Literature DB >> 22016617

Polymorphic microsatellite loci isolated from the Squalidus argentatus using PCR-Based Isolation of Microsatellite Arrays (PIMA).

Yang Sun1, Hung-Du Lin, Wen-Qiao Tang, Yu-Min Ju, Zhi-Zhi Liu, Dong Liu, Jin-Quan Yang.   

Abstract

Squalidus argentatus (Sauvage and Dabry de Thiersant 1874) is a small-sized freshwater fish which is distributed in Mainland China, Hainan Island and Taiwan. The populations of S. argentatus have dropped sharply probably due to overharvesting and water pollution recently. Eleven polymorphic microsatellite markers were developed for the cyprinid fish S. argentatus. These new markers were tested on 43 individuals collected from Yangtze River and Qiantang River. The number of alleles, observed and expected heterozygosity per locus, in two populations ranged from 3 to 14, from 0.333 to 0.954 and from 0.480 to 0.928, respectively. Only two loci are significantly deviated from Hardy-Weinberg expectations due to the heterozygote deficiency. No significant linkage disequilibrium was detected between the pairwise comparisons of these loci. These polymorphic microsatellite loci will enable us to study the genetic variation, population structure, and conservation genetics of this species in the future.

Entities:  

Keywords:  PIMA; RAPD-PCR enrichment; Squalidus argentatus; conservation; microsatellite

Mesh:

Year:  2011        PMID: 22016617      PMCID: PMC3189741          DOI: 10.3390/ijms12095666

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   5.923


1. Introduction

Genus Squalidus argentatus (Sauvage and Dabry de Thiersant 1874) (Cypriniformes, Cyprinidae) consists of a group of small-sized freshwater fishes widely found in the lower or middle reaches of Eastern Asia, including Mainland China, Hainan Island and Taiwan. There are at least seven valid species of Squalidus found in mainland China and two endemic species reported from Taiwan [1]. Among them, S. argentatus is the only species commonly found in above mentioned areas [2]. Within the last decade, the wild resource of S. argentatus has experienced a dramatic decrease probably owing to over-fishing and environmental destruction. In order to develop effective strategies for fishery management and conservation, information, such as the population genetic structure and genetic diversity and divergence of S. argentatus, is important. DNA-based genetic analyses can yield valuable information for assessing levels of variation and population genetic structure in freshwater fishes. Because of their high level of polymorphism and co-dominant inheritance in Mendelian fashion, microsatellites have been widely used as DNA markers in the studies of population structure and conservation genetics of freshwater fishes [3]. Although many studies related to taxonomy [1], embryonic development [4] and phylogenetic relationship [5] of S. argentatus, have been conducted, there is no report available on molecular markers isolation for this species. The microsatellite markers identified will allow the undertaking of further genetic studies on S. argentatus and provide valuable genetic information to assist the management and culture of this resource.

2. Experimental Section

2.1. Isolation of Microsatellite Markers

In the present study, we developed 11 polymorphic microsatellite loci isolated using PCR-based isolation of microsatellite arrays (PIMA) of Squalidus argentatus. In brief, total genomic DNA was extracted from muscle tissue or fins preserved in 95% ethanol, by proteinase K digestion at 55 °C. DNA was purified by traditional phenol-chloroform protocol and ethanol precipitation [6]. The PCR library was obtained by the PCR isolation of microsatellite arrays (PIMA) method that is based on random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) enrichment [7-9]. It takes advantage of the fact that the RAPD fragments contain microsatellite repeats more frequently than random genomic clones [10]. Amplification of 20–100 ng of DNA was performer in a 15 μL final volume with 0.2 mM of each dNTP, 2 mM MgCl2, 0.5 U Taq polymerase (Promega), and 5 pmols of one RAPD primer. Several RAPD primers were used to amplify fragments from the target species’ genome in separate reactions. Reactions of PCR amplification were conducted in a thermal cycler (Eppendorf Mastercycler) using the following conditions: initial denaturing at 94 °C for 3 min; 40 cycles of 94 °C denaturing for 50 s, 37 °C annealing for 1 min, 72 °C extension for 1 min; and 72 °C for 10 min. RAPD-PCR products were size-selected to preferentially obtain small fragments (500–1200 bp). Approximately 100 ng of PCR product was ligated into a pMD 19-T vector (Takara) according to the manufacturer’s instructions, and the ligation mixture was transformed into Escherichia coli DH5α competent cells. Clones were screened of the library for microsatellites by PCR with both vector primers plus a microsatellite specific primer (GT and GA repeats) [8]. In positive clones, the repeat-specific and vector primers amplified DNA fragments that contain microsatellites, whereas no amplification was found in negative clones. Plasmid DNA from positives was purified using the High-Speed Plasmid Mini Kit (Geneaid). Both strands of the DNA insert were sequenced. Sequencing of positive insert PCRs was conducted by Sangon Biotec (Shanghai) Co., Ltd. with an ABI PRISM 3730 sequencer using the BigDye Terminator kit (Applied Biosystems) and by using vector primers. Primer pairs were newly designed for eleven microsatellite sequences with the program PRIMER 3 software [11]. Preliminary assessment of polymorphism was performed on a few individuals. Reactions were performed in a total volume of 15 μL containing 10 ng of genomic DNA, 0.2 mM dNTP, 2 mM MgCl2, and 0.12 μM of each primer. PCR reactions were as follows: 94 °C for 4 min followed by 40 cycles at 94 °C for 30 s, 30 s–50 s at primer-specific annealing temperature (Table 1), 72 °C for 45 s and a final extension step at 72 °C for 10 min. PCR product was analyzed automatically by the QIAxcel system in combination with QIAxcel DNA High Resolution Kit (QIAGEN, German). The method was selected OM700. PBR322/MSP I marker (TIANGEN, China) was used as standard for scoring.
Table 1

The forward (F) and reverse (R) primer sequences, repeat motif, size range and Tm, annealing temperature for eleven microsatellite loci of Squalidus argentatus.

LocusGenbank Accession No.Primer sequence(5′ to 3′)Repeat motifSize range (bp)Tm °C
MISA01JN582002F: TCTGACCCAACGGTTTCTGC(TG)10222–25263
R: GGACACCTGCTGACGCTCTT
MISA02JN582003F: AGCTAACTGAGCTGCATACAAC(AG)18262–28059
R: GGTGGTGGAACATAAAGTGACA
MISA03JN582004F: AGCCAACCTGCGTCGTTATCTAC(TG)14186–22263
R: GGGACTCACAACCAGTTTTGGTT
MISA04JN582005F: ATCAAAGGTAAGAGAACATCAGCG(CT)21212–30861
R: TCAATTAAATCCTTCCCGGTGTAC
MISA05JN582006F: TTGAGCATGACAGAGCACACAGAATC(AG)8G(GA)27298–37063
R: CGAAACCAGTGAATGCCAAAGTCTC
MISA06JN582007F: TGGCTCCTTTCACACCCGT(CAT)6…(TC)10…(TC)6…(TG)6202–28063
R: AGGCAGGAGAGGAAGAGCG
MISA07JN582008F: AGGACACCTGCTGACGCTCTT(AC)9224–24665
R: CTCTGACCCAACGGTTTCTGC
MISA08JN582009F: TGACACAGTGTAGACTTTCCAAAC(TC)15(TG)9202–27861
R: GAACTCAGCAGAAATAGAAACCAT
MISA09JN582010F: ATCGCTTCAGACTCACCTCATC(TG)31326–38063
R: AAACCTCAAATTCGACCAAAAT
MISA10JN582011F: ACACTGAGGAGTTCAAATAAAGCC(TG)5…(TG)6182–19461.5
R: TCATCTTCTAAGAGAGCAGGAGTG
MISA11JN582012F: CGATCATCATGGTGTTTCCTGC(AC)9…(CA)15246–34661
R: TCGGGTTGTATTGCTCTTCAGT

2.2. Data Analysis

Allele frequency, observed (HO) and expected (HE) heterozygosities were calculated. All loci were tested for fitness to the Hardy–Weinberg equilibrium (HWE), and all pairwise combinations of loci were tested for linkage disequilibrium. All these parameters and tests were computed using ARLEQUIN 3.5 [12]. Results of the tests were corrected for multiple comparisons by applying sequential Bonferroni corrections [13]. The software MICROCHECKER was employed to infer the most probable technical cause of HWE departures, including null alleles, allelic dropout due to short allele dominance, and errors made during the scoring of alleles with ‘stutter’ on our data [14].

3. Results and Discussion

A total of 43 Squalidus argentatus, including 21 from Yangtze River and 22 from Qiantang River, were collected and their levels of genetic diversity were estimated by 11 microsatellite loci. Locus designation, GenBank accession number, repeat motif, PCR product size range and number of alleles for the 11 microsatellite markers are listed in Table 1. The number of alleles on each locus ranged from 3 to 11 (average 6.364) in Yangtze River and from 4 to 14 (average 8.636) in Qiantang River. As shown in Table 2, the HE and HO ranged from 0.480–0.923 (average of 0.767) and 0.333–0.857 (average of 0.668), respectively, in Yangtze River. The HE and HO ranged from 0.717–0.928 (average of 0.830) and 0.476–0.954 (average of 0.747), respectively, in Qiantang River. One locus in Yangtze River (MISA10) and in Qiantang River (MISA11) is significantly deviated from Hardy–Weinberg equilibrium after Bonferroni’s correction (P < 0.001) due to the heterozygote deficiency, respectively (Table 2). These deviations may have resulted from null alleles or small population size associated with human disturbances and habitat loss [15]. With MICRO-CHECKER utility, null alleles were found in MISA11 locus (P < 0.05), but for stuttering and allelic dropout tests, no evidences were found in all loci (P > 0.05). After applying sequential Bonferroni corrections to compensate for multiple statistical tests, no evidence of genotypic linkage disequilibrium at any pair of loci was found. Microsatellite makers described here should be useful to monitor population dynamics and to determine dispersal patterns and genetic diversity within and between populations of this species. These polymorphic microsatellite loci will be used to investigate population structure and gene flow among S. argentatus populations and are expected to provide a better understanding about the ecology of the species, and consequently a basis for a sustainable management framework in the future.
Table 2

List of eleven microsatellite loci for Squalidus argentatus in Yangtze River and Qiantang River. Number of alleles (NA), expected (HE) and observed (Ho) heterozgosities and significance of deviation from Hardy–Weinberg equilibrium for microsatellite loci.

Yangtze RiverQiantang River
NAHoHEHWEP-valueNAHoHEHWEP-value
MISA0160.733330.818390.1151260.681820.806550.05309
MISA0240.647060.757580.2324140.954550.749470.12959
MISA0370.812500.731850.0369960.705880.823530.32288
MISA0480.857140.881530.13961140.818180.928120.29437
MISA05110.823530.919790.32180140.909090.919660.02107
MISA06110.714290.923280.11708120.727270.878440.29985
MISA0740.631580.661450.1261050.818180.717760.51218
MISA0870.666670.847620.38511130.772730.926000.06433
MISA0950.466670.698850.2296580.818180.850950.47429
MISA1040.666670.716610.0003840.545450.748410.00152
MISA1130.333330.480460.0397490.476190.785130.00000
mean6.3640.668430.767048.6360.747960.83037

4. Conclusions

The wild resource of Squalidus argentatus has experienced a dramatic decrease in the last decade. Therefore, there is an urgent need for the development and application of microsatellites to provide an effective tool for investigation of genetic variation and population structure in S. argentatus. In conclusion, we report, these 11 polymorphic microsatellite loci presented in this study were the first set of microsatellite markers designed specifically for S. argentatus, and provides the ground work for further studies on the genetic structure, gene flow, conservation management and molecular evolution of this vulnerable species.
  5 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  Microsatellites, from molecules to populations and back.

Authors:  P Jarne; P J Lagoda
Journal:  Trends Ecol Evol       Date:  1996-10       Impact factor: 17.712

3.  Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows.

Authors:  Laurent Excoffier; Heidi E L Lischer
Journal:  Mol Ecol Resour       Date:  2010-03-01       Impact factor: 7.090

4.  ANALYZING TABLES OF STATISTICAL TESTS.

Authors:  William R Rice
Journal:  Evolution       Date:  1989-01       Impact factor: 3.694

5.  Random amplified hybridization microsatellites (RAHM): isolation of a new class of microsatellite-containing DNA clones.

Authors:  R A Cifarelli; M Gallitelli; F Cellini
Journal:  Nucleic Acids Res       Date:  1995-09-25       Impact factor: 16.971

  5 in total
  2 in total

1.  Cross-priming of microsatellite loci in subfamily cyprininae (family Cyprinidae): their utility in finding markers for population genetic analysis in three Indian major carps.

Authors:  Prachi Masih; Rupesh K Luhariya; Rakhi Das; Arti Gupta; Vindhya Mohindra; Rajeev K Singh; Rohit Srivastava; U K Chauhan; J K Jena; Kuldeep K Lal
Journal:  Mol Biol Rep       Date:  2014-05-04       Impact factor: 2.316

2.  Elongation factor 1β' gene from Spodoptera exigua: characterization and function identification through RNA interference.

Authors:  Li-Na Zhao; Zi Qin; Ping Wei; Hong-Shuang Guo; Xiang-Li Dang; Shi-Gui Wang; Bin Tang
Journal:  Int J Mol Sci       Date:  2012-06-29       Impact factor: 6.208

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.