Pal A Olsvik1, Liv Softeland, Kai K Lie. 1. National Institute of Nutrition and Seafood Research, Nordnesboder 2, N-5005 Bergen, Norway. pal.olsvik@nifes.no.
Following the publication of our article[1], an error in Table 2 was noted, the wrong accession number and primer sequences were stated for the EF1A assay.The GenBank accession number was incorrectly stated as:EX721840Forward primer: CCCTGTGGAAGTGGCTGAAGReverse primer: CATCCAAGGGTCCGTATCTCTTThe correct GenBank accession number should be:EX722124 Forward primer: CGGTATCCTCAAGCCCAACA Reverse primer: GTCAGAGACTCGTGGTGCATCTWe apologise for any inconvenience this may have caused.