogenous H2O2, and confers the resistance to the powdery mildew (PM) in wheat [30]. These studies demonstrate the coordination of the H2O2-induced signaling pathways and that of pathogens. The recent advance in next-generation sequencing technology provides a powerful tool for sequence-based transcriptome analysis in species with large genomes such as wheat. However, a global analysis of H2O2-responsive genes in wheat is still lacking, especially H2O2-triggered defense related genes and molecular pathways. In the present work, we performed a transcriptome analysis of H2O2-treated wheat seedlings in the PM resistant (PmA) and susceptible (Cha and Han) lines. Using the mRNA tag sequencing approach, we identified differentially expressed genes with consistent expression patterns in all three wheat lines as well as those with specific expression patterns in PmA. We found that the basal H2O2-responsive genes in wheat were involved in various cellular responses and metabolic processes, with functions toward cell defense, signal transduction, photosynthesis, carbohydrate metabolism, lipid metabolism, redox homeostasis, and transport. In PmA, Gene Ontology analysis revealed the enrichment of ‘transport’ activities, while MapMan classification unraveled activated genes in PmA for JA and Et signaling pathway. Further, eight genes were found to be co-regulated by H2O2 treatment and Bgt inoculation, among which a fatty acid desaturase gene (TaFAD) was shown to be involved in the PM resistance. Our work is the first transcriptome-wide analysis of wheat genes responding to H2O2 treatment and provides candidate genes that may deserve further investigation for PM resistance in wheat.

Results

The morphological and physiological changes of wheat seedlings under H2O2 treatment

H2O2 can act as signaling molecules at low concentrations by diffusing into cells and be rapidly and specifically perceived by a series of target proteins before being scavenged by antioxidative defense mechanisms [15]. These H2O2 signals are transmitted to downstream signaling molecules and together modulate various metabolic and defense pathways in plants [9], [13], [31]–[32]. To study the effects of H2O2 on wheat seedlings and discover genes that are potentially involved in biotic responses, we set out to investigate the H2O2-triggered transcriptome profile changes in one PM-resistant (PmA) and two PM-susceptible lines (Cha and Han; see Materials and Methods; Figure 1A). As shown in Figure 1B, the growth of 9-day-old wheat seedlings in 10 mM H2O2 for 6 hours (h) did not cause evident changes in morphology, which was in contrast to the severely curled leaves of rice seedlings under similar conditions [15]. To confirm that the application of exogenous H2O2 indeed elevated the cytosolic H2O2 level, we determined the endogenous H2O2 concentration in the treated leaves. The results showed that the internal H2O2 level indeed increased by more than 200% over the control in all of the three wheat lines (Figure 1C). In contrast, the net photosynthetic rate (Pn) in all of the three wheat lines were decreased (Figure 1D). These measurements demonstrate that the current treatment condition was sufficient to cause physiological changes in the wheat cells. We then carried out an mRNA tag profiling analysis using RNA samples extracted from the seedling leaves. The two libraries derived from the 0 h and 6 h time points were named as follows: for PmA, PK and P6, respectively; for Han, HK and H6, respectively; and for Cha, CK and C6, respectively.
Figure 1

Effects of H2O2 treatment on wheat seedlings.

(A) PM response of the resistance line PmAm6/Beijing837 BC5F3 (PmA) and the susceptible lines Beijing837 (Bj), Hanxuan10 (Han), and Chadianhong (Cha) at 10 day after Bgt inoculation. (B) Phenotypes of 9-day-old wheat seedlings after 6 h 10 mM H2O2 treatment. (C) Accumulation of endogenous H2O2 in wheat seedling leaves. (D) Suppression of photosynthesis efficiency (Pn) in wheat seedling leaves by H2O2. For (C) and (D), the data are based on three biological replicates, each with ten plants.

Effects of H2O2 treatment on wheat seedlings.

(A) PM response of the resistance line PmAm6/Beijing837 BC5F3 (PmA) and the susceptible lines Beijing837 (Bj), Hanxuan10 (Han), and Chadianhong (Cha) at 10 day after Bgt inoculation. (B) Phenotypes of 9-day-old wheat seedlings after 6 h 10 mM H2O2 treatment. (C) Accumulation of endogenous H2O2 in wheat seedling leaves. (D) Suppression of photosynthesis efficiency (Pn) in wheat seedling leaves by H2O2. For (C) and (D), the data are based on three biological replicates, each with ten plants.

The mRNA tag raw data processing, gene association, and differential expression analysis

An average total of 11,841,476 high quality tags (clean tags) were obtained from each of the six libraries. After removing un-mappable reads, 9,201,359 tags were shown to have at least one match (with less than 1 bp mismatch considering the existence of homoeo-alleles) in the reference tag database generated from 274,754 PlantGDB sequences (Release 163b). The unmatched tags may arise from the absence of ESTs in the current datasbase or from sequencing errors, and were not pursued further. More than 30,000 genes that were tagged by 291,026 unambiguous tags for each library were further analyzed for differential expression analysis (see Materials and methods for the data processing details, Table S1), with an average number of tags per gene as 137.9. A total of 6,157, 6,876, and 3,268 transcripts were found to be differentially expressed between 0 h and 6 h H2O2 treatment in PmA, Han, and Cha respectively (p<0.001 and FDR<0.001). In PmA, the number of up-regulated transcripts (4,008) was nearly 2-fold that of the down-regulated transcripts (2,148), whereas the numbers of up- and down-regulated transcripts in Han (3,780 vs 3,095) and Cha (1,780 vs 1,487) were similar (Table S2). A BlastN search between tagged ESTs and sequences presented on Affymetrix wheat GeneChips showed that only a third of these differentially expressed transcripts were represented by the latter methodology, demonstrating that the high-throughput sequencing technology-based gene expression methodology provides more comprehensive information than the traditional array-based approach. A correlation analysis showed that the correlation coefficients (R 2) between libraries of the same wheat line were higher (>0.95) than those between different wheat lines, regardless whether the plants were treated with H2O2 or not. This result indicates significant variations in basal gene expression levels between the wheat lines of different genetic backgrounds (Table S3). This observation also cautions us to take all three of the lines into consideration when identifying genes that specifically respond to H2O2. A total of 28 differentially expressed genes between PK and P6, as measured in tag numbers, were then verified using qRT-PCR. The result showed >86% (24 out of 28 genes) consistency between the two methods (Table S4).

Functional classification of differential expression genes with consistent expression patterns in all three wheat lines

To reduce the potential variation derived from different genetic backgrounds, we firstly looked at the genes with consistent differential expression patterns in all three of the lines. A total of 260 genes fell in this category, with 135 genes up-regulated and 125 down-regulated (Figure 2A, Table S5). We then manually classified these genes using functional categories as reported [15]. The numbers of up- and down-regulated genes were significantly different (Fisher's exact test P<0.05) in the functional categories related to cell rescue/defense, photosynthesis, and carbohydrate metabolism (Figure 2B, 2C). For example, nearly a third (30 ESTs, or 29%) of the up-regulated genes were annotated as to be involved in cell rescue/defense, significantly more than the ones down regulated (9 ESTs, or 11%). In this category, a number of genes induced by H2O2 are clear components of defense responses, such as chitinase (Ta-1686165446), cytochrome P450 enzymes (Ta-98605, 137154, 127510), hypersensitive-induced response protein (Ta-1646165446, 265165443), late embryogenesis abundant group 1 protein (Ta-108515, 44767, 04365), wound-induced precursor (Ta-1412165445, 012207), and glycosyl hydrolases family protein (Ta-0877, 33326, 81876), whereas those down regulated are cellulase (Ta-64131), expansins (Ta-1865165444, 89717), and WAX2 (Ta-93863) genes (Table 1). In contrast, the expressions of genes for other two categories, i.e. photosynthesis and carbohydrate metabolism, were all repressed. Twelve genes (14%) were associated with photosynthesis including those for the light harvest center such as chlorophyll A-B binding proteins (Ta-0112922, 036375, 053588, 129259, 146211, 19895, 2098165442, 3264165442, 98245) and photosynthesis I and II reaction center proteins (Ta-2040165448, 132758). The consequent repression of carbohydrate metabolism genes included key sucrose synthesis genes such as beta-amylase (Ta-155349), trehalose-6-phosphate synthase (Ta-2355165445), and ribulose bisphosphate carboxylase small chain precursor (Ta-3117165446; Table S5).
Figure 2

Classification of differentially expressed genes in wheat seedlings under H2O2 treatment.

(A) Venn diagram analysis of the differentially expressed genes (fold change ≥2; tag number ≥12; P value<0.001) in PmA (PK/P6), Han (HK/H6), and Cha (CK/C6). Functional classification of 135 (104 annotated) up-regulated (B) and 125 (84 annotated) down-regulated genes (C) that are differentially expressed across all three lines. Wheat ESTs were annotated by their similarity to rice proteins. The significance between up and down regulated gene numbers was tested using Fisher's exact test. *p<0.05.

Table 1

H2O2-responsive ESTs annotated with cell rescue/defense functions.

PlantGDB EST No.Putative functionFold change (log2)a
PmAHanCha
Up-regulated
Ta-1686165446CHIT8 - Chitinase family precursor1.551.231.19
Ta-28626CSLF8 - cellulose synthase-like family F; beta1,3;1,4 glucan synthase2.921.714.16
Ta-98605cytochrome P450 72A14.028.211.85
Ta-137154cytochrome P4503.498.875.50
Ta-127510cytochrome P4502.732.051.57
Ta-760165445dehydrin7.507.757.17
Ta-1646165446hypersensitive-induced response protein2.833.432.13
Ta-265165443hypersensitive-induced response protein3.131.722.56
Ta-108515late embryogenesis abundant group 17.568.647.29
Ta-44767late embryogenesis abundant group 17.995.443.46
Ta-04365late embryogenesis abundant group 11.131.391.69
Ta-85498OsRCI2-5 - Putative low temperature and salt responsive protein1.893.001.97
Ta-65960pectinesterase inhibitor domain containing protein2.972.232.52
Ta-1137165445pectinesterase1.381.442.02
Ta-1864165443pleiotropic drug resistance protein6.678.952.33
Ta-33080thaumatin7.502.492.73
Ta-1412165445WIP3 - Wound-induced precursor2.772.161.40
Ta-012207WIP3 - Wound-induced precursor1.602.114.19
Ta-0109885glyoxalase family protein2.452.101.59
Ta-36034wound/stress protein1.091.571.53
Ta-95374jacalin-like lectin domain containing protein2.082.473.40
Ta-0877glycosyl hydrolases family 162.433.152.25
Ta-33326glycosyl hydrolases family 164.042.991.49
Ta-81876glycosyl hydrolases family 161.791.298.98
Ta-58864glycosyl hydrolases1.882.671.98
Ta-839165443alpha-1,4-glucan-synthase1.672.082.50
Ta-111845vignain precursor1.451.751.33
Ta-1262165444vignain precursor8.441.708.29
Ta-152385lysM domain containing protein3.212.171.54
Ta-92174BBTI6 - Bowman-Birk type bran trypsin inhibitor precursor6.577.353.97
Down-regulated
Ta-64131cellulase−1.58−2.20−1.39
Ta-117342cytochrome P450−1.47−2.49−4.38
Ta-1865165444expansin precursor−9.44−1.86−2.11
Ta-89717expansin precursor−8.16−6.44−8.11
Ta-0115846glycosyl hydrolases−1.62−2.85−2.40
Ta-111456late embryogenesis abundant D-34−1.97−3.20−1.89
Ta-1523165444Os1bglu5 - beta-glucosidase homologue, similar to G. max isohydroxyurate hydrolase−1.87−3.02−1.70
Ta-101667verticillium wilt disease resistance protein−2.15−1.61−8.05
Ta-93863WAX2−1.73−1.33−1.99

6 h TPM∶0 h TPM;

Ta, PUT-163b-Triticum_aestivum; PmA, PmAm6/Beijing837 BC5F3; Han, Hanxuan10; Cha, Chadianhong.

Classification of differentially expressed genes in wheat seedlings under H2O2 treatment.

(A) Venn diagram analysis of the differentially expressed genes (fold change ≥2; tag number ≥12; P value<0.001) in PmA (PK/P6), Han (HK/H6), and Cha (CK/C6). Functional classification of 135 (104 annotated) up-regulated (B) and 125 (84 annotated) down-regulated genes (C) that are differentially expressed across all three lines. Wheat ESTs were annotated by their similarity to rice proteins. The significance between up and down regulated gene numbers was tested using Fisher's exact test. *p<0.05. 6 h TPM∶0 h TPM; Ta, PUT-163b-Triticum_aestivum; PmA, PmAm6/Beijing837 BC5F3; Han, Hanxuan10; Cha, Chadianhong. In addition, four categories contain similar numbers of induced and repressed genes. These categories were signal transduction, lipid metabolism, redox homeostasis, and transport. Genes for signal transduction, for example, were comprised of 27 (26%) induced genes and 16 (19%) repressed ones (Table S5). These genes are of various signaling functions and encode putative calcium/calmodulin-dependent protein kinase (Ta-18711), calmodulin-related calcium sensor protein (CML) (Ta-095679), mitogen-activated protein kinase (MAPK) (Ta-60654), phosphatase 2C proteins (Ta-2846165449, 18275, 57939, 133196, 804165440, 3652165444), and AP2 transcription factors (Ta-51510, 29471), MYBs (Ta-089056, 056632, 24630), WRKY (Ta-064372), zinc-finger (Ta-9295), and bHLH (Ta-58552). Eleven genes were involved in lipid metabolism (9 up- and 2 down-regulated), including putative lipid transfer protein like (LTPs) family proteins (Ta-104587, 035988, 459165442, 66239), lipoxygenases (Ta-01383, 1776165447), fatty acid hyroxylase (Ta-45483), and acyl carrier protein (Ta-15083). There were nine genes (4 up- and 5 down-regulated) that were involved in redox homeostasis. The genes in this category encode dehydrogenases (Ta-21469, 31030), tropinone reductase 2 proteins (Ta-36863, Ta-060010), glutathione S-transferase (GST, Ta-66576), glutathione peroxidase (Ta-19785), peroxisomal membrane protein (Ta-121223), peroxidase precursor (Ta-010988), and thioredoxin (Ta-2210165449). There were seven genes that were involved in transport activity (2 up- and 5 down-regulated). The genes in this category encode MDR-like ABC transporter (Ta-2659165443), transmembrane amino acid transporter protein (Ta-151041), amino acid transporter (Ta-118377), mitochondrial carrier protein (Ta-01816), peptide transporter (Ta-149275), and trafficking particle complex subunit (Ta-95913). The genes in other category were mainly were involved in protein biosynthesis and degradation (Table S5). In addition, a group of 38 genes (15 up- and 23 down-regulated) were annotated to encode putative, hypothetical, or expressed proteins of unknown functions. Finally, we compared these H2O2-regulated genes with those differential genes from several other wheat microarray works. As shown in Table 2, a number of H2O2 regulated genes also participated in other biotic and abiotic stresses, such as heat, drought, and pathogen infections (leaf rust, yellow rust, and Fusarium pseudograminearum), confirming the diverse functions of H2O2 in wheat stress responses. There seem to be more common genes differentially expressed under our condition and under drought and heat conditions [33]. This may be attributed to the similar time points for sample collection in the two experiments.
Table 2

Co-regulation of H2O2-responsive wheat genes under other stress conditions as detected by the microarray analyses.

ArrayExpress or GEO accessionConditionTime courseFold change cut-offa Common genesReference
E-MEXP-1523Heat and drought1 h, 3 h, 24 h243Qin et al. 2008 [33]
TA23Drought11 DPA212April et al. 2009 [34]
GSE6227 (TA29) Puccinia triticina race MFBL (Lr34)36 h512Hulbert et al. 2007 [35]
TA11 P. striiformis f. sp. tritici (Yr39)12 h22Coram et al. 2008 [36]
TA24Magnaporthe isolate BR32 (adapted)24 h24Boyd 2009 [37]
GSE13346 (TA31) Fusarium pseudograminearum 1 day1.55Desmond et al. 2008 [38]
GSE13660 Blumeria graminis f. sp. Tritici 3 weeks1.51Chain et al. 2009 [39]
TA2 (E-GEOD-12508)Seedling root vs seedling leaf85Schreiber et al. 2009 [40]

As used by the authors or selected to make a dataset of a reasonable size.

As used by the authors or selected to make a dataset of a reasonable size.

Gene Ontology analysis suggests H2O2-enhanced transport activities in PmA

In barley and wheat, H2O2 can accumulate in the mesophyll cells during the early stage of the host-PM incompatible interaction, where it acts as an important signaling molecule to activate defense systems [11], [27]–[28]. Since PmA is resistant to Bgt isolate E09 while Han and Cha are susceptible, we studied in PmA H2O2 responding genes that were “subtracted” with their expression patterns in Han and Cha. We defined three classes of PmA-specific (PmA-H2O2) genes: class I comprises genes whose expression was induced in PmA (U) but suppressed (D) or remained unchanged (N) in both Han and Cha (UDD/UNN); class II includes genes that were suppressed in PmA (D) but induced or unchanged in Han and Cha (DUU/DNN); class III contains genes whose expression was not affected in PmA but changed in Han and Cha (NUU/NDD) (Table S6, S7). A total of 2,982 genes fell in these categories. Among them, nearly 60% of the genes (1,763) belong to class I genes (fold change ≥2, p<0.001, and FDR<0.001), while classes II and III genes comprise 28% (846) and 12% (373) respectively. Gene Ontology (GO) analysis showed that class I genes were mostly enriched in functions associated with the biological process (BP) terms “localization”, “response to stimulus”, and “metabolic process”, the molecular function (MF) terms “transporter activity”, “catalytic activity” and “binding”, and the cellular component (CC) terms “plasma membrane”, “vacuole” and “membrane-bounded organelle” (Table 3). A total of 112 genes were associated with “localization” including 43 transporters, 18 protein targeting proteins, and 11 cell vesicle transporters (data not shown), among which a total of 21 genes were annotated as related to the vesicle-mediated transport (Table S8). Genes with “transporter activity” were 17.5 fold more over-represented than in the Arabidopsis ATH1 Genome Array ATH1 (Table 3) that contains more than 22,500 probe sets representing approximately 24,000 genes. Transporter genes are known to be associated with defense responses by participating in the formation of multi-vesicular bodies and cell wall-associated paramural bodies that have been shown to be involved in secretion of building blocks for cell wall appositions [41]. These vesicle bodies not only arrest fungal penetration but also can cause hypersensitive cell death through blocking plasmodesmata. However, whether H2O2 enhanced membrane transport, as observed here in wheat, plays a role in pathogen defense or not may need further experimental investigation.
Table 3

Enriched GO terms among H2O2-responsive genes in the PM resistant line PmA.

GO termsPercent of total transcriptsH2O2 over representationP valueFDR
This StudyATH1
UNN/UDD (Class I)
Biological Process
localization0.120.052.46.90E-153.40E-12
response to stimulus0.180.111.69.40E-101.10E-07
metabolic process0.410.281.52.70E-103.50E-08
Molecular Function
transporter activity0.70.0417.51.80E-062.70E-04
catalytic activity0.40.261.52.10E-131.90E-10
binding0.40.31.31.60E-062.70E-04
Cell Component
plasma membrane0.20.0453.80E-402.10E-37
vacuole0.050.0152.30E-199.80E-18
membrane-bounded organelle0.40.228.20E-271.10E-24
DNN/DUU (Class II)
Biological Process
localization0.10.0521.20E-043.90E-03
cellular process0.50.31.74.30E-063.30E-04
metabolic process0.450.31.52.60E-073.30E-05
Molecular Function
electron carrier activity0.030.0074.38.80E-043.10E-02
catalytic activity0.40.31.32.50E-099.90E-07
binding0.40.31.31.40E-033.50E-02
Cell Component
chloroplast stroma0.060.006102.80E-141.10E-12
chloroplast thylakoid membrane0.050.0068.35.20E-127.50E-11
plasma membrane0.10.042.55.90E-095.30E-08
NUU/NDD (Class III)
Biological Process
cellular component biogenesis0.060.0233.00E-041.70E-02
response to stimulus0.20.122.80E-053.80E-03
metabolic process0.50.31.71.50E-052.60E-03
Molecular Function
catalytic activity0.50.31.75.30E-071.20E-04
Cell Component
chloroplast stroma0.060.006101.40E-073.80E-06
organelle membrane0.060.0236.10E-033.70E-02
plasma membrane0.10.042.58.10E-068.80E-05
GO analysis showed that class II genes were also enriched with “localization” and “metabolic process” (BP), “catalytic activity” and “binding” (MF), and “plasma membrane” (CC). The difference between the class II and the class I genes was the enrichment of the GO terms “chloroplast stroma” (CC, 10 fold enrichment) and “thylakoid membrane” (CC, 8.3 fold enrichment) in class II genes, suggesting significant effects on chloroplast functions by H2O2. The composition of the class III genes (up- or down-regulated only in both Han and Cha) was enriched with the BP term “cellular component biogenesis” and the CC term “chloroplast stroma” (10 fold enrichment). In contrast, the BP “localization” was not enriched among the genes of this category, demonstrating a difference in membrane transport activities between the PM susceptible and resistant lines. Therefore, these data point to possible roles of H2O2 in pathogen defense, with enhanced vesicle transportation as one of the possible approaches.

MapMan analysis showed H2O2-enhanced JA/Et signaling pathway in PmA

To study the possible roles of H2O2 responding genes in biotic response, we overlaid classes I, II, and III genes to the Arabidopsis GeneChip template in the MapMan program [42] and analyzed them in the biotic stress overview (Figure S1). Figure 3A summarizes 10 major categories of genes that were associated with biotic response according to the MapMan classification. Among these, the most abundant genes (102 ESTs) were involved in protein degradation of various functions such as subtilases, cysteine protease, aspartate protease, serine protease, metalloprotease, AAA type, ubiquitin E1, ubiquitin E2 and ubiquitin E3 (Table S9, S10). Ubiquitination-associated proteins have been shown to play important roles in plant-microbe interactions [43]. The second group of genes (75 ESTs) was associated with signaling including more than 30 receptor kinases, calcium/calmodulin dependent kinases, and ras-related proteins (Figure 3A; Table S10). Protein kinases are well known to play a central role in the pathogen recognition and subsequent activation of plant defense [44]. The biotic stress overview also displays genes involved in redox homeostasis (31 ESTs), secondary metabolism (31 ESTs), cell wall (23 ESTs), heat shock proteins (13 ESTs), pathogenesis-related proteins (PRs; 4 ESTs), and 31 ESTs that may be overlapping with additional abiotic responses.
Figure 3

Functional categories of MapMan biotic stress overview of differentially expressed genes specific to the PM resistant line PmA.

(A) An overview of genes involved in biotic stress. Genes of classes I, II, and III are as defined in the text. Numbers of down regulated genes are represented by negative numbers. Genes in each functional category were listed in Table S10. (B) List of genes involved in hormone signaling and their relative expression levels between 0 h and 6 h H2O2 treatment. The expression levels are represented as the log2 value of the mRNA tag number ratios between the two libraries.

Functional categories of MapMan biotic stress overview of differentially expressed genes specific to the PM resistant line PmA.

(A) An overview of genes involved in biotic stress. Genes of classes I, II, and III are as defined in the text. Numbers of down regulated genes are represented by negative numbers. Genes in each functional category were listed in Table S10. (B) List of genes involved in hormone signaling and their relative expression levels between 0 h and 6 h H2O2 treatment. The expression levels are represented as the log2 value of the mRNA tag number ratios between the two libraries. A total of 30 genes were involved in hormone signaling according to their annotation. As shown in Figure 3B, except for salicylic acid (SA), putative signaling genes for auxin, abscisic acid (ABA), JA, Ethylene (Et), and brassinolides (BR) were all affected by H2O2 among PmA-H2O2 genes. For ABA, Auxin, and BR, some genes were up regulated whereas others were down regulated. In contrast, all JA and Et signaling genes were up regulated, indicating that H2O2 is able to enhance JA/Et signaling in PmA (the two hormones often work together) [45]–[47]. The 12 putative JA/Et signaling genes encode lipoxygenases (LOXs, Ta-07168, 15852, 2498165446), lipozygenase (Ta-108080), allene oxide synthase 2 (AOS2, Ta-134687), jasmonic acid carboxyl methyltransferase (JMT, Ta-89552), ethylene receptors (ETRs, Ta-2002165441, 124905), esterase (Ta-0103737), ethylene response factor (ERF, Ta-147978), and endothelial differentiation-related factors (Ta-3023, 56281; Figure 3B). Six of the above 12 JA/Et genes (Ta-2498165446, 108080, 134687, 89552, 2002165441, 147978) were selected for qRT-PCR confirmation and, as expected, were all induced by H2O2 (Table S11). Besides, two additional JA biogenesis-related genes Ta-80972 and Ta-04807 were also confirmed by qRT-PCR to be up regulated by H2O2 (Table S11). Ta-80972 encodes a cytochrome P450 that is highly similar to a rice allene oxide synthase (AOS), a key enzyme in the oxylipin pathway leading to AOS-derived jasmonates, while Ta-048072 encodes the enzyme 12-oxophytodienoate (OPDA) reductase that is involved in JA biosynthesis by catalyzing the reduction of 10, 11-double bonds of OPDA to yield 3-oxo-2-(2′-pentenyl)-cyclopentane-1-octanoic acid (OPC-8:0). These results suggest that it is not only the signaling, but also the biogenesis of JA that may have been enhanced in the H2O2-treated wheat.

Co-regulation of H2O2 responsive genes by Bgt inoculation in PmA

Several studies demonstrate that H2O2-induced genes can also be regulated by pathogen infections, including powdery mildew [18], [29]–[30]. To identify H2O2 regulated genes that may also respond to wheat Bgt infection, 19 PmA-H2O2 ESTs that were annotated as related to defense response were selected for expression study using qRT-PCR assay between PmA and its susceptible isogenic line Beijing837 (Bj; Table 4). Eight of these genes were found to have similar expression patterns between H2O2 treatment and Bgt inoculation. Among them, five were class I genes including Ta-048072, 147978, 019566, 92123, and 02061 that encode 12-oxophytodienoate reductase (JA pathway), ethylene-responsive transcription factor (Et pathway), calcium/calmodulin dependent kinases (signaling), heavy metal-associated domain containing protein (cell rescue/defense), and stripe rust resistance Yr10-associated (cell rescue/defense) respectively. In the mean time, two class II genes Ta-138137 and Ta-2126165445 that respectively encode a helix-loop-helix DNA-binding domain containing protein (signaling) and an ABC transporter family protein (transport) were co-suppressed by both treatments. These H2O2 and Bgt co-regulated genes may be involved in the PM responses. The last EST Ta-0109540 represents a gene encoding a fatty acid desaturase (named TaFAD) and is a class III gene that was significantly repressed by H2O2 in the two PM susceptible lines Han and Cha (Table 4). In PmA, the fold change of the TaFAD expression under 0 and 6 h H2O2 treatments was calculated as close to 0.5, but was not significant under our statistic threshold (p<0.001;). qRT-PCR assay showed that under Bgt inoculation, TaFAD was significantly (p<0.05) repressed by Bgt infection in the PM susceptible isogenic line Bj (6 h∶0 h ratio 0.25±0.08) when the change in PmA was marginal (6 h∶0 h ratio 0.53±0.09). A more detailed analysis over a 48 h Bgt inoculation course showed that TaFAD was indeed significantly repressed by Bgt infection in Bj (p<0.05), whereas in PmA the modest down regulation was statistically insignificant (Figure 4). These data demonstrate that the capability to maintain a constant expression level of TaFAD might be essential for PM resistant wheat lines.
Table 4

Expression patterns of selected H2O2-responsive genes under Bgt inoculation in the near isogenic lines PmA and Bj.

PlantGDB ESTAnnotationClassH2O2 treatment Bgt inoculation
PmAa Hana Chaa PmAb PmAb Bjb
Ta-048072c 12-oxophytodienoate reductaseI 3.72 1.841.33 3.15±1.07 d 2.95±0.44 14±2.21
Ta-18253SGS domain containingI12.211.231.065.2±0.130.08±0.020.13±0.01
Ta-147978Ethylene-responsive transcription factorI 2.19 0.850.91 2.11±0.07 2.5±0.21 2.35±0.49
Ta-3577165441Acyl-CoA thioesterase 2I2.030.440.342.3±0.180.34±0.060.56±0.21
Ta-1259165445Serine/threonine- kinase PRP4I2.970.400.012.83±0.151.57±0.591.23±1.01
Ta-129760Ethylene-responsive element-bindingI3.010.370.265.33±1.921.08±0.710.92±0.27
Ta-019566CAMK_KIN1/SNF1/Nim1_like.38 - CAMKI 3.6 0.330.15 2.37±0.31 15.8±4.21 21.9±3.72
Ta-1676165442Solute carrier family 35 member B1I2.310.320.353.23±1.150.57±0.230.67±0.32
Ta-92123Heavy metal-associated domain containingI 2.73 0.310.19 2.78±0.21 2.53±0.12 2.36±1.09
Ta-99839Peptide transporter PTR2I3.710.210.002.01±0.270.59±0.220.45±0.12
Ta-02061Stripe rust resistance Yr10I 5.54 0.010.00 3.55±0.43 4.47±1.03 4.92±1.23
Ta-121165441F-box/LRR-repeat protein 14II0.01163.1263.20.17±0.012.13±1.111.85±0.24
Ta-4496Hcr2-5DII0.014.416.880.23±0.061.62±0.521±0.15
Ta-099263Thioesterase family proteinII0.125.354.890.32±0.041.96±1.120.71±0.11
Ta-1039165449OsIAA12 - Auxin-responsive Aux/IAA gene family memberII0.244.44156.50.12±0.091.26±0.440.9±0.33
Ta-138137Helix-loop-helix DNA-binding domain containing proteinII 0.37 19.29324.0 0.29±0.05 0.02±0.02 0.06±0.04
Ta-2126165445ABC transporter family proteinII 0.37 2.132.79 0.24±0.13 0.4±0.21 0.28±0.22
Ta-0109540Fatty acid desaturaseIII0.5e 0.23 0.07 1.25±0.22e 0.53±0.09e 0.25±0.08
Ta-3709Homeobox and START domains containingIII1.300.010.011.52±0.332.05±0.051.94±5.63

Fold change detected by mRNA tag profiling (6 h TPM∶0 h TPM);

Fold change determined by real time PCR (6 h∶0 h);

Ta, PUT-163b-Triticum_aestivum;

Standard error shown here indicates three biological repeats; Bolded numbers represent co-activation or co-suppression;

indicates that the change is statistically insignificant.

Figure 4

Response of TaFAD to the Bgt treatment.

Expression patterns of TaFAD in the PM resistant (PmA) and the susceptible (Bj) near isogenic lines under Bgt inoculation as detected by qRT-PCR. ** p<0.001; * p<0.05.

Response of TaFAD to the Bgt treatment.

Expression patterns of TaFAD in the PM resistant (PmA) and the susceptible (Bj) near isogenic lines under Bgt inoculation as detected by qRT-PCR. ** p<0.001; * p<0.05. Fold change detected by mRNA tag profiling (6 h TPM∶0 h TPM); Fold change determined by real time PCR (6 h∶0 h); Ta, PUT-163b-Triticum_aestivum; Standard error shown here indicates three biological repeats; Bolded numbers represent co-activation or co-suppression; indicates that the change is statistically insignificant. In Arabidopsis and rice, FADs have been shown to be involved in disease resistance by modulating JA and SA signaling [48]–[49]. To study whether TaFAD may play a role in wheat PM resistance, we silenced TaFAD in PmA using virus-induced gene silencing (VIGS) technique. A 231-bp fragment comprising the 3′ end of the ORF and part of the 3′ UTR sequence was used to increase the specificity, [50]–[51]. The results showed that down-regulation of TaFAD caused the compatibility between Bgt and PmA (Figure 5). The reduction of TaFAD expression resulted in the growth of Bgt spores on the leaves of the BSMV∶TaFAD plants and enhanced PM penetration efficiency (PE, 28% vs. 0%; Table S12). To ensure that no additional genes were affected by “off target” silencing, we also tested the expression level of TaFAD6, the next closest gene of TaFAD in wheat, and indeed no co-suppression was observed (Figure 5A). These data thus suggest that the constant expression of TaFAD is indeed required for the PM resistance in PmA. Since FADs have been shown to be involved in disease resistance by modulating JA and SA signaling, we then investigated wheat genes homologous to functionally characterized rice marker genes in JA and SA signaling pathways in these VIGS plants. The SA-signaling gene used was the acidic pathogenesis-related protein gene PR1a (Table S13), whereas the JA-signaling genes encode a lipoxygenase (LOX, Ta-2498165446), an allene oxide synthase 2 (AOS2, Ta-134687), and a pathogenesis-related protein PR1b which acts in both the JA- and SA-dependent pathways [52]–[53]. As shown in Table S13, the JA pathway related genes, Ta-134687 (AOS2), Ta249865446 (LOX), and Ta-141027 (PR1b) were significantly down-regulated in BSMV∶TaFAD plants, whereas the expression level of PR1a remained unchanged. Therefore, we deduce that the loss of PM resistance in BSMV∶TaFAD plants was likely caused by the failure to maintain proper JA signaling. BSMVHSP90 was used as a positive control for successful silencing of the disease resistance system because HSP90 is essential for the plant hypersensitive reaction (HR) to diverse pathogens as shown by previous studies [50]–[51], [54]–[56]. In BSMV∶TaHSP90 VIGS plants, AOS2 and LOX were significantly up-regulated, whereas PR1a were down-regulated (Table S13), suggesting different regulatory modes of TaFAD and TaHSP90. Overall, these observations suggest the potential modulation of TaFAD on JA signaling during wheat powdery mildew infection, which deserves further investigation.
Figure 5

Virus Induced Gene Silencing (VIGS) assay of TaFAD.

(A) Significant down regulation of TaFAD (left) in PmA plants by BSMV∶TaFAD inoculation. The expression level of another fatty acid desaturase gene TaFAD6 (right) was not affected. (B) Susceptibility of PmA leaves to Bgt inoculation when TaFAD was “silenced” by VIGS. Bejing837 (Bj) was used as a control for successful Bgt infection; Mock, GKP buffer; BSMV∶GFP, empty vector-like control; BSMV∶HSP90, positive control for VIGS; At least fifteen VIGS plants were tested for each vector. (C) Microscopic observation of leaves from VIGS plants after 5 days of Bgt inoculation showing elongated secondary hyphae in VIGS plants. Short bars represent 10 µm. Student's t test p value *<0.05.

Virus Induced Gene Silencing (VIGS) assay of TaFAD.

(A) Significant down regulation of TaFAD (left) in PmA plants by BSMV∶TaFAD inoculation. The expression level of another fatty acid desaturase gene TaFAD6 (right) was not affected. (B) Susceptibility of PmA leaves to Bgt inoculation when TaFAD was “silenced” by VIGS. Bejing837 (Bj) was used as a control for successful Bgt infection; Mock, GKP buffer; BSMV∶GFP, empty vector-like control; BSMVHSP90, positive control for VIGS; At least fifteen VIGS plants were tested for each vector. (C) Microscopic observation of leaves from VIGS plants after 5 days of Bgt inoculation showing elongated secondary hyphae in VIGS plants. Short bars represent 10 µm. Student's t test p value *<0.05.

Discussion

In plant cells, H2O2 plays a dual role as a toxic by-product of normal cell metabolism and as a regulatory molecule in stress perception and signal transduction [15]. A complex interplay between H2O2 and other signaling molecules is known to exist in plant cells, which explains the versatility of H2O2 functions in different scenarios. However, the knowledge about the transcriptome changes by exogenous H2O2 treatment in wheat is limited, especially the knowledge about the H2O2-trggered defense related genes and signaling pathways. In this work, we performed a mRNA tag analysis of the wheat seedling transcriptome after 6 h 10 mM H2O2 treatment using the next-generation sequencing technology. We found that H2O2 caused differential expression of genes associated with important biological processes such as cell rescue/defense responses, photosynthesis, and carbohydrate metabolism. Further analysis in the PM resistant wheat line provided additional clues about the H2O2-triggered molecular pathways and the possible links of H2O2 signaling and Bgt defense.

The effects of exogenous H2O2 on gene expression profiles in wheat

In rice, the exposure of seedlings to exogenous H2O2 caused leaves to curl severely [15]. By contrast, the wheat seedlings did not exhibit evident morphological changes after growth in H2O2 solution for 6 hours. Consistent with this, we found only three percent (9 out of 260) differentially expressed genes related to redox detoxification in the transcripts with identical expression patterns in all three wheat lines, suggesting that dramatic oxidative stress had not taken place under the current experimental condition. Despite this, exposure of wheat seedling roots to H2O2 stress did result in increased endogenous H2O2 accumulation with impaired photosynthesis in wheat leaves. A total of 12 genes were associated with the photosynthetic process and were all down-regulated, together with 6 carbohydrate metabolism genes, indicating that H2O2 can effectively repress photosynthesis and related carbohydrate metabolism in wheat. Several studies show that exogenous H2O2 can initiate signal transduction processes in treated plants that render them to acquire tolerance to various abiotic and biotic stresses. In Arabidopsis, for example, genes responding to exogenous H2O2 are also involved in wilting, UV irradiation, and elicitor challenge response, indicating that H2O2 can mediate cross-tolerance toward other stresses [12]. Extra H2O2 caused by high light in a catalase-deficient Arabidopsis mutant can regulate the transcription of two clusters of genes that encode heat shock proteins (HSPs) known to be involved in stress responses [14]. Similarly, treatment of winter wheat with low concentrations of H2O2 and catalase inhibitor may enhance its tolerance to low temperature [57]. We found significant activation of putative cell rescue/defense genes than repression in the same functional category, indicating that, as in a number of other studies, H2O2 can stimulate defense responsive genes in wheat. Further comparative analysis showed that H2O2-responsive genes also participated in the response to other biotic and abiotic stresses, such as heat, drought and pathogen infections, indicating that at least some of these genes were indeed involved in defense responses.

The characteristics of H2O2 responses in the powdery mildew resistant wheat

The accumulation of H2O2 in the mesophyll cells has been observed in barley and wheat during the early stage of the host-PM incompatible interaction, indicating that H2O2 works as an important signaling molecule in defense system activation [11], [27]–[28]. Two events were observed during this process: the accumulation of vesicles and vesicle-like materials at the cells in contact with microorganisms [41], [58] and the subsequent hypersensitive response (HR) in the epidermis cells directly nearby the penetration sites [11], [27]. We studied the differential gene responses in the PM resistant line PmA by GO enrichment analysis and found the “localization” was the most enriched BP term, together with the most enrichment GO MF term “transporter activity” and GO CC term “Plasma membrane” and “vacuole”. The enrichment of these GO terms suggest that H2O2 enhanced the membrane trafficking, supporting the hypothesis that trafficking of membrane-bound solutes, such as H2O2, is essential not only for signaling but also for accommodating the cellular volume changes associated defense response [59]. It is nowadays impossible to discuss ROS and redox signaling in plants without considering plant hormones and related signal molecules because these compounds act together with redox-modulated signaling pathways to process and transmit environmental cues into appropriate responses. Compounds strongly interacting with redox processes include classical hormones such as auxin, ethylene, and ABA, as well as defense-related signals such as SA and JA [60]–[65]. JA is synthesized from α-linolenic acid in chloroplast membranes. The three chloroplast-located enzymes 13-lipoxygenase (13-LOX), 13-allene oxide synthase (13-AOS), and the AOC catalyze the first half of JA biosynthesis up to the intermediate product cis-(+)-12-oxophytodienoic acid (OPDA). The Arabidopsis AOS promoter is activated by a variety of signals including jasmonic acid, wounding, OPDA, and SA, indicating that regulation of the AOS gene might exert a major control on JA signaling [66]. As for OPDA, it alone is sufficient to induce defense responses. The methylation of jasmonic acid to MeJA is catalyzed by an S-adenosyl-L-methioninejasmonic acid carboxyl methyltransferase (JMT) in Arabidopsis. The expression of JMT itself is sufficient to induce some JA-dependent responses. In our study, we simultaneously detected the up-regulation of JA signaling and biogenesis genes including Ta-80972 (AOS), Ta-048072 (OPDA), Ta-07168, 15852, 2498165446 (LOX), and Ta-89552 (JMT). We also detected the activation of an ethylene receptor (ETR, Ta-2002165441) and an ethylene-responsive transcription factor (ERF, Ta-147978) by H2O2 treatment in PmA. It has been shown that JA, alone or often in combination with Et, mainly works in defense to insect wounding and necrotrophic pathogen attack [45]–[47]. Our results suggest that H2O2 may play a role in biotic stress by enhancing JA and/or Et signaling pathways. Whether these responsive genes also play any function in response to the infection of the biotrophic pathogens such as wheat PM is worth further investigation.

The potential links between H2O2 signaling and Bgt defense

The recent identification of a serine/threonine kinase gene, Stpk-V as a PM resistant gene in wheat, provides further evidence that H2O2 and Bgt co-regulated genes can be involved in disease resistance [30]. This gene however was not detected in our work, probably because it was an introgressed gene from Haynaldia villosa and did not exist in the wheat line used here. In our study, eight genes exhibited similar expression patterns under H2O2 treatment and Bgt inoculation. These representative genes belong to various functional categories such as cell rescue/defense, signaling, JA/Et signaling pathways, transport, and lipid metabolism, and may participate in the PM defense. We show that the H2O2 responsive fatty acid desaturase gene TaFAD is indeed involved in the PM resistance, indicating that, as in other plants, fatty acids play important roles in wheat pathogen defense. In Arabidopsis, oleic acid (18∶1) has been implicated to participate in SA and JA-mediated defense pathways [48], [67]–[70]. It has been shown that suppressing the gene for stearoyl acyl carrier protein fatty acid desaturase (SACPD) enhances the resistance of Arabidopsis (SSI2), soybean, and rice to multiple pathogens [48]–[49], [70]. In addition, another fatty acid desaturase gene FAD7 is required for the accumulation of the systemic acquired resistance-inducing activity [71], suggesting that different FAD family members may play distinct roles in plant defense. Therefore, the role of TaFAD in wheat PM resistance is not accidental since this gene is significantly repressed by both H2O2 and Bgt in the PM susceptible lines Han, Cha and Bj while maintained a relative stable expression level in the PM resistant line PmA. The observation that silencing of TaFAD causes the loss of PM resistance in PmA and the significant down-regulation of the JA signaling pathway supports the idea that the maintenance of TaFAD function is crucial for the defense response, probably due to its potential regulatory role in modulating JA signaling. Whether or how H2O2 regulates the TaFAD expression in PmA during Bgt infection needs further investigation.

An overview of the transcriptome changes caused by exogenous H2O2 in wheat

Several issues that are intrinsic to the hexaploid nature of the bread wheat need to be taken into consideration. For example, the mRNA tag numbers should represent the collective levels of the three homoeologous alleles if they were all expressed. Although consensus primers can be applied during qRT-PCR when sequences for all three alleles are available, allele-specific studies will result in more precise conclusions. Despite this, our analysis for the first time provides a global insight about the transcriptomic response to exogenous H2O2 treatment in wheat seedlings. Combining our observations and the previous studies, we present in Figure 6 several major cellular and metabolic processes in response to H2O2 treatment in wheat. First, the application of exogenous H2O2 may increase the cytosolic H2O2 level causing the disruption of the redox homeostasis that can be relayed by MAPKs and type-2C protein phosphatase (PP2C) or perceived by the chloroplasts where both photosynthesis and carbohydrate metabolism are consequently suppressed. Second, the MAPK cascade and/or the retrograde signals from the chloroplast are then transmitted into the nucleus where the activation of transcription factors may initiate defense related genes. Third, the enhanced JA and Et signaling, accompanied with largely up regulated lipid metabolism (which may provide needed JA precursors), may positively regulate genes for defense response where H2O2-enhanced trafficking of membrane-bound solutes may also play an important role. Finally, we propose that possible links of H2O2 signaling and Bgt defense may exist in the processes of signaling, transport, JA/Et pathway, and lipid metabolism (indicated by stars). Genes involved in these aspects of H2O2 response may deserve further study for their roles in the PM resistance in wheat.
Figure 6

An overview of the molecular pathways and cellular processes in response to the H2O2 treatment in the bread wheat.

Displayed are common molecular pathways among all three wheat lines studied that may represent basal cellular response under exogenous H2O2 treatment, except for the JA/Et pathway which is specific for PmA. Pathways labeled by stars are postulated to be also involved in biotic responses according to their enrichment in PmA. MAPK, mitogen-activated protein kinase; ROS, reactive oxygen species; AOS, allene oxide synthase; LOX, lipoxygenase; 12-OPDA, 12-oxophytodienoate; ETR ethylene receptor; ERF, ethylene-responsive transcription factor; JA, jasmonic acid; ET, ethylene; CAB proteins, chlorophyll A–B binding proteins; Lea proteins, late embryogenesis abundant group 1 proteins; LTPLs, lipid transfer protein like family proteins; ER, endoplasmic reticulum.

An overview of the molecular pathways and cellular processes in response to the H2O2 treatment in the bread wheat.

Displayed are common molecular pathways among all three wheat lines studied that may represent basal cellular response under exogenous H2O2 treatment, except for the JA/Et pathway which is specific for PmA. Pathways labeled by stars are postulated to be also involved in biotic responses according to their enrichment in PmA. MAPK, mitogen-activated protein kinase; ROS, reactive oxygen species; AOS, allene oxide synthase; LOX, lipoxygenase; 12-OPDA, 12-oxophytodienoate; ETR ethylene receptor; ERF, ethylene-responsive transcription factor; JA, jasmonic acid; ET, ethylene; CAB proteins, chlorophyll A–B binding proteins; Lea proteins, late embryogenesis abundant group 1 proteins; LTPLs, lipid transfer protein like family proteins; ER, endoplasmic reticulum.

Materials and Methods

Plant Growth and Treatments

Am6 is a synthetic amphiploid derived from a cross between Triticum durum (AABB) accession DR147 and Aegilops tauschii (DD) accession Ae39 [72]. The line used for this study (PmA) is a BC5F3 progeny between Am6 and the cultivar Beijing837 with a novel powdery mildew resistant gene. PmA is resistant to the popular Blumeria graminis f. sp. tritici (Bgt) race No. 15 in the Beijing area, whose virulence type is E09, while Beijing837 is susceptible. Hanxuan10 is a drought tolerant cultivar and Chadianhong is known to be salt tolerant, both of which are susceptible to the Bgt race No. 15. Wheat seedlings were grown in a chamber at 22°C and a photoperiod of 16 h (60 µmol m−2 s−1 photon flux density). For H2O2 treatment, 9-day-old seedlings were transferred to a Hoagland's solution containing 10 mM H2O2. For PM inoculation, the Bgt isolate E09 conidia on heavily diseased leaves were shaken off over a settling tower onto the wheat primary leaves, harvested at 0 and 6 h after treatment, and stored at −80°C until use. Inoculated plants were checked later to ensure proper development of powdery mildew on the leaves of the susceptible control.

Measurements of Photosynthesis Efficiency and H2O2 Levels

Net photosynthetic rates of the first and second leaves of wheat seedlings were measured using a LI-COR 6400 portable gas analysis system with a light-emitting diode light source (LI-COR Inc., Lincoln, NE), with seven duplicates. H2O2 accumulation in wheat leaves was measured according to a previously described method [73]. Briefly, leaves were grounded to a fine powder and extracted with 5 mM titanium sulfate. The oxidation of titanium sulfate was recorded by reading the absorbance at 410 nm. The readings were converted to corresponding concentrations using a standard calibration plot.

Tag Library Construction and the Initial Bioinformatic Processing

Wheat seedling leaves at 0 h and 6 h after H2O2 treatment were used for mRNA tag library construction, as described by [74]. Sequencing was performed by Beijing Genomics Institute, Shenzhen, China (http://sequencing.genomics.com.cn/). For the tag number counting, a reference tag database was generated using 274,754 PlantGDB sequences (Release 163b). For convenience, the prefix “PUT-163b-Triticum_aestivum” was replaced by a shorter one, “Ta”. A total of 217,691 sequences were found to have GATC sites, which generated a total of 425,312 reference tags, with340,097 unambiguous tags (79.96%). The tags derived from wheat mRNA libraries were counted for redundancy and, therefore, copy numbers, using in-house Perl scripts. Numbers of all the tags on one EST or assembly were used to represent its expression levels.

mRNA Tag Data Analysis

Tag numbers for each gene were normalized with the total number of tags in the corresponding library. The statistical difference between corresponding genes in differently libraries was measured using a previously described method [75]. Expression level changes were calculated using the log2 ratios of transcripts per million mapped reads (TPM) between conditions (P6/PK, H6/HK, C6/CK). The sets of genes were selected for further analysis after the following filters: (1) TPM log2 ratios were either ≥1 for up regulation or ≤1 for down regulation; (2) the copy numbers for each condition should be ≥12; (3) the FDR for differential expression was set to be <0.001. For convenience, transcripts with zero detected tags in one condition were arbitrarily designated as 0.01 TPM and marked, whereas others were normalized using the total tag numbers in one library (minimum 12 copies for tags to be included for analysis). For MapMan analysis, wheat EST sequences were compared using Blastx against Arabidopsis sequences represented on Affymetrix GeneChips. Fold change numbers were then transferred to the best Arabidopsis matches which were mapped to the Arabidopsis template in the MapMan program for display [42]. The manual functional classification of genes followed Wan and Liu [15]. Gene Ontology enrichment analysis was performed using Arabidopsis proteins as templates at AGRIGO website (http://bioinfo.cau.edu.cn/agriGO/).

Virus Induced Gene Silencing Assays

The plasmids utilized in these experiments were based on the constructs described by Holzberg et al. [76]. The virus-induced gene silencing of TaFAD (PlantGDB EST Ta-0109540) and TaHSP90 (TaHSP90.3-D1, GQ240789.1; TaHSP90.3-A1, GQ240787.1) [51] was performed using a δ RNA vector, pSS031-1. TaHSP90 was used as a positive control for powdery mildew resistance. A 231-bp fragment of TaFAD was amplified from the plasmid pTaFAD with the forward primer, CTA, and the reverse primer, CTA. A 355-bp fragment of TaHSP90 was amplified from the plasmid pTaHSP90 with the forward primer, CTA, and the reverse primer, CTA. The underlined bases are the NheI restriction sites. Plants were infected with BSMV using a modified protocol [50], [76]. Briefly, capped transcripts were prepared from three linearized plasmids that contain the tripartite barley stripe mosaic virus (BSMV) genome using the mMessage mMachine T7 in vitro transcription kit (Ambion, Austin, TX), following the manufacturer's protocol. These in vitro transcription reactions typically resulted in a final concentration of 1 to 1.5 mg/ml of RNA.

Bgt-wheat Interaction Assays

The method to estimate Bgt infection efficiency is largely in accord to Li et al. [11]. Wheat leaves of three centimeters were aligned on the surface of 0.5% agarose with 50 mg/L 2-[(4-chlorophenenyl)methyl]-1H-benzimidazol and sprayed with Bgt spores (isolate E09) using an air compressor and nozzle. After 5 days, the leaves were bleached with trichloroacetic acid (1.5 g L−1) in ethanolchloroform (4∶1 v/v), stained with aniline blue (1 g L−1), and observed under a light microscope for the formation of elongated secondary hyphae. A segment of the same leaf was kept at −80°C for mRNA extraction and subsequent quantitative real time PCR (qRT-PCR). For VIGS plants, newly emerging leaves of 14 d after the viral inoculation (usually the fourth leaves) were used. At least 8 VIGS plants were tested for each VIGS vector with three independent biological replicates.

Measurements of Gene Expression Levels by qRT-PCR

For mRNA tag data and gene silencing confirmation, RNA was extracted using Trizol reagent (TIANGEN, China) and qRT-PCR experiments were performed on an ABI Prism® 7300 (Applied Biosystems, USA). The number of transcripts was normalized with the constitutively expressed glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA [77]–[78], which was tested as the most stable reference gene for the wheat seedling powdery mildew infection assay (data not shown).. The qRT-PCR assays were repeated three times, each with three biological replicates. To test the silencing efficiency, qRT-PCR primers were designed as: TaFAD forward, TACGTCGAGCCCGAGGACCG; TaFAD reverse, TGCCCCAAAATGCCCTCTTGCT; TaFAD6 (Ta-1294165443) forward, GGGAGAAGTCACCACCAA; and TaFAD6 reverse, GACCGAAAGCATACGAAG. RNA from the BSMV∶GFP-treated plants was used as controls. MapMan biotic overview of PmA-specific H2O2 responding genes. (TIF) Click here for additional data file. The statistics of the mRNA tags from the six wheat libraries in this study. (XLS) Click here for additional data file. The statistics of the differentially expressed transcripts in response to H2O2 treatment in the wheat lines PmA, Han, and Cha. (XLS) Click here for additional data file. The correlation coefficients (R) of the mRNA tag numbers for genes shared among different libraries. (XLS) Click here for additional data file. qRT-PCR validation of 28 differentially expressed genes as detected by the miRNA tag analysis. (XLS) Click here for additional data file. The full list of genes with the same differential expression patterns in all three wheat lines under H2O2 stress. (XLS) Click here for additional data file. Classification of H2O2 responsive genes with specific expression patterns in PmA. (XLS) Click here for additional data file. The full list of 2,982 PmA-specific differentially expressed ESTs under H2O2 treatment. (XLS) Click here for additional data file. Representative H2O2 regulated genes associated with the enriched GO term vesicle-mediated transport from the class I PmA specific genes. (XLS) Click here for additional data file. Functional categories of PmA-specific H2O2 responding genes from the MapMan biotic stress overview. (XLS) Click here for additional data file. Functional classification of 328 PmA-specific ESTs from the biotic overview in MapMan. (XLS) Click here for additional data file. qRT-PCR confirmation of JA/Et signal pathway genes under H2O2 treatment. (XLS) Click here for additional data file. Blumeria graminis f. sp. tritici penetration efficiency (PE) in the VIGS plants. (XLS) Click here for additional data file. Expression patterns of putative JA and SA signaling pathway related genes in the BSMV∶FAD and BSMVHSP90 plants. (XLS) Click here for additional data file.
  72 in total

1.  Oxidative stress increased respiration and generation of reactive oxygen species, resulting in ATP depletion, opening of mitochondrial permeability transition, and programmed cell death.

Authors:  Budhi Sagar Tiwari; Beatrice Belenghi; Alex Levine
Journal:  Plant Physiol       Date:  2002-04       Impact factor: 8.340

2.  Development of wheat near-isogenic lines for powdery mildew resistance.

Authors:  Ronghua Zhou; Zhendong Zhu; Xiuying Kong; Naxin Huo; Qingzhen Tian; Pei Li; Cuiyun Jin; Yuchen Dong; Jizeng Jia
Journal:  Theor Appl Genet       Date:  2005-01-26       Impact factor: 5.699

3.  Virus-induced gene silencing-based functional characterization of genes associated with powdery mildew resistance in barley.

Authors:  Ingo Hein; Maria Barciszewska-Pacak; Katarina Hrubikova; Sandie Williamson; Malene Dinesen; Ida E Soenderby; Suresh Sundar; Artur Jarmolowski; Ken Shirasu; Christophe Lacomme
Journal:  Plant Physiol       Date:  2005-07-22       Impact factor: 8.340

4.  H2O2 in plant peroxisomes: an in vivo analysis uncovers a Ca(2+)-dependent scavenging system.

Authors:  Alex Costa; Ilaria Drago; Smrutisanjita Behera; Michela Zottini; Paola Pizzo; Julian I Schroeder; Tullio Pozzan; Fiorella Lo Schiavo
Journal:  Plant J       Date:  2010-03-02       Impact factor: 6.417

Review 5.  Plant responses to abiotic stresses: heavy metal-induced oxidative stress and protection by mycorrhization.

Authors:  Andres Schützendübel; Andrea Polle
Journal:  J Exp Bot       Date:  2002-05       Impact factor: 6.992

6.  Evidence for Chilling-Induced Oxidative Stress in Maize Seedlings and a Regulatory Role for Hydrogen Peroxide.

Authors:  T. K. Prasad; M. D. Anderson; B. A. Martin; C. R. Stewart
Journal:  Plant Cell       Date:  1994-01       Impact factor: 11.277

7.  Comparative proteomics analysis reveals an intimate protein network provoked by hydrogen peroxide stress in rice seedling leaves.

Authors:  Xiang-Yuan Wan; Jin-Yuan Liu
Journal:  Mol Cell Proteomics       Date:  2008-04-11       Impact factor: 5.911

8.  Wheat blast: histopathology and transcriptome reprogramming in response to adapted and nonadapted Magnaporthe isolates.

Authors:  Hale A Tufan; Graham R D McGrann; Andreas Magusin; Jean-Benoit Morel; Lucie Miché; Lesley A Boyd
Journal:  New Phytol       Date:  2009-07-23       Impact factor: 10.151

9.  MAPMAN: a user-driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes.

Authors:  Oliver Thimm; Oliver Bläsing; Yves Gibon; Axel Nagel; Svenja Meyer; Peter Krüger; Joachim Selbig; Lukas A Müller; Seung Y Rhee; Mark Stitt
Journal:  Plant J       Date:  2004-03       Impact factor: 6.417

10.  Transcriptional profiling in response to terminal drought stress reveals differential responses along the wheat genome.

Authors:  Alessio Aprile; Anna M Mastrangelo; Anna M De Leonardis; Gabor Galiba; Enrica Roncaglia; Francesco Ferrari; Luigi De Bellis; Luana Turchi; Giovanni Giuliano; Luigi Cattivelli
Journal:  BMC Genomics       Date:  2009-06-24       Impact factor: 3.969

View more
  20 in total

1.  The FATTY ACID DESATURASE2 Family in Tomato Contributes to Primary Metabolism and Stress Responses.

Authors:  Min Woo Lee; Carmen S Padilla; Chirag Gupta; Aravind Galla; Andy Pereira; Jiamei Li; Fiona L Goggin
Journal:  Plant Physiol       Date:  2019-11-25       Impact factor: 8.340

2.  Proteomic and virus-induced gene silencing (VIGS) Analyses reveal that gossypol, brassinosteroids, and jasmonic acid contribute to the resistance of cotton to Verticillium dahliae.

Authors:  Wei Gao; Lu Long; Long-Fu Zhu; Li Xu; Wen-Hui Gao; Long-Qing Sun; Lin-Lin Liu; Xian-Long Zhang
Journal:  Mol Cell Proteomics       Date:  2013-09-09       Impact factor: 5.911

3.  Development and comparative genomic mapping of Dasypyrum villosum 6V#4S-specific PCR markers using transcriptome data.

Authors:  Shijin Li; Zhishan Lin; Chang Liu; Ke Wang; Lipu Du; Xingguo Ye
Journal:  Theor Appl Genet       Date:  2017-06-26       Impact factor: 5.699

4.  Integration of peroxisomes into an endomembrane system that governs cellular aging.

Authors:  Adam Beach; Michelle T Burstein; Vincent R Richard; Anna Leonov; Sean Levy; Vladimir I Titorenko
Journal:  Front Physiol       Date:  2012-07-17       Impact factor: 4.566

5.  Optimizing de novo common wheat transcriptome assembly using short-read RNA-Seq data.

Authors:  Jialei Duan; Chuan Xia; Guangyao Zhao; Jizeng Jia; Xiuying Kong
Journal:  BMC Genomics       Date:  2012-08-14       Impact factor: 3.969

6.  Changes of Nitric Oxide and Its Relationship with H2O2 and Ca2+ in Defense Interactions between Wheat and Puccinia Triticina.

Authors:  Mei Qiao; Jiawei Sun; Na Liu; Tianjie Sun; Gang Liu; Shengfang Han; Chunyan Hou; Dongmei Wang
Journal:  PLoS One       Date:  2015-07-17       Impact factor: 3.240

7.  The Hv-SGT1 gene from Haynaldia villosa contributes to resistances towards both biotrophic and hemi-biotrophic pathogens in common wheat (Triticum aestivum L.).

Authors:  Liping Xing; Chen Qian; Aizhong Cao; Yingbo Li; Zhengning Jiang; Minghao Li; Xiahong Jin; Jiameng Hu; Yiping Zhang; Xiue Wang; Peidu Chen
Journal:  PLoS One       Date:  2013-09-03       Impact factor: 3.240

8.  Proteomic discovery of H2O2 response in roots and functional characterization of PutGLP gene from alkaligrass.

Authors:  Juanjuan Yu; Yongxue Zhang; Junming Liu; Lin Wang; Panpan Liu; Zepeng Yin; Siyi Guo; Jun Ma; Zhuang Lu; Tai Wang; Yimin She; Yuchen Miao; Ling Ma; Sixue Chen; Ying Li; Shaojun Dai
Journal:  Planta       Date:  2018-07-23       Impact factor: 4.116

9.  The decreased expression of GW2 homologous genes contributed to the increased grain width and thousand‑grain weight in wheat-Dasypyrum villosum 6VS·6DL translocation lines.

Authors:  Zhiyu Feng; Long Song; Wanjun Song; Zhongqi Qi; Jun Yuan; Run Li; Haiming Han; Huifang Wang; Zhaoyan Chen; Weilong Guo; Mingming Xin; Jie Liu; Zhaorong Hu; Huiru Peng; Yingyin Yao; Qixin Sun; Zhongfu Ni; Jiewen Xing
Journal:  Theor Appl Genet       Date:  2021-08-10       Impact factor: 5.699

10.  TaCPK2-A, a calcium-dependent protein kinase gene that is required for wheat powdery mildew resistance enhances bacterial blight resistance in transgenic rice.

Authors:  Shuaifeng Geng; Aili Li; Lichuan Tang; Lingjie Yin; Liang Wu; Cailin Lei; Xiuping Guo; Xin Zhang; Guanghuai Jiang; Wenxue Zhai; Yuming Wei; Youliang Zheng; Xiujin Lan; Long Mao
Journal:  J Exp Bot       Date:  2013-08       Impact factor: 6.992

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.