The highly repetitive Alu retroelements are regarded as methylation centres in the genome. Methylation in the gene promoters could be spreading from them. Promoter methylation of MLH1 is frequently detected in cancers, but the underlying mechanism is unclear. The aim of this study is to understand whether the methylation in the Alu elements is associated with promoter methylation in the MLH1 gene. Bisulfite genomic sequencing was used to analyse the CpG sites of the 5' end (promoter, exon 1 and Alu-containing intron 1) of the MLH1 gene in colorectal cancer cells and tissues, and gastric cancer tissues. Hypomethylation in the Alu elements and hypermethylation in the promoters and the regions between the promoters and the Alu elements were detected in two cancer cell lines and seven cancer tissues. However, demethylation or hypomethylation of the MLH1 promoter and regions between promoter and the Alu elements, and hypermethylation in the Alu elements, were identified in the normal tissues. MLH1 promoter methylation may spread from Alu elements that are located in intron 1 of the MLH1 gene. The trans-acting elements binding to the mutation sites could play a role in the methylation spreading.
The highly repetitive Alu retroelements are regarded as methylation centres in the genome. Methylation in the gene promoters could be spreading from them. Promoter methylation of MLH1 is frequently detected in cancers, but the underlying mechanism is unclear. The aim of this study is to understand whether the methylation in the Alu elements is associated with promoter methylation in the MLH1 gene. Bisulfite genomic sequencing was used to analyse the CpG sites of the 5' end (promoter, exon 1 and Alu-containing intron 1) of the MLH1 gene in colorectal cancer cells and tissues, and gastric cancer tissues. Hypomethylation in the Alu elements and hypermethylation in the promoters and the regions between the promoters and the Alu elements were detected in two cancer cell lines and seven cancer tissues. However, demethylation or hypomethylation of the MLH1 promoter and regions between promoter and the Alu elements, and hypermethylation in the Alu elements, were identified in the normal tissues. MLH1 promoter methylation may spread from Alu elements that are located in intron 1 of the MLH1 gene. The trans-acting elements binding to the mutation sites could play a role in the methylation spreading.
MLH1 is a major mismatch repair gene which plays a role in maintaining the stability of the genome. MLH1 dysfunction may cause a high rate of gene mutations in the genome. Promoter methylation of MLH1, especially the C region (−310 to −240, relative to the initiation codon) containing 8 CpG sites, is a frequent event in cancer, which could result in loss of MLH1 expression [1]–[3]. To date, the mechanism of MLH1 methylation is unclear. Our previous studies have shown that MLH1 methylation may be associated with MLH1 -93SNP [4], [5]. However, the molecular basis behind this is unknown.Alu is one of the repetitive elements in the genome, which is hypermethylated in normal cells [6]. Alu elements are believed to be methylation centres in the genome [7]. In cancer, gene promoter methylation may spread from adjacent repetitive elements [7]. Graff et al. [8] mapped the methylation patterns of E-cadherin and von Hippel-Lindau tumour suppressor genes in both normal and neoplastic cells, and found that boundaries exist between the unmethylated promoters and the nearby hypermethylated Alu elements, to maintain the unmethylated status of the promoters in normal cells, and that the boundaries may be progressively overriden by methylation of the Alu elements, resulting in promoter methylation in neoplasia.Three Alu elements have been identified in intron 1 of MLH1 by searching a database of humanAlu repeat elements (Fig. 1). No Alu elements exist in the MLH1 promoter region. The methylation status of each CpG site within Alu elements of MLH1 has not been pinpointed. It is possible that MLH1 promoter methylation occurs from nearby Alu elements. To test this, we analysed the methylation status of all CpG sites of the MLH1 5′ end (C region containing promoter, exon 1 and majority of intron 1) (Fig. 1) in colorectal cancer cells and tissues, gastric cancer tissues and normal tissues using bisulfite genomic sequencing, and found that Alu elements in the intron 1 of MLH1 are hypomethylated, and the promoters and the regions between MLH1 promoters and Alu elements are hypermethylated in cancers. However, in the normal tissues Alu elements are hypermethylated, and the promoters and the regions between promoters and Alu elements are not methylated or hypomethylated.
Figure 1
A graphic overview of the 5′ end (promoter, exon 1, intron 1 and exon 2) of the human MLH1 gene and 27 amplicons in relation to it.
There are three Alu elements in intron 1, whose sizes and locations are shown by nucleotide numbers. The relative sizes and locations of the 27 PCR amplicons are depicted by bold lines, which cover a region from −339 to 116+2876.
A graphic overview of the 5′ end (promoter, exon 1, intron 1 and exon 2) of the human MLH1 gene and 27 amplicons in relation to it.
There are three Alu elements in intron 1, whose sizes and locations are shown by nucleotide numbers. The relative sizes and locations of the 27 PCR amplicons are depicted by bold lines, which cover a region from −339 to 116+2876.
Materials and Methods
Ethics statement
This research has been approved by the review board of Huazhong University of Science and Technology. We obtained tissue samples with written informed consent from the participants involved in the study. The ethics committee specifically approved the procedures.
Normal and cancer samples
Two colorectal cancer cell lines, RKO and SW48, with MLH1 promoter methylation [2] were ordered from the Chinese Academy of Sciences (Shanghai, China). A total of 188 colorectal and 27 gastric cancer tissues with matched normal mucosa were obtained from Tongji hospital (Wuhan, China). The peripheral blood of a healthy individual was also obtained from Tongji hospital (Wuhan, China).
Cell culture and DNA isolation
Cells were grown in DMEM supplemented with 10% foetal bovine serum at 37°C with 5% CO2 atmosphere. DNA was extracted from cells, cancer tissues, normal mucosa and blood samples using DNA isolation kit (Sangon, Shanghai, China) and TIANamp genomic DNA kit (Tiangen, Beijing, China).
Characterisation of tumours
All tumours were assessed for microsatellite instability (MSI) using five microsatellite repeats (BAT25, BAT26, D2S123, D5S346, and D17S250), as described previously [1]. For the MSI positive tumours, the extracted DNA was converted using EZ DNA Methylation Kit (Zymo Research Corporation, Orange, CA, USA). MLH1 methylation at cytosines at −250 and −252 relative to the initiation codon was assessed using combined bisulfite restriction analysis (COBRA) with BstUI [1].
Immunohistochemical (IHC) staining
IHC staining for MLH1 proteins was performed on 5-µm sections from paraffin-embedded tumour and adjacent normal tissue blocks with antibody MLH1 (ab92312, abcam, UK). The sections were deparaffinised, rehydrated, and rinsed in tap water before antigen retrieval by boiling in a 0.01 M citrate buffer (pH 6.0) twice for 5 min. Sections were incubated with antibodies overnight at 4°C. IHC staining was visualised using the Strep ABC Complex/horseradish peroxidise (HPR). Tumours were graded by intensity of staining as negative, weakly positive, moderately positive and strongly positive.
Bisulfite genomic sequencing
For COBRA-positive samples, the methylation status of MLH1 5′end was determined using bisulfite genomic sequencing. In total there were 27 PCR amplicons designed to cover the region from −339 to 116+2876, relative to the translation start site (Fig. 1). The primers used are shown in Table S1. PCR was performed at 95°C for 5 min followed by 40 cycles of 95°C for 30 sec, 55–61°C for 45 sec and 72°C for 1 min with a final extension at 72°C for 7 min. A hot start was used by adding the enzyme during the first cycle at about 72°C, after a preincubation time of 5 minutes at 95°C. The PCR products were tested in 2% agarose gel and then cloned into the pEASY-T1 vector (TransGen Biotech, Beijing, China). The colony PCR was undertaken to screen the positive colonies. The clones with the right sizes of PCR products were sequenced on an ABI sequencer with dye terminators (Applied Biosystems, Foster City, CA, USA). With sequencing results of five clones, the methylation frequency was determined for each CpG site.
Mutation screening
The MLH1 5′ end for methylation analysis was sequenced using the unconverted DNA from cancer cells and tissues. The 10 pairs of primers used are shown in Table 1. PCR was performed at 95°C for 5 min followed by 35 cycles of 95°C for 30 sec, 58–66°C for 30 sec and 72°C for 1 min with a final extension at 72°C for 7 min. Then PCR products were directly sequenced using the ABI sequencer.
Table 1
Oligonucleotide sequences of the primers for mutation analysis.
Primer name
Primer sequence (5′-3′)
Genomic position
Product size (bp)
A
ACCTCAGCAGAGGCACACA
−369 to −351
393
AATAACCCCTGCCACGAAC
+6 to +24
B
CGTTTCCTTGGCTCTTCTGG
−27 to −7
343
GGGGAGAGCGGTAAAGAAAC
IVS*1+181 to IVS1+200
C
GTCAGGCCTTCTCCTTTTCC
IVS1+150 to IVS1+169
354
AAAGTGCATCAGCCTGTCCT
IVS1+484 to IVS1+503
D
ATTCATTTTGAGTTTCTTTCAAAAC
IVS1+442 to IVS1+466
381
CCTACCACTCCAAACTGAAGC
IVS1+802 to IVS1+822
E
TGACGTCCGTACGTTAATAGAAAA
IVS1+772 to IVS1+795
344
CAAGCCACCAAGCTAGTATGTTT
IVS1+1093 to IVS1+1115
F
TTGTACTGTGCCAGAATACTGTAAA
IVS1+1060 to IVS1+1084
365
TGTAATCCCAGCACTTTGGA
IVS1+1405 to IVS1+1424
G
TGTCAAAACTCTCGATCTCAGG
IVS1+1363 to IVS1+1384
386
TGGGCAACAGAGTAAGACTTCA
IVS1+1727 to IVS1+1748
H
ACAGGGGCTCATGAGAAATG
IVS1+1659 to IVS1+1678
384
CCCACACAGACAATTCTTTATTCA
IVS1+2019 to IVS1+2042
I
CGTGCCCAGCCTATTATCTT
IVS1+1994 to IVS1+2013
386
GAGACCAGCCTGACCAACAT
IVS1+2340 to IVS1+2379
J
CCATGCCTGGCTAATTTTGT
IVS1+2314 to IVS1+2333
365
TTTTGGCAGATGTCTCTTCTCA
IVS1+2657 to IVS1+2678
IVS, intervening sequence.
IVS, intervening sequence.
Results
Screening of colorectal and gastric cancer tissue samples with MLH1 promoter methylation
Of the 188 colorectal and 27 gastric cancer tissues, 48 colorectal and 9 gastric cancer samples were found to have MSI positive phenotype. The MSI positive samples were then examined for MLH1 promoter methylation, and 4 colorectal and 3 gastric cancer samples exhibited MLH1 promoter methylation (Fig. 2).
Figure 2
MLH1 promoter methylation assessment by COBRA with BstUI.
The four colorectal cancers (C8T, C15T, C35T and C156T) and 3 gastric cancers (G9T, G19T and G24T) were analysed. Symbol “−” means that PCR products were digested without BstUI, and “+” means digestion with BstUI.
MLH1 promoter methylation assessment by COBRA with BstUI.
The four colorectal cancers (C8T, C15T, C35T and C156T) and 3 gastric cancers (G9T, G19T and G24T) were analysed. Symbol “−” means that PCR products were digested without BstUI, and “+” means digestion with BstUI.
Association of MLH1 methylation and negative or weak expression of MLH1
The seven MLH1 methylation samples, together with their adjacent normal tissues, were analysed for MLH1 expression using IHC staining. All seven cancer tissues showed negative or weakly positive expression of Mlh1, and their adjacent normal tissues had strong expression (Fig. 3).
Figure 3
IHC staining of MLH1 expression in tumours and their adjacent normal tissues.
A and B represent a colorectal tumour (T) and the adjacent normal tissue (N) respectively; C and D display a gastric tumour (T) and the adjacent normal tissue (N). A: negative staining; C: weak staining; B and D: strong staining.
IHC staining of MLH1 expression in tumours and their adjacent normal tissues.
A and B represent a colorectal tumour (T) and the adjacent normal tissue (N) respectively; C and D display a gastric tumour (T) and the adjacent normal tissue (N). A: negative staining; C: weak staining; B and D: strong staining.
Comparison of MLH1 methylation patterns between normals and cancers
A total of 93 CpG sites located on the region analysed were measured for methylation status using bisulfite genomic sequencing (Fig. 4). The two colorectal cancer cell lines, four MSI positve colorectal cancer tissues, and three MSI positive gastric cancer tissues showed different patterns compared to the MSI negative colorectal cancer tissue, the normal colorectal and gastric mucosa and peripheral blood (Fig. 5). The MSI negative colorectal cancer tissue, the normal colorectal and gastric mucosa and peripheral blood displayed no methylation in the MLH1 promoter, and demethylation or hypomethylation (less than 50%) in the regions between promoters and Alu elements, whereas the regions within or downstream of Alu elements exhibited hypermethylation (more than 50%). In contrast, for the colorectal cancer cells and tissues (MSI positive) and gastric cancer tissues (MSI positive), the MLH1 promoters and the regions between promoters and Alu elements are hypermethylated, with the exception of a very few hypomethylated CpG sites. However, the regions within or downstream of Alu elements showed a certain degree of hypomethylation or demethylation compared to the normal tissues. Furthermore, the hypomethylation and demethylation were more frequently seen in the colorectal and gastric cancer tissues (MSI positive) compared to the colorectal cancer cells (Fig. 5).
Figure 4
Partial sequencing data for 5 clones of an PCR amplicon located at 116+1780 to 116+2059 of MLH1 in RKO cells.
The CpG sites are underscored. Clones 1, 3 and 4 displayed methylation, and clones 2 and 5 no methylation. The methylation frequency of the CpG site is 60%. WT, wildtype; CT, converted type.
Figure 5
Methylation profiles of CpG sites of the MLH1 C region containing promoter, exon 1 and majority of intron 1 in normal colorectal and gastric mucosa and peripheral blood, colorectal cancer cells and tissues, and gastric cancer tissues.
In total 93 CpG sites are analysed. However, 92 CpG sites can be seen in the normal colorectal mucosa, due to a transition of G to A at a CpG site between Alus 1 and 2. •,▴,▪,□,△ and ○ represent methylation frequency of 100%, 80%, 60%, 40%, 20% and 0, respectively. 80% indicates that of the 5 clones, 4 exhibited methylation at a CpG site. RKO and SW48: colorectal cells; C8T, C15T, C35T, C156T: MSI positive colorectal cancer tissues; C161T: MSI negative colorectal cancer; C161N: C161T matched normal tissue; and G9T, G19T and G24T: MSI positive gastric cancers.
Partial sequencing data for 5 clones of an PCR amplicon located at 116+1780 to 116+2059 of MLH1 in RKO cells.
The CpG sites are underscored. Clones 1, 3 and 4 displayed methylation, and clones 2 and 5 no methylation. The methylation frequency of the CpG site is 60%. WT, wildtype; CT, converted type.
Methylation profiles of CpG sites of the MLH1 C region containing promoter, exon 1 and majority of intron 1 in normal colorectal and gastric mucosa and peripheral blood, colorectal cancer cells and tissues, and gastric cancer tissues.
In total 93 CpG sites are analysed. However, 92 CpG sites can be seen in the normal colorectal mucosa, due to a transition of G to A at a CpG site between Alus 1 and 2. •,▴,▪,□,△ and ○ represent methylation frequency of 100%, 80%, 60%, 40%, 20% and 0, respectively. 80% indicates that of the 5 clones, 4 exhibited methylation at a CpG site. RKO and SW48: colorectal cells; C8T, C15T, C35T, C156T: MSI positive colorectal cancer tissues; C161T: MSI negative colorectal cancer; C161N: C161T matched normal tissue; and G9T, G19T and G24T: MSI positive gastric cancers.
Mutation screening in the cancer cells and tissues
Mutations in the MLH1 5′ end for methylation analysis were screened in the 2 cancer cells and 7 cancer tissues. One colorectal and one gastric cancer tissue were found to have mutations compared to their adjacent normal tissues (Fig. 6). One colorectal and one gastric cancer exhibited an identical heterozygous mutation, A→G, at the same site, IVS1 +681 bp. Their adjacent normal tissues did not show the mutation, indicating that it is somatic and tumour-specific.
Figure 6
Sequencing analysis of MLH1 5′ end.
One colorectal and one gastric cancer, C15T and G19T, exhibited an identical heterozygous mutation, A→G, at the same site, IVS1 +681 bp. Their adjacent normal tissues, C15N and G19N, did not show the mutation. Arrows display the sites of the mutations.
Sequencing analysis of MLH1 5′ end.
One colorectal and one gastric cancer, C15T and G19T, exhibited an identical heterozygous mutation, A→G, at the same site, IVS1 +681 bp. Their adjacent normal tissues, C15N and G19N, did not show the mutation. Arrows display the sites of the mutations.
Discussion
The methylation patterns of Alu elements in the MLH1 have not previously been explored in normal tissues. In this study, we analysed the methylation status of the CpG sites within the three Alu elements located in the intron 1 of MLH1, and found that all three Alu elements are at levels of hypermethylation in normal colorectal and gastric mucosa and peripheral blood (Fig. 5). It is in line with earlier finding that Alu elements are hypermethylated in the normal gastric mucosa, breast epithelial and kidney tissues [6], [8]. The MSI negative colorectal tumour displayed very similar methylation pattern to the normal tissues (Fig. 5). Normally, methylation within the Alu elements should not spread to the adjacent CpG islands due to blockage by the Sp1 elements [9], [10]. Here we revealed that the regions upstream of the Alu elements are unmethylated or hypomethylated in the normal colorectal and gastric mucosa and peripheral blood. Clear boundaries are seen between hypermethylated Alu elements and hypomethylated regions upstream of them (Fig. 5). There are several hypomethylated CpG sites upstream of the Alu elements in the normal tissues, and those CpG sites are out of the C region (Fig. 5), suggesting a limited spread of Alu methylation in normal cells. Some CpG sites around or within the Alu elements in normal tissues displayed less than 100% methylation (Fig. 5), suggesting that methylation of individual sites is not clonally derived, even though the overall pattern of methylation is transmitted from cell to cell. In line with this, it has been shown that the mouseadenine phosphoribosyltransferase gene has methylation patterns which differ between liver cells [10]. The mechanism behind this could be that the methylation centres of the identical genes in different cells have variable strength of signal travelling upstream or downstream [11].Disruption of the Sp1 elements facilitates de novo methylation of the adjacent CpG sites [9], [10], [12], and induces epigenetic gene inactivation [12]. It is proposed that Alu elements are the methylation centres in the genome [8]. The methylation patterns of the Alu elements in the MLH1 methylated colorectal cancer cells RKO and SW48 have not been studied previously. RKO and SW48 have been found to have methylation in the MLH1 promoter region, particularly in the C region (−310 to −240, relative to the initiation codon), which causes reduced MLH1 expression [2]. In this study we also analysed methylation patterns in the MLH1 promoters, the three Alu elements and the regions between promoters and the Alu elements. Compared to the normal colorectal and gastric mucosa and peripheral blood, the Alu elements showed hypomethylation especially in Alus 2 and 3 in both RKO and SW48. Moreover, the region downstream of Alu 3 showed hypomethylation in both RKO and SW48 (Fig. 5). However, the promoters and particularly the regions between promoters and Alu elements were hypermethylated in RKO and SW48 (Fig. 5). This strongly suggests that the MLH1 promoter methylation spreads from the methylation centres within intron 1 of MLH1.Because cultured cancer cell lines are considered to have a higher degree of methylation than primary tumours [13], we decided to analyse the primary tumours for MLH1 methylation pattern in the same regions as the cell lines. A somewhat lower degree of methylation was detected in the MLH1 promoter region in the 4 MSI positive colorectal and 3 MSI positive gastric cancers compared to the two cell lines (Fig. 5). However, hypermethylated promoters, particularly in the C regions, and the regions between promoters and Alu elements are seen in all seven cancers analysed. Some regions within and around Alu elements were obviously hypomethylated in the tumour tissues. Hence the data from the cancer tissues strongly suggest that the methylation is spreading from the Alu elements to the 5′ region of the MLH1 in MSI positive colorectal and gastric cancer tissues, as well as in the colorectal cancer cell lines. Alu hypomethylation has been identified in gastric carcinomas and melanoma cell lines [6], [14]. Another repetitive sequence, LINE-1, also showed hypomethylation in malignant gastrointestinal stromal tumours [15]. Hypomethylation may increase the malignant potential of tumours by inducing accumulation of chromosomal aberrations or methylation spreading to the promoters of tumour suppressor genes. Thus methylation of the repetitive sequences may be a useful marker for malignancy assessment.A Sp1 element was identified at −119 of the MLH1 promoter region using transcription factor search software (TFSEARCH ver.1.3). To ascertain whether there are mutations in the Sp1 element, we sequenced the entire region analysed above in the cancer cell lines and tissues. No mutations in the Sp1 element were detected, but one MSI positive colorectal and one MSI positive gastric cancer showed the A→G mutation, at the same site, IVS1 +681 bp in the MLH1 gene. This site is between the promoter and Alu elements. Our finding suggests that the region is a mutational hotspot in the pathogenesis of colorectal and gastric cancer. We speculate that the trans-acting elements binding to this site, or other sites which are between promoter and Alu elements, may be involved in the methylation spreading from the Alu elements to the promoter region. Therefore, those trans-acting elements could behave as guardians of the methylation centres, e.g. Alu elements. Further studies are needed in order to search for those trans-acting elements, which could be the therapeutic targets of cancers in the future.Oligonucleotide sequences of the primers for methylation analysis.(DOC)Click here for additional data file.
Authors: D J Smiraglia; L J Rush; M C Frühwald; Z Dai; W A Held; J F Costello; J C Lang; C Eng; B Li; F A Wright; M A Caligiuri; C Plass Journal: Hum Mol Genet Date: 2001-06-15 Impact factor: 6.150
Authors: Paul J Goodfellow; Barbara M Buttin; Thomas J Herzog; Janet S Rader; Randall K Gibb; Elizabeth Swisher; Katherine Look; Ken C Walls; Ming-Yu Fan; David G Mutch Journal: Proc Natl Acad Sci U S A Date: 2003-05-05 Impact factor: 11.205
Authors: M Brandeis; D Frank; I Keshet; Z Siegfried; M Mendelsohn; A Nemes; V Temper; A Razin; H Cedar Journal: Nature Date: 1994-09-29 Impact factor: 49.962
Authors: Hyang-Min Byun; Francesco Nordio; Brent A Coull; Letizia Tarantini; Lifang Hou; Matteo Bonzini; Pietro Apostoli; Pier Alberto Bertazzi; Andrea Baccarelli Journal: PLoS One Date: 2012-06-20 Impact factor: 3.240
Authors: A Benard; C J H van de Velde; L Lessard; H Putter; L Takeshima; P J K Kuppen; D S B Hoon Journal: Br J Cancer Date: 2013-11-12 Impact factor: 7.640
Authors: Ruiwei Jiang; Meaghan J Jones; Francesco Sava; Michael S Kobor; Christopher Carlsten Journal: Part Fibre Toxicol Date: 2014-12-09 Impact factor: 9.400