Literature DB >> 21988906

Analysis of conserved microRNAs in floral tissues of sexual and apomictic Boechera species.

Samuel Amiteye1, José M Corral, Heiko Vogel, Timothy F Sharbel.   

Abstract

BACKGROUND: Apomixis or asexual seed formation represents a potentially important agronomic trait whose introduction into crop plants could be an effective way to fix and perpetuate a desirable genotype through successive seed generations. However, the gene regulatory pathways underlying apomixis remain unknown. In particular, the potential function of microRNAs, which are known to play crucial roles in many aspects of plant growth and development, remains to be determined with regards to the switch from sexual to apomictic reproduction.
RESULTS: Using bioinformatics and microarray validation procedures, 51 miRNA families conserved among angiosperms were identified in Boechera. Microarray assay confirmed 15 of the miRNA families that were identified by bioinformatics techniques. 30 cDNA sequences representing 26 miRNAs could fold back into stable pre-miRNAs. 19 of these pre-miRNAs had miRNAs with Boechera-specific nucleotide substitutions (NSs). Analysis of the Gibbs free energy (ΔG) of these pre-miRNA stem-loops with NSs showed that the Boechera-specific miRNA NSs significantly (p ≤ 0.05) enhance the stability of stem-loops. Furthermore, six transcription factors, the Squamosa promoter binding protein like SPL6, SPL11 and SPL15, Myb domain protein 120 (MYB120), RELATED TO AP2.7 DNA binding (RAP2.7, TOE1 RAP2.7) and TCP family transcription factor 10 (TCP10) were found to be expressed in sexual or apomictic ovules. However, only SPL11 showed differential expression with significant (p ≤ 0.05) up-regulation at the megaspore mother cell (MMC) stage of ovule development in apomictic genotypes.
CONCLUSIONS: This study constitutes the first extensive insight into the conservation and expression of microRNAs in Boechera sexual and apomictic species. The miR156/157 target squamosa promoter binding protein-like 11 (SPL11) was found differentially expressed with significant (p ≤ 0.05) up-regulation at the MMC stage of ovule development in apomictic genotypes. The results also demonstrate that nucleotide changes in mature miRNAs significantly (p ≤ 0.05) enhance the thermodynamic stability of pre-miRNA stem-loops.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21988906      PMCID: PMC3208272          DOI: 10.1186/1471-2164-12-500

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Apomixis, or asexual reproduction through seeds, is a naturally occurring reproductive form which has been observed in more than 400 plant species. Apomictic reproduction is, however, absent in many agriculturally important crop plants [1]. It therefore represents a potentially important agricultural tool, since introduction of apomixis into crops could be an effective way to fix and propagate a given genotype for superior crop performance. Apomixis has evolved from many different sexual taxa [2,3], although the genetic factors underlying apomictic reproduction remain unknown. The genus Boechera (Bocher's rock cress; formerly Arabis) is monophyletic, has a basic chromosome number × = 7 [4], and wild populations are characterized by diploid sexuals, and diploid, aneuploid, and polyploid (mostly 2n = 3x = 21) apomicts [5]. Plants of this genus are perennial members of the Brassicaceae which are distributed throughout North America and Greenland [4,6,7]. The switch from sexual to apomictic reproduction has been hypothesized to arise via de-regulation of the developmental pathways originally leading to sexual seed formation [8]. As virtually all asexual plants or animals are hybrid and/or polyploid, their associated gene regulatory changes have been proposed as possible triggers for the switch in reproductive mode [9]. In particular, the potential function of microRNAs (miRNAs), which are known to play crucial roles in many aspects of plant development, remains to be determined with regards to the switch from sex to apomixis. MiRNAs are 20-24 nucleotide small endogenous non-protein-coding regulatory RNA sequences that are produced by genes distinct from the genes that they regulate. Evidence provided by Allen et al [10] and Felippes et al [11] show that some miRNAs evolved by inverted duplications of target gene sequences, whereas others originated from random sequences that either have self-complementarity by chance or sequences that represent highly eroded inverted duplications. Since their discovery, several miRNAs have been computationally and/or experimentally identified and characterized in different species. A number of studies have shown that miRNAs play key roles in regulatory functions of gene expression for most eukaryotes [12,13], mainly at the post-transcriptional levels [14,15]. Several recent findings have implicated miRNAs in a number of biological mechanisms including leaf [16], stem [15] and root growth [17], floral organ identity, control of female gamete formation and reproductive development [18,19], auxin signaling [20], and biotic and abiotic stress response [13]. Biogenesis of miRNAs involves nucleolytic processing of a precursor transcript with extensive foldback structure [21-23]. miRNAs are initially expressed as part of longer transcripts that are self-complementary foldback hairpin structures termed primary miRNAs (pri-miRNAs). Pri-miRNA precursors are transcribed by miRNA genes which are mostly independent transcript units. These pri-miRNA precursors are first processed into pre-miRNAs from which miRNAs are eventually generated by the ribonuclease III nucleases and Dicer-like1 (DCL1) in plants. Subsequently, the mature single stranded miRNA is incorporated into a miRNA-induced silencing complex (miRISC) to cleave its specific target messenger RNA (mRNA), or to effect translational attenuation of its target transcript [24,25]. Plant miRNAs bind to the protein-coding region of their target mRNAs to induce target mRNA degradation via an RNAi-like mechanism where an Argonaut (AGO) protein cleaves the miRNA-mRNA duplex, thereby repressing expression of that particular mRNA [26]. It is also known that gene repression can be effected by translational inhibition through deadenylation of the 3' poly (A) tail and decapping of the 5' end in mRNAs, which leads to progressive mRNA decay and degradation [27,28]. Accurate detection and expression profiling of miRNAs will enable a better understanding of their role in plant growth and development [13,18,20], and could provide insights into miRNA-mediated apomictic gene regulatory mechanisms. The main approaches for miRNA identification have been widely undertaken by computational prediction, direct cloning and sequencing. Until recently, most sequence information including Expressed Sequence Tags (ESTs) or Genome Survey Sequences (GSS) used for computational prediction of miRNAs were generated by traditional Sanger sequencing methods [29,30]. Compared to highly conserved miRNAs, less- or non-conserved miRNAs are often expressed at lower levels, thus making their detection more daunting using small-scale sequencing. The development of next generation sequencing technology has greatly improved the capacity to identify low abundance or tissue-specific miRNAs, and has enhanced the discovery of several conserved, non-conserved or lowly expressed miRNAs through cloning and deep sequencing of small RNA and transcriptome libraries in Arabidopsis thaliana [31,32], Triticum aestivum (wheat; [33]), Solanum lycopersicum (tomato [34]), Oryza sativa (rice), Populus trichocarpa (cotton wood), and Manihot esculenta (Cassava) [35-37]. To date, many varieties of miRNAs are reported in plants, animals, and even microbes [38]. Although miRNAs have been studied in plants for years, no extensive study has yet been performed on Boechera. The objective of this work was thus to identify and completely catalogue conserved plant miRNAs, and to compare the expression pattern of their target genes in the floral tissues of sexual and apomictic Boechera, in order to shed light on the potential role of miRNAs in the switch from sexual to apomictic reproduction. To do so we have cloned, sequenced and validated conserved miRNAs using bioinformatics and microarray techniques, and have analyzed these data using sexual and apomictic EST libraries (sequenced using 454 FLX technology) and comparative expression profiles between microdissected ovules from sexual and apomictic genotypes [39,40].

Results and Discussion

Homology of miRNAs to Boechera ESTs

The BLASTn search using a reference set of 8433 non-redundant known conserved plant miRNAs against flower-specific sexual and apomictic Boechera EST libraries led to the identification of 282 sexual and 301 apomictic transcripts with high homology to miRNAs of other plant species (Figure 1). Of these, 13 sexual and 16 apomictic transcripts could fold back into stable hairpins containing conserved miRNAs (Table 1 &2; Additional file 1, Figure S1). Many EST sequences were found that could not fold back into stem loops, although it is unclear whether this was due to the fact that they were not pre-miRNAs or whether this was due to sequencing errors introduced by the 454 FLX system. Predominantly, the less conserved miRNA families (e.g. miR444 to miR869) matched a small number of cDNA sequences which in most cases were found to be truncated precursor sequences in the EST libraries, and thus could not fold into stable stem-loops (Table 1 &2).
Figure 1

Scheme for search of conserved miRNAs in .

Table 1

Characteristics of conserved miRNA families and stem-loops in sexual Boechera genotypes.

miRNA familyMature miRNAsPlant sp., NSsNNARMA+U%AMFEMFEIEST IDEMBL No.
miR156UGACAGAAGAGAGAGAGCACAth, U/A755'54.6728.800.635ET5PU7E02HBOCMFR869734
miR157UUGACAGAAGAGAGAGAGCACSbi, U/A755'54.6728.800.635ET5PU7E02HBOCMFR869734
miR159UUUGGUUUGAAGGAAGCUCUAAth, A/U, G/A-----ETM6Q5C04I3XE2aFR869757
miR160UGCCUGGCUCCCUGUAUGCCAAth-----ET5PU7E02JH8DIaFR869730
miR161UGAAAGUGACUACAUCGGGGUAth925'55.4324.670.554ET5PU7E02IM9YAFR869722
miR164UGGAGAAGCAGGGCACGUAAAGar-----ETM6Q5C04IAM5VaFR869752
miR166CCGGACCAGGCUUCAUCCCAGPta-----ET5PU7E02JKLSIaFR869725
miR167UGAAGCUGCCAGCAUGAUCUAAth1005'60.0048.201.201ETM6Q5C03GWWM2FR869745
miR170UGAUUGAGCCGCGCCAAUAUCAth-----ETM6Q5C03GVN0GaFR869746
miR172AGAAUCCUGAUGAUGCUGCAUAth, U/C-----ET5PU7E02GZHSBaFR869721
miR319UUGGAAUGAAGGGAGCUCCACAth, A/C, U/A, U/C-----ETM6Q5C03FYJ8YaFR869740
miR394UUGGCAUUCUGUCCACCUCCAth1165'57.7646.461.100ET5PU7E02IYKJ5FR869733
miR395AUGAAGAGUUUGGAGGAACUCOsa, U/A-----ETM6Q5C03FTE98aFR869741
miR396UCCACAGGCUUUCUUGAACGGGhr1435'41.9638.370.661ET5PU7E02GM4DSFR869731
miR398UGUGAUCUCAGGUAACCCCUUAth, U/A, C/A-----ETM6Q5C04IDRCBaFR869755
miR399UGCCAAAGGAGAUAUGCCCUAAth, U/A, G/A-----ET5PU7E02FZ073aFR869726
miR400UAUGAGAGUAUUAUAUGUCACAth, A/U763'60.5315.790.400ET5PU7E02JJRIAFR869735
miR403UUAGAUUCACGCACAAACUCCAth, G/C755'57.3324.930.584ET5PU7E02I3RXEFR869723
miR408AUGCACUGCCUCUUCCCUGGCAth1483'58.7833.580.815ETM6Q5C04JX15CFR869749
miR414UCAUCAUCAUCAUCAUCGUCGUCAUCAUCAUCAUCAUCGUCAUCAUCAUCAUCAUCAUCGUCAAth, U/A, A/GAth, U/AAth, U/A1702212335'3'3'51.1851.0156.6529.2923.6224.640.6000.4820.568ET5PU7E02IZWR4ET5PU7E02GNU3FET5PU7E02I14IEFR869738FR869727FR869724
miR415GACAGAGAAGAAACAGAACAUAth, A/G, C/A-----ETM6Q5C03FIL8CaFR869748
miR444UUGCUGCCUCAAGCUCCCGGCZma, U/C, U/G-----ETM6Q5C04IXD3La FR869750
miR482UCUUCCCUACACCGCCCAUACGso, U/G-----ET5PU7E02HNZGIaFR869720
miR529GCUCUUCCCUCUCUCUUCUUCOsa, C/G, G/C, A/U-----ET5PU7E02HC551aFR869729
miR824UAGACCAUUUGUGAGAAGAGAAth, G/A-----ETM6Q5C04ISA8KaFR869754
miR835UUUUUCCAUAUGUUCUUUAUCAth, C/U, G/C-----ETM6Q5C04JNEVJaFR869751
miR838UUUUCUUCUACUUCUUCCCCAAth, G/C, A/C-----ETM6Q5C03FOEE6aFR869747
miR841UACGACCCACUGGAAACUGAAAth, G/C, U/G-----ETM6Q5C03HCEISaFR869742
miR845UAGCUCUGAUACCAAAUGAUAVvi, U/A-----ET5PU7E02F58WOaFR869732
miR846UUGAAUUGGAGUGCUUGCAUUAth, A/G, A/C-----ETM6Q5C03FVWRYaFR869743
miR852AAGAUAAGCGCCUUAGGUCUGAth, U/G895'62.9238.311.033ETM6Q5C03G2GJOFR869744
miR854GAUGAGGAGAAGGAGGAGGAGAth, U/G, G/A-----ETM6Q5C04JC8OPaFR869756
miR859UCUCUCUGUUGUGAAAUCAAAAth, G/A-----ET5PU7E02GYEM5aFR869736
miR860UCAGUAGCUUGGACUAUGUAUAth, A/G, A/C-----ETM6Q5C03G8ZLDaFR869739
miR861CCUUGGAGAAAUAUGCUUCAAAth, G/U-----ET5PU7E02IMVALaFR869728
miR865UUUCUCCUCAAAUUUCUCCAAAth, U/C, A/C-----ETM6Q5C04JQMWDaFR869753
miR869CAUGGUUCAAUGCAGGUGCUAGma, U/A, U/C-----ET5PU7E02JV51FaFR869737

Plant sp, NSs, Nucleotide substitutions between known plant query miRNAs and the corresponding miRNA in Boechera sexual species; NN, Number of nucleotides hairpin length; ARM, mature miRNA location in hairpin structure; AMFE, Adjusted minimum fold energy; MFEI, Minimum fold energy index; EST ID, Identifier of the 454 transcripts from which miRNA was derived. Italicized, bold and underlined red letters show nucleotide substitutions in miRNAs of Boechera sexual species. EST could not form secondary stem-loop structures. EMBL No., European Molecular Biology Laboratory accession number; Plant species: Ath, Arabidopsis thaliana; Gar, Gossypium arboreum; Ghr, Gossypium hirsutum; Gma, Glycine max; Gso, Glycine soja; Osa, Oryza sativa; Pta, Pinus taeda; Sbi, Sorghum bicolor; Vvi, Vitis vinifera; Zma, Zea mays.

Table 2

Characteristics of conserved miRNA families and stem-loops in apomictic Boechera genotypes.

miRNA familyMature miRNAsPlant sp., NSsNNARMA+U%AMFEMFEIEST IDEMBL No.
miR156UGACAGAAGAGAGAGAGCACUGACAGAAGAGAGAGAGCACAth, U/AAth, U/A661055'5'53.0352.3830.0025.240.6390.530ETM6Q5C01AY29EET5PU7E01BE5BPFR869781FR869766
miR157UUGACAGAAGAGAGAGGGCACAth, A/G1195'57.9832.100.764ET5PU7E01A5S8VFR869768
miR159UUUGGACUGAAGGGAGCUCCUAth, U/C-----ETM6Q5C02EBWUAaFR869788
miR160UGCCUGGCUCCCUGUAUGCCAAth1105'58.1842.101.007ET5PU7E01AQT2AFR869776
miR161UCAAUGCAUUGAAAGUAACUAAth, G/A-----ETM6Q5C01AMWREaFR869779
miR162UCGAUAAACCUCUGCAUCCAGPtc843'55.9548.451.100ETM6Q5C01AZ87OFR869778
miR166CCGGACCAGGCUUCAUCCCCCPta, A/C, G/C-----ET5PU7E01CXVM2aFR869765
miR167UGAAGCUGCCAGCAUGAUCUAAth1005'60.0048.201.205ETM6Q5C01CA126FR869786
miR169UGAGCCAAGGAUGAUUUGCCUAth, C/U, G/U-----ETM6Q5C01B8RXCaFR869787
miR170UGAUUGAGCCGCGCCAAUAUCAth1213'51.2440.500.831ET5PU7E01EN973FR869761
miR172AGAAUCUUGAUGAUGCUGCAUAth1423'49.3022.390.442ET5PU7E01CV6Q5FR869764
miR319UUGGACUGAAGGGAGCUCCUUAth1843'57.6145.201.066ETM6Q5C02EBWUAFR869788
miR394UUGGCAUUCUGUCAACCUCCAth, C/A1263'57.9419.130.455ET5PU7E01CBSOIFR869772
miR395AUGAAGAGUUUGGAGGAACUCOsa, U/A-----ETM6Q5C02DVQZ4aFR869794
miR396UCCACAGGCUUUCUUGAACGGGhr-----ETM6Q5C02DSTK1aFR869791
miR398UGUGUUCUCAGGUCACCCCUUAth-----ET5PU7E01B8LVWaFR869770
miR400UAUGAGAGUAUUAUAGGUCACAth, A/G-----ET5PU7E01AVMRYaFR869771
miR408AUGCACUGCCUCUUCCCUGGCAth893'52.8139.550.838ET5PU7E01EE6T6FR869769
miR414UCAUCAUCAUCAUCAUCGUCUAth, U/A, A/U2083'57.6916.920.400ET5PU7E01DL36LFR869767
UCAUCAUCAUCAUCAUCGUCGAth, U/A, A/G1705'50.8829.290.603ET5PU7E01BXM22FR869762
UCAUCGUCAUCAUCAUCGUCAAth, U/G1045'63.4629.330.803ET5PU7E01D5L0PFR869759
miR415GACAGAGAAGAAACAGAACAUAth, A/G, C/A1355'56.3024.960.571ETM6Q5C01A4TW0FR869780
miR472UUUUGCCUACUCCACCCAUACCAth, U/G, G/A-----ETM6Q5C01B63E7aFR869782
miR529CUCUUCCCUCUCUCUUCUUCOsa, G/C, A/U-----ETM6Q5C02D6DWQaFR869795
miR776UCUAAUUCUUCUAUUGAUAUUAth, G/U, G/A-----ET5PU7E01CU8R6aFR869774
miR820UCGUACUCGUGGAUGGACCAGOsa, G/U, C/A-----ET5PU7E01CXV4LaFR869760
miR824UAGACCAUUUGUGAGAAGAGAAth, G/A-----ETM6Q5C01BUUMVaFR869777
miR835UUUUUCCAUAUGUUCUUUAUCAth, C/U, G/C-----ET5PU7E01BKF2JaFR869773
miR840ACACUGAAGGAGCUGAACUAAUAth, C/G, A/G. C/U-----ETM6Q5C02C26W5aFR869789
miR841UACGACCCACUGGAAACUGAAAth, G/C, U/G-----ETM6Q5C01B0IVVaFR869785
miR846UUGAAUUGGAGUGCUUGCAUUAth, A/G, A/C-----ETM6Q5C02D2FL9aFR869793
miR854GAUGAUGAUAGUGAGGAGGAGAth, G/U, G/U-----ETM6Q5C01A9E26aFR869783
miR857UUAUGUAUGUUGAAUGUGUAUAth, U/A, G/U-----ETM6Q5C01AWYYJFR869784
miR859UCUCUCUGUUGUGAAAUCAAAAth, G/A-----ET5PU7E01E1HDIa FR869775
miR860UCAGUAGCUUGGACUAUGUAUAth, A/G, A/C-----ETM6Q5C02DJ9H7aFR869790
miR861CCUUGGAGAAAUGUGCUUCAAAth, A/G, G/U2335'51.9331.930.664ET5PU7E01A7VRKFR869763
miR865UUUCUCCUCAAAUUUCUCCAAAth, U/C, A/C-----ETM6Q5C02DTC6WaFR869792
miR869CAUGGUUCAAUGCAGGUGUUAGma, U/A-----ET5PU7E01A48FHaFR869758

Plant sp, NSs, Nucleotide substitutions between known plant query miRNAs and the corresponding miRNA in Boechera apomictic species; NN, Number of nucleotides hairpin length; ARM, mature miRNA location in hairpin structure; AMFE, Adjusted minimum fold energy; MFEI, Minimum fold energy index; EST ID, Identifier of the 454 transcripts from which miRNA was derived. Italicized, bold and underlined red letters show nucleotide substitutions in miRNAs of Boechera apomictic species. EST could not form secondary stem-loop structures. EMBL No., European Molecular Biology Laboratory accession number; Plant species: Ath, Arabidopsis thaliana; Ghr, Gossypium hirsutum; Gma, Glycine max; Osa, Oryza sativa; Pta, Pinus taeda; Ptc, Populus trichocarpa; Sbi, Sorghum bicolor.

Scheme for search of conserved miRNAs in . Characteristics of conserved miRNA families and stem-loops in sexual Boechera genotypes. Plant sp, NSs, Nucleotide substitutions between known plant query miRNAs and the corresponding miRNA in Boechera sexual species; NN, Number of nucleotides hairpin length; ARM, mature miRNA location in hairpin structure; AMFE, Adjusted minimum fold energy; MFEI, Minimum fold energy index; EST ID, Identifier of the 454 transcripts from which miRNA was derived. Italicized, bold and underlined red letters show nucleotide substitutions in miRNAs of Boechera sexual species. EST could not form secondary stem-loop structures. EMBL No., European Molecular Biology Laboratory accession number; Plant species: Ath, Arabidopsis thaliana; Gar, Gossypium arboreum; Ghr, Gossypium hirsutum; Gma, Glycine max; Gso, Glycine soja; Osa, Oryza sativa; Pta, Pinus taeda; Sbi, Sorghum bicolor; Vvi, Vitis vinifera; Zma, Zea mays. Characteristics of conserved miRNA families and stem-loops in apomictic Boechera genotypes. Plant sp, NSs, Nucleotide substitutions between known plant query miRNAs and the corresponding miRNA in Boechera apomictic species; NN, Number of nucleotides hairpin length; ARM, mature miRNA location in hairpin structure; AMFE, Adjusted minimum fold energy; MFEI, Minimum fold energy index; EST ID, Identifier of the 454 transcripts from which miRNA was derived. Italicized, bold and underlined red letters show nucleotide substitutions in miRNAs of Boechera apomictic species. EST could not form secondary stem-loop structures. EMBL No., European Molecular Biology Laboratory accession number; Plant species: Ath, Arabidopsis thaliana; Ghr, Gossypium hirsutum; Gma, Glycine max; Osa, Oryza sativa; Pta, Pinus taeda; Ptc, Populus trichocarpa; Sbi, Sorghum bicolor.

Bioinformatically-identified conserved miRNA families

In all, 44 miRNA families across 67 plant species were found to match at least one Boechera 454 EST read, with A. thaliana being the predominant species (Figure 2). Conserved plant miRNA families in Boechera were identified to a large extent based upon high homology with reported conserved A. thaliana miRNAs (Figure 2). In cases where Boechera and A. thaliana did not share particular miRNA families, a search for conserved miRNA families was performed in other plant species. The predominant miRNA families which shared similarity with the highest number of Boechera 454 reads were miR156, miR157, miR160, miR167 and miR172 (Figure 3). It was observed also that the Boechera miRNAs exhibit a wide variation in the length of pre-miRNA sequences (Table 1 &2; Figure 4, 5, 6 &7). 29 families were found to be common between the sexual and apomictic genotypes. Of these, 17 mature miRNAs (miR156, 160, 167, 170, 172, 395, 396, 408, 415, 529, 824, 835, 841, 846, 859, 860 and 865) were similar in sequence, whereas 12 were different in sequence constitution due to nucleotide differences between the two reproductive modes. These included miRNAs miR157, 159, 161,166, 319, 394, 398, 400, 414, 854, 861 and 869 (Table 1 &2). Pre-miRNA lengths varied from 66 to 233 nucleotides, with most between 66 and 184 nucleotides, a length similar to that of pre-miRNAs in other species. The location of the mature miRNAs in the precursor pre-miRNAs also varied among the miRNA families. In 12 pre-miRNAs, the miRNAs were found in the 3' arm while 18 were in the 5' arm of the stem-loop hairpin structures (Table 1 &2; Figure 4, 5, 6 &7).
Figure 2

Percentage of conserved miRNAs between . Ath, Arabidopsis thaliana; Ptc, Populus trichocarpa; Osa, Oryza sativa; Zma, Zea mays; Mtr, Medicago truncatula; Gma, Glycine max; Sbi, Sorghum bicolor; Vvi, Vitis vinifera; Ppt, Physcomitrella patens; Rco, Ricinus communis; Tae, Triticum aestivum; Ghr, Gossypium hirsutum; Sly, Solanum lycopersicum; Ahy, Arachis hypogaea; Sof, Saccharum officinarum.

Figure 3

Abundance (based on total number of transcripts) of conserved miRNAs in .

Figure 4

Predicted pre-miRNA stem-loops of miR156/157 families with nucleotide substitutions in . Shaded red letters correspond to the sequence of the mature miRNA. Nucleotide substitutions of conserved miRNAs in other plant species compared with the corresponding miRNAs in Boechera species are shown as italicized, bold and underlined blue letters. MiRNA precursors could be slightly longer than the sequences shown in this figure.

Figure 5

Predicted pre-miRNA stem-loops of miRNA families with nucleotide substitutions in . Shaded red letters correspond to the sequence of the mature miRNA. Nucleotide substitutions of conserved miRNAs in other plant species compared with the corresponding miRNAs in Boechera species are shown as italicized, bold and underlined blue letters. MiRNA precursors could be slightly longer than the sequences shown in this figure.

Figure 6

Predicted pre-miRNA stem-loops of miR414 family with nucleotide substitutions in . Shaded red letters correspond to the sequence of the mature miRNA. Nucleotide substitutions of conserved miRNAs in other plant species compared with the corresponding miRNAs in Boechera species are shown as italicized, bold and underlined blue letters. MiRNA precursors could be slightly longer than the sequences shown in this figure.

Figure 7

Predicted pre-miRNA stem-loops of miRNA families with nucleotide substitutions in . Shaded red letters correspond to the sequence of the mature miRNA. Nucleotide substitutions of conserved miRNAs in other plant species compared with the corresponding miRNAs in Boechera species are shown as italicized, bold and underlined blue letters. MiRNA precursors could be slightly longer than the sequences shown in this figure.

Percentage of conserved miRNAs between . Ath, Arabidopsis thaliana; Ptc, Populus trichocarpa; Osa, Oryza sativa; Zma, Zea mays; Mtr, Medicago truncatula; Gma, Glycine max; Sbi, Sorghum bicolor; Vvi, Vitis vinifera; Ppt, Physcomitrella patens; Rco, Ricinus communis; Tae, Triticum aestivum; Ghr, Gossypium hirsutum; Sly, Solanum lycopersicum; Ahy, Arachis hypogaea; Sof, Saccharum officinarum. Abundance (based on total number of transcripts) of conserved miRNAs in . Predicted pre-miRNA stem-loops of miR156/157 families with nucleotide substitutions in . Shaded red letters correspond to the sequence of the mature miRNA. Nucleotide substitutions of conserved miRNAs in other plant species compared with the corresponding miRNAs in Boechera species are shown as italicized, bold and underlined blue letters. MiRNA precursors could be slightly longer than the sequences shown in this figure. Predicted pre-miRNA stem-loops of miRNA families with nucleotide substitutions in . Shaded red letters correspond to the sequence of the mature miRNA. Nucleotide substitutions of conserved miRNAs in other plant species compared with the corresponding miRNAs in Boechera species are shown as italicized, bold and underlined blue letters. MiRNA precursors could be slightly longer than the sequences shown in this figure. Predicted pre-miRNA stem-loops of miR414 family with nucleotide substitutions in . Shaded red letters correspond to the sequence of the mature miRNA. Nucleotide substitutions of conserved miRNAs in other plant species compared with the corresponding miRNAs in Boechera species are shown as italicized, bold and underlined blue letters. MiRNA precursors could be slightly longer than the sequences shown in this figure. Predicted pre-miRNA stem-loops of miRNA families with nucleotide substitutions in . Shaded red letters correspond to the sequence of the mature miRNA. Nucleotide substitutions of conserved miRNAs in other plant species compared with the corresponding miRNAs in Boechera species are shown as italicized, bold and underlined blue letters. MiRNA precursors could be slightly longer than the sequences shown in this figure. Evaluation of the pre-miRNAs was also based on A+U content. The miRNA precursors have A+U content ranging from 41.96 to 63.46% (Table 1 &2; Figure 4, 5, 6 &7), similar to proportions observed in other plant species [41]. Consistent with general notion, the majority of identified Boechera miRNA precursors contain more A+U nucleotides than G+C [42,43]. It is also important to note that the formation of a stem-loop structure is not a unique feature of miRNAs, since other RNAs such as mRNA, rRNA, and tRNA can also form similar structures. For this reason, uniform systems for annotating new miRNAs comprising negative minimal fold energy (MFE), adjusted minimal fold energy (AMFE) and the minimal fold energy index (MFEI) have been developed [42-45] and have become generally accepted. Zhang et al [43] indicated that most identified miRNA precursors have an MFEI greater than 0.85, which is much higher than in tRNA (0.64), rRNA (0.59), or mRNA (0.65). However, a number of pre-miRNAs with lower MFEIs have been reported, provided the number of nucleotide substitutions in the particular conserved miRNA compared with other species does not exceed three (Table 1 &2; [41]).

Microarray analysis of conserved miRNA families

The miRNAs identified from cDNA sequencing of floral tissues, using the bioinformatics described above, were further verified using a proprietary microarray analysis with LC Sciences, in order to validate their expression in sexual and apomictic Boechera flower tissues. The LC Sciences proprietary miRNA microarray chip that was used was designed by spotting all known plant miRNAs that were available in the miRBase Release 14 (total 1117 unique mature miRNAs) and the Plant miRNA Database, PMRD (total 5690 unique mature miRNAs). Subsequently hybridization was performed as described in Methods using isolated enriched Boechera small RNAs to confirm expressed conserved miRNAs. As expected, most (n = 50) mature miRNAs representing 22 miRNA families were identified to be conserved mainly compared to A. thaliana. The microarray assay confirmed 15 conserved families identified with the bioinformatics techniques. It is also noteworthy that 7 and 29 other miRNA families were respectively detected separately by the microarray and bioinformatics approaches (Additional file 2, Figure S2).

Boechera-specific miRNA nucleotide substitutions (NSs) enhance pre-miRNA stem-loop stability

The stability of a secondary structure is quantified as the amount of free energy released or used by forming base pairs. The more negative the free energy of a structure, the more likely is formation of that structure and its stability, because more stored energy is released, and this principle is used to predict the secondary structure of a particular sequence [46,47]. Out of the 30 stable Boechera pre-miRNA stem-loop structures obtained, 19 contain miRNAs with nucleotide substitutions (NSs) when compared with corresponding Arabidopsis or other plant miRNAs. The frequency of A, C and G substitutions were similar between sexual and apomictic mature miRNAs, while U appeared to show a higher rate of substitution in the apomictic mature miRNAs (Figure 8). Considering that a single nucleotide change in the sequence of a target site can affect miRNA regulation, NS could conceivably be under selection pressure to enhance the conformation and thermodynamic stability of the pre-miRNA stem-loop structure. We thus examined whether these Boechera-specific nucleotide changes had any effect on the structure and thermodynamic stability of their corresponding pre-miRNAs.
Figure 8

Frequency of nucleotide substitutions related to .

Frequency of nucleotide substitutions related to . To do this, all pre-miRNAs containing miRNA NSs were selected from the various identified miRNA families (Figure 4, 5, 6 &7). For each pre-miRNA sequence, the Gibbs free energy (ΔG) was calculated using the mfold web server [48]. Importantly, the ΔG comparison was done between a pre-miRNA with the Boechera-specific miRNA sequence, and the same pre-miRNA with the miRNA sequence of (mostly) Arabidopsis, in other words "correcting" the NSs in the Boechera miRNA. In most cases, the Boechera-specific pre-miRNA showed significantly higher (p ≤ 0.05) thermodynamic stability (more negative free energy) than that of the pre-miRNA containing the "corrected" nucleotide substitution (Table 3). Similarly, when the corresponding pre-miRNAs in Arabidopsis/Oryza were "corrected" to Boechera miRNAs, most of the Arabidopsis/Oryza "new pre-miRNA" versions showed significantly lower (p ≤ 0.05) thermodynamic stability compared to the natural pre-miRNAs (Table 4).
Table 3

Boechera miRNA nucleotides substituted with those of Arabidopsis/Oryza.

Pre-miRNANSsNNΔG
Plant sp./BoecheraNatural HP"Corrected" HP

Sexual Species

bsex-MIR156a*U/A75-21.6-19.3
bsex-MIR157aU/A75-21.6-19.3
bsex-MIR396U/G143-55.9-56.8
bsex-MIR400*A/G76-12.0-11.7
bsex-MIR403*G/C75-18.7-15.5
bsex-MIR414* (1)U/A, A/G170-49.8-48.2
bsex-MIR414 (2)U/A221-52.2-56.4
bsex-MIR414 (3)U/A233-57.9-60.0
bsex-MIR852U/G89-34.1-34.7

Apomictic Species
bapo-MIR156a*(1)U/A66-19.8-15.6
bapo-MIR156a*(2)U/A105-27.9-26.7
bapo-MIR157m*A/G119-38.2-31.3
bapo-MIR394aC/A126-23.8-26.2
bapo-MIR414* (1)U/A, A/U208-35.2-34.2
bapo-MIR414* (2)U/A, A/G170-49.8-48.2
bapo-MIR414* (3)U/G104-30.5-29.2
bapo-MIR415*A/G, C/A135-33.8-30.3
bapo-MIR861*A/G, G/U233-79.4-71.4

HP, Hairpin; NN, Number of nucleotides hairpin length; NSs, Nucleotide substitutions. Asterisk indicates cases where "correction" of Boechera miRNA NSs led to less stem-loop stability due to decrease in ΔG. Where there are two or more pre-miRNAs with the same miRNA, they are distinguished by numbers in brackets.

Table 4

Known plant miRNA nucleotides substituted with those of Boechera.

Pre-miRNANucleotide SubstitutionsNNΔG
Plant sp./BoecheraNatural HP"Corrected" HP

ath-MIR156a*U/A123-57.1-52.4
ath-MIR157m*A/G50-10.2-9.3
ath-MIR394*C/A117-53.1-46.6
osa-MIR396*U/G154-64.7-60.1
ath-MIR400*A/U102-38.4-34.3
ath-MIR403*G/C135-38.8-35.4

ath-MIR414U/A, A/G108-22.0-22.3
U/G-22.0-21.8
U/A, A/U-22.0-26.4
U/A-22.0-23.3
U/A, A/G, A/G-22.0-22.4

ath-MIR415*A/G, C/A110-27.0-24.8
ath-MIR852U/G202-80.6-80.8
ath-MIR861*A/G, G/U132-56.3-51.6

HP, Hairpin; NN, Number of nucleotides hairpin length; Asterisk indicates cases where "correction" of Arabidopsis/Oryza miRNA NSs led to less stem-loop stability.

Boechera miRNA nucleotides substituted with those of Arabidopsis/Oryza. HP, Hairpin; NN, Number of nucleotides hairpin length; NSs, Nucleotide substitutions. Asterisk indicates cases where "correction" of Boechera miRNA NSs led to less stem-loop stability due to decrease in ΔG. Where there are two or more pre-miRNAs with the same miRNA, they are distinguished by numbers in brackets. Known plant miRNA nucleotides substituted with those of Boechera. HP, Hairpin; NN, Number of nucleotides hairpin length; Asterisk indicates cases where "correction" of Arabidopsis/Oryza miRNA NSs led to less stem-loop stability. In all, this nucleotide substitution-stability phenomenon was most common in our analyses of both apomictic (8 out of 9 miRNA families) and sexual Boechera (5 out of 9 miRNA families; Table 3), in addition to Arabidopsis (9 out of 11 miRNA families; Table 4). Naturally occurring miRNA NSs thus appear to confer optimal thermodynamic stability on pre-miRNA stem-loop structures in Boechera, and is consistent with similar analyses in other plants. For example, a similar comparison of the ΔG of predicted secondary structures of two variants of barley miR1137 precursor with a C and a G in the 13th position showed differences in stability between the variants [49]. Interestingly, Thakur et al [50] reported that species background may also be correlated with the calculation of both the minimum free energy and miRNA hairpin stability, although this difference appeared to be manifested at the level of mono- and dicots. Thus, at least with respect to the comparisons between closely related Boechera and Arabidopsis used here, our data imply that natural selection has guided sequence variation in these regulatory elements. In one case pre-miRNA stability was also manifested on the intraspecific level, comparing sexual and apomictic Boechera. In the family miR394, the pre-miRNA of the sexual Boechera species has the same miRNA sequence as in Arabidopsis, however that of the apomictic species shows one C to A NS change at position seven (Figure 5A). The pre-miRNA stability was examined by introducing the apomictic NS into the sexual sequence at the same position and ΔGs compared. As expected there was a decrease in the negative ΔG by 6.5 kcal/mol in the "new" sexual pre-miRNA with the introduced apomictic NSs, suggesting that the sexual pre-miRNA is perhaps at its optimal thermodynamic stable state. This final evidence is consistent with trans-acting regulatory differences between sexual and apomictic ovules, the result of sequence variation in regulatory factors in the sexual (homozygous) versus apomictic (hybrid) genomes, as suggested by Sharbel et al [40].

Conserved Boechera miRNAs target many transcription factors (TFs)

The BLAST analyses here have revealed many potential regulatory gene targets. Consistent with the results of functional studies in other plant species, such as Arabidopsis, rice and corn [26,51,52], the majority (40%) of target proteins in Boechera are transcription factors (Table 5; Additional file 3 Table S1). Transcription factors (TF) have been estimated in rice to be about 70% of conserved miRNA targets, while in wheat it has been predicted to be 35% [33,53]. The other targets are mostly associated with plant metabolism, development, signal transduction and response to environmental stress including cold, salinity, drought and nutritional deficiency [35,29,54,55].
Table 5

Transcription factor targets of conserved miRNA families in Boechera species.

miRNA familyTarget proteinFunction of targetTarget gene (UPE)E-value
miR156/157Squamosa promoter binding protein like
SPL11Transcription factorAT1G27360 (11.430)1
SPL 2AT5G43270 (11.987)1
SPL10AT1G27370 (12.296)1
SPL15AT3G57920 (14.449)1
SPL 9AT2G42200 (16.239)1
SPL6AT1G69170 (17.076)1
miR159Myb domain protein 120 (MYB120); DNA bindingTranscription factorAT5G55020 (7.049)3.5
miR160Auxin Response Factor 10 (ARF10); transcription factorTranscription factorAT2G28350 (18.139)1
miR167Auxin response factor 8 (ARF8)Transcription factorAT5G37020 (17.281)3.5
miR169CCAAT-binding transcription factor (CBF-B/NF-YA) subunit BTranscription factorATIG17590 (18.910)2
MiR170/171Scarecrow transcription factor family proteinTranscription factorAT3G60630 (14.202)1
miR172RAP2.7, TOE1 | RAP2.7 (RELATED TO AP2.7) DNA bindingTranscription factorAT2G28550 (16.639)1.5
miR319TCP10 (TCP Domain Protein 10)Transcription factorAT2G31070 (10.122)3.5
TCP4 (TCP family transcription factor 4)Transcription factorAT3G15030 (13.479)3.5
miR396AtGRF4 (Growth regulating factor 4)Transcription activatorAT3G52910 (14.357)2
miR408TIL1 (TILTED 1); DNA binding/DNA-directed DNA polymerase/nucleic acid binding/nucleotide binding/zinc ion bindingTranscription factorAT1G08260 (15.881)4
miR414WRKY DNA -binding domainTranscription factorAT4G31550

(UPE; Maximum energy to unpair the target site, UPE range: 0.0-25.0; E-value range: 0.0-4.0)

Transcription factor targets of conserved miRNA families in Boechera species. (UPE; Maximum energy to unpair the target site, UPE range: 0.0-25.0; E-value range: 0.0-4.0) The EST libraries from which the Boechera miRNAs were mined were flower-specific [39,40], and expectedly, a number of identified TF-targeting miRNAs have been associated with flower development in other species. For example, miR156 and miR157, the homologues of the squamosa-promoter binding proteins and whose function is well conserved across plant species [43], were identified in both apomictic and sexual Boechera (Table 5; Additional file 3, Table S1). In Arabidopsis these TF regulatory miRNAs have been reported to regulate the Antirrhinum floral meristem identity squamosa promoter binding protein-like (SPL) genes [56]. Other TF regulatory miRNA families which have regulatory roles during flower development in other species were also identified (Table 5; Additional file 3, Table S1), including miR156, miR159, miR164 and miR172, which have been implicated in the control of LFY expression, floral organ identity, and flowering time [27,57,58]. miR172 has furthermore been reported to regulate stem cell fate, and defines the inner boundary of the APETALA3 and PISTILLATA expression domains in Arabidopsis floral meristems [38]. A number of well-defined TF targeting miRNAs were also identified in Boechera. For example, miR160 and miR167 (Table 5; Additional file 3, Table S1) are associated with post-transcriptional regulation of the A. thaliana auxin response transcription factor (ARF) family genes [26,59]. miR319 is known to regulate the expression of TCP transcription factor genes whose down-regulations cause abnormalities in leaf development [16]. Vierstra [60] showed that miR394 regulates the messages of F-box proteins, which in turn target specific proteins for proteolysis by making them substrates for ubiquitination by SCF E3 ubiquitin ligases. Growth Regulating Factor genes, the targets of the miR396 family, are putative transcription factors that regulate cell expansion in leaf and cotyledon [61]. Argonaute, one of the important proteins in the regulation of miRNA biogenesis, is a target of miR403 whereas miR408 regulates a copper ion binding protein. The miR414 family regulates a number of other genes including the transcription factors, transducin family protein/WD-40 repeat family protein and peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein.

Expression patterns of transcription factor (TF) targets and apomixis in Boechera

The switch from sexual to apomictic seed production is hypothesized to involve global regulatory changes during ovule development which are induced by hybridization and/or polyploidy [9,62], both common characteristics of apomictic plants and parthenogenetic animals. Using data from a previously-published SuperSAGE analysis [39,40], the ovule expression patterns of putative target TFs for the miRNAs identified here were compared between sexual and apomictic Boechera across four ovule developmental stages. Of the 17 TFs identified as potential miRNA targets, expression data for 6 were found in the SuperSAGE libraries, including: the squamosa promoter binding protein like SPL6, SPL11 and SPL15, Myb domain protein 120 (MYB120), RAP2.7, TOE1 RAP2.7 (RELATED TO AP2.7) DNA binding and TCP10 (TCP family transcription factor 10), which are targets of the miRNA families miR156/157, miR159, miR172 and miR319 respectively. It is noteworthy that, whereas the other genes showed no significant differential expression levels between sexual and apomictic species, SPL11 was found to be significantly (p ≤ 0.05) up-regulated at the stage two of ovule development in apomictic species in all libraries studied (Figure 9). SPL11 also showed low level expression in all the other apomictic ovule stages and at only stage two of the sexual ovules. Using six apomictic and five sexual genotypes of Boechera, the differential expression of SPL11 at ovule stage two of floral development was further validated using quantitative Real Time-PCR. With the exception of a single sexual B. divaricarpa from Mule Ranch, Montana, all apomictic accessions clearly showed relatively higher expression of SPL11 than the sexuals (Figure 10), result which is consistent with the expression pattern observed with the SPL11 SuperSAGE tag (Figure 9). The single sexual outlier (Figure 10) for SLP11 implies that the expression pattern of this TF may not be a key factor associated with apomixis expression, but rather is associated with DNA sequence variation in regulatory factors in the hybrid B. divaricarpa. Alternatively, population-level variation for TF expression could be associated with the penetrance of the apomictic phenotype, which has been shown to be genotype-specific in Boechera [63].
Figure 9

Expression of transcription factors across . Refer to Sharbel et al. [40] for descriptions of ovule stages.

Figure 10

Relative differential expression of SPL11 transcription factor in stage two of apomictic and sexual ovules.

Expression of transcription factors across . Refer to Sharbel et al. [40] for descriptions of ovule stages. Relative differential expression of SPL11 transcription factor in stage two of apomictic and sexual ovules.

Conclusions

This study constitutes the first extensive insight into the conservation and expression of miRNAs in Boechera sexual and apomictic species. Of the expressed miRNA transcription factor targets observed, only the miR156/157 family target squamosa promoter binding protein-like 11 (SPL11) was found differentially expressed with significant (p ≤ 0.05) up-regulation at the stage two of ovule development in apomictic species. Also demonstrated here is that nucleotide changes in mature miRNAs significantly (p ≤ 0.05) enhance the thermodynamic stability of pre-miRNA stem-loops. This work will enhance subsequent elucidation of the repertoire of miRNA expression in Boechera towards revealing the potential role of miRNAs in the switch from sexual to apomictic reproduction.

List of abbreviations

AGO, argonaute; ESTs, expressed sequence tags; GSS, genome survey sequences; miRNA, microRNA; miRISC, miRNA-induced silencing complex; MFE, minimum fold energy; MFEI, minimal fold energy index; AMFE, adjusted minimal fold energy; PMRD, plant miRNA database; TAIR, arabidopsis information resource; SBP, squamosa promoter binding protein; qRT-PCR, quantitative reverse transcription PCR.

Methods

Flower-specific Boechera 454 cDNA libraries used

Floral cDNA libraries used in this study are those previously reported by Sharbel et al. [39,40]. These libraries were sequenced from pooled flower stages 1-12 [64] of three diploid sexual plants (Accessions ES910-2-2 K, 105.6-1 K and B07261) and three apomictic plants (Accessions 67.5-K, 300.6.1-1 K and 218.2-2 K).

Conserved miRNA reference set for bioinformatics procedures

A total of 9274 previously reported non-redundant 21-24 nucleotides long miRNAs (including their precursor sequences) collected from 121 plant species were obtained from the Plant MicroRNAs Database (PMRD as of February 8, 2011; [65]). These miRNAs were defined as a reference set of miRNA sequences for the identification of potentially conserved miRNAs in Boechera. To avoid redundant miRNAs, duplicated miRNAs shared between different species within the database were removed. In all, 8433 non-redundant miRNAs were obtained, and these were used as query sequences for a BLASTn search against all original 454 sequence reads from the apomictic and sexual Boechera libraries.

Identification of conserved miRNAs

The bioinformatics approaches used for identification of conserved miRNAs in Boechera species are outlined in Figure 1. The length of the EST sequences used to search for conserved miRNAs ranged between 51 and 478 nucleotides, with about 80% of them around 200 nucleotides long. In order to exclude all ESTs having exact matches to tRNA or rRNA sequences from further BLASTn searches, the sexual and apomictic EST libraries were first queried against ribosomal RNAs database from Rfam (http://www.sanger.ac.uk/Software/Rfam/) and the Arabidopsis transfer RNAs database (http://lowelab.ucsc.edu/GtRNAdb/Athal/). Rather than using the miRNA precursors for BLASTn searches against our databases, the analysis was based mainly on the mature miRNA sequences considering that only mature miRNAs are highly conserved in plants [42,43]. The following BLASTn parameters which gave the highest and most reliable number of hits (blastall -p blastn -m 8 -e 1 -W 7 -r 1 -q -1 -i) were used. All resulting EST sequences with an alignment length of 20-24 nucleotides, three or fewer mismatches and no gaps compared to previously identified plant miRNAs were selected and compared with each other to eliminate redundancies. The obtained non-redundant sequences were then used for the prediction of secondary structures and screening for miRNA precursor sequences. The secondary structures of pre-miRNAs were generated using the Mfold 3.2 software, which is based on Zuker folding algorithm principles [48]. The secondary structure of candidate pre-miRNA sequences were analysed and scored for their potential to form miRNA precursors. A stem-loop was selected as a candidate miRNA precursor if it satisfied most of the following generally accepted criteria: (1) the mature miRNA is 20-24nt with a maximum of three mismatches compared with the corresponding known miRNA in other plant species; (2) the miRNA precursor (pre-miRNA) sequence folds into a stable hairpin structure such that one arm of the hairpin contains the mature miRNA sequence; (3) the predicted secondary structure of the pre-miRNA has lower minimal free energy (MFE ≤-10 kcal/mol) and minimal free energy index (MFEI) than other types of RNA (e.g. tRNA, rRNA); (4) the predicted mature miRNA has an A+U content of 40-70%; and (5) no loop or gap in the mature miRNA sequences [41].

Microarray validation of conserved plant miRNAs

The bioinformatically-identified miRNAs in floral tissues were further verified using a proprietary microarray analysis with LC Sciences, USA. The microarray assay was performed using 4 to 8 μg total RNA sample from pooled flower tissues of sexual and apomictic genotypes. The total RNA was size fractionated using a YM-100 Microcon centrifugal filter (Millipore) and the isolated small RNAs (< 300 nt) were 3'-extended with a poly(A) tail using poly(A) polymerase. An oligonucleotide tag was then ligated to the poly(A) tail for later fluorescent dye staining, and two different tags were used for two RNA samples in dual-sample experiments. Hybridization was performed overnight on a μParaflo microfluidic chip [spotted with all known plant mature miRNAs that were available in miRBase Release 14 (total 1117 unique mature miRNAs) and the Plant miRNA Database (total 5690 unique mature miRNAs)] using a micro-circulation pump (Atactic Technologies; [66]). On the microfluidic chip, each detection probe consisted of a chemically modified nucleotide coding segment complementary to a target miRNA, and a spacer segment of polyethylene glycol to extend the coding segment away from the substrate. The detection probes were made by in situ synthesis using PGR (photogenerated reagent) chemistry. The hybridization melting temperatures were balanced by chemical modifications of the detection probes, and hybridization was performed using 100 μL 6 × SSPE buffer (0.90 M NaCl, 60 mM Na2HPO4, 6 mM EDTA, pH 6.8) containing 25% formamide at 34°C. After RNA hybridization, tag-conjugating Cy3 and Cy5 dyes were circulated through the microfluidic chip for dye staining. The fluorescence data were collected on an Axon GenePix 4000B Microarray Scanner, and then analysed by first subtracting the background followed by normalization of the signals using a LOWESS filter (Locally-weighted Regression; [67]). A detectable miRNA on the array was identified if its signal intensity was higher than 3×(background standard deviation) and spot CV < 0.5, and p < 0.01 for the difference between Cy3 and Cy5 signals (LC Sciences).

Prediction of Boechera gene targets of miRNA families

A BLASTn search (blastall -p blastn -m 8 -e 1 -W 7 -r 1 -q -1 -i) was employed to detect complementarity between the validated miRNAs and predicted target ESTs in sexual and apomictic Boechera (Additional file 3, Table S1). Putative miRNA targets were identified based on the total numbers of mismatched nucleotides between miRNAs and the alignment structures of potential targets. To identify potential regulatory targets, a BLAST search (blastall -p blastn -m 8 -e 1 -W 7 -r 1 -q -1 -i) was performed using the validated (from LC Sciences) conserved Boechera miRNAs against the A. thaliana protein-coding nucleotide databases (TAIR9 cDNA) using the miRU web server [68] from the Arabidopsis Information Resource (TAIR). The total number of allowed mismatches at complementary sites between miRNA sequences and potential mRNA targets in Arabidopsis were limited to a maximum of three, and no gaps were allowed at complementary sites. Finally, the Boechera homologues of potential targeted genes in Arabidopsis were chosen using a BLAST search (blastall -p blastn -m 8 -e 1 -W 7 -r 1 -q -1 -i) based on the degree of similarity of protein-coding mRNAs between A. thaliana and Boechera.

Expression analysis of Transcription factor (TF) targets using SuperSAGE tags

Finally, a comparative gene expression analysis of TF targets from 11 miRNA families was carried out. First, a BLASTn search using TF genes from Arabidopsis against the assembled Boechera EST database was performed (blastall -p blastn -m 8 -e 1 -W 7 -r 1 -q -1 -i). For each Arabidopsis TF, homologous Boechera TFs with an alignment having a bit score ≥100 were selected. Next, 100% sequence matches between the Boechera TFs and expression tags from 8 ovule-specific Boechera SuperSAGE libraries [40] were found using a BLASTn search. Finally, the expression patterns of the selected Boechera TFs corresponding to the obtained SuperSAGE tags were compared across four different ovule developmental stages between a sexual and apomictic Boechera genotype [40].

Quantitative RT-PCR validation of differential SPL11 expression in ovule stage two of Boechera flowers

Six accessions of apomictic and five of sexual Boechera were selected for the validation the differential expression of SPL11 (Additional file 4, Table S2). From these accessions, stage two ovules were micro-dissected, RNAs isolated and cDNAs prepared as described in Sharbel et al. [40]. The forward primer 5'-CAAAGTGCCCAAAAGTTACCGTGAGT-3' and reverse primer 5'-ACGCCTCGCATTATGATGAGAAAGA-3' with amplicon size of 137 nucleotides long were used for the qRT-PCR. Primers were designed avoiding intronic regions (to ensure the elimination of likely DNA contamination in samples) using the following parameters: temperature; 60°C, 20% < CG content < 80%, and PCR product size < 150 bp. For the real-time PCR reactions, the SYBR Green PCR Master Mix (Applied Biosystems) was used. qRT-PCR amplifications were performed in a 7900 HT Fast RT-PCR system (Applied Biosystems) with the following temperature profile for SYBRgreen assays: initial denaturation at 90°C for 10 min, followed by 40 cycles of 95°C for 15 s, and 60°C for 1 min. The Ct, defined as the PCR cycle at which a statistically significant increase of reporter fluorescence is first detected, was used as a measure for the starting copy numbers of the target gene. The mean expression level and standard deviation for each set of three technical replicates for each cDNA was calculated. Relative quantitation and normalization of the amplified targets were performed by the comparative ΔΔCt method in reference to the expression levels of the housekeeping gene ubiquitin [69].

Authors' contributions

SA: Project development, bioinformatics, microarray analysis and draft of manuscript. JMC: Project development, analytical supervision and sample preparation. HV: Project development and sample preparation. TFS: Project development, bioinformatics and draft of manuscript. All authors have read and approved the final manuscript.

Additional file 1

. List of predicted pre-miRNA structures of conserved miRNAs identified in Boechera species. Click here for file

Additional file 2

. Grouping of miRNA families identified by bioinformatics and microarray assay. Click here for file

Additional file 3

Predicted miRNA targets. Gene targets of conserved miRNA families in Boechera species. Click here for file

Additional file 4

. Boechera genotypes used for qRT-PCR validation of differential SPL11 expression. Click here for file
  61 in total

1.  mRNAs have greater negative folding free energies than shuffled or codon choice randomized sequences.

Authors:  W Seffens; D Digby
Journal:  Nucleic Acids Res       Date:  1999-04-01       Impact factor: 16.971

Review 2.  The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins.

Authors:  Richard D Vierstra
Journal:  Trends Plant Sci       Date:  2003-03       Impact factor: 18.313

Review 3.  Apomixis: a developmental perspective.

Authors:  Anna M Koltunow; Ueli Grossniklaus
Journal:  Annu Rev Plant Biol       Date:  2003       Impact factor: 26.379

Review 4.  In situ synthesis of oligonucleotide microarrays.

Authors:  Xiaolian Gao; Erdogan Gulari; Xiaochuan Zhou
Journal:  Biopolymers       Date:  2004-04-05       Impact factor: 2.505

5.  The miRNA156/157 recognition element in the 3' UTR of the Arabidopsis SBP box gene SPL3 prevents early flowering by translational inhibition in seedlings.

Authors:  Madhuri Gandikota; Rainer P Birkenbihl; Susanne Höhmann; Guillermo H Cardon; Heinz Saedler; Peter Huijser
Journal:  Plant J       Date:  2007-01-08       Impact factor: 6.417

6.  Evolution of Arabidopsis thaliana microRNAs from random sequences.

Authors:  Felipe Fenselau de Felippes; Korbinian Schneeberger; Tobias Dezulian; Daniel H Huson; Detlef Weigel
Journal:  RNA       Date:  2008-10-24       Impact factor: 4.942

7.  Widespread translational inhibition by plant miRNAs and siRNAs.

Authors:  Peter Brodersen; Lali Sakvarelidze-Achard; Marianne Bruun-Rasmussen; Patrice Dunoyer; Yoshiharu Y Yamamoto; Leslie Sieburth; Olivier Voinnet
Journal:  Science       Date:  2008-05-15       Impact factor: 47.728

8.  Quantitative variation for apomictic reproduction in the genus Boechera (Brassicaceae).

Authors:  Olawale M Aliyu; M Eric Schranz; Timothy F Sharbel
Journal:  Am J Bot       Date:  2010-09-27       Impact factor: 3.844

9.  miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floral meristems.

Authors:  Li Zhao; YunJu Kim; Theresa T Dinh; Xuemei Chen
Journal:  Plant J       Date:  2007-06-15       Impact factor: 6.417

10.  Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes.

Authors:  Milo J Aukerman; Hajime Sakai
Journal:  Plant Cell       Date:  2003-10-10       Impact factor: 11.277

View more
  16 in total

1.  Genome-wide identification and characterization of miRNAs in the hypocotyl and cotyledon of cauliflower (Brassica oleracea L. var. botrytis) seedlings.

Authors:  Meijuan Geng; Hui Li; Chuan Jin; Qian Liu; Chengbin Chen; Wenqin Song; Chunguo Wang
Journal:  Planta       Date:  2013-10-30       Impact factor: 4.116

2.  The conserved chimeric transcript UPGRADE2 is associated with unreduced pollen formation and is exclusively found in apomictic Boechera species.

Authors:  Martin Mau; José M Corral; Heiko Vogel; Michael Melzer; Jörg Fuchs; Markus Kuhlmann; Nico de Storme; Danny Geelen; Timothy F Sharbel
Journal:  Plant Physiol       Date:  2013-10-15       Impact factor: 8.340

Review 3.  The genetic control of apomixis: asexual seed formation.

Authors:  Melanie L Hand; Anna M G Koltunow
Journal:  Genetics       Date:  2014-06       Impact factor: 4.562

4.  Computational identification of conserved microRNAs and their putative targets in the Hypericum perforatum L. flower transcriptome.

Authors:  Giulio Galla; Mirko Volpato; Timothy F Sharbel; Gianni Barcaccia
Journal:  Plant Reprod       Date:  2013-07-12       Impact factor: 3.767

5.  Generation of an integrated Hieracium genomic and transcriptomic resource enables exploration of small RNA pathways during apomixis initiation.

Authors:  David S Rabiger; Jennifer M Taylor; Andrew Spriggs; Melanie L Hand; Steven T Henderson; Susan D Johnson; Karsten Oelkers; Maria Hrmova; Keisuke Saito; Go Suzuki; Yasuhiko Mukai; Bernard J Carroll; Anna M G Koltunow
Journal:  BMC Biol       Date:  2016-10-06       Impact factor: 7.431

6.  Diplosporous development in Boehmeria tricuspis: Insights from de novo transcriptome assembly and comprehensive expression profiling.

Authors:  Qing Tang; Gonggu Zang; Chaohua Cheng; Mingbao Luan; Zhigang Dai; Ying Xu; Zemao Yang; Lining Zhao; Jianguang Su
Journal:  Sci Rep       Date:  2017-04-06       Impact factor: 4.379

7.  High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot.

Authors:  Zhihong Gao; Ting Shi; Xiaoyan Luo; Zhen Zhang; Weibing Zhuang; Liangju Wang
Journal:  BMC Genomics       Date:  2012-08-03       Impact factor: 3.969

8.  Apomictic and sexual germline development differ with respect to cell cycle, transcriptional, hormonal and epigenetic regulation.

Authors:  Anja Schmidt; Marc W Schmid; Ulrich C Klostermeier; Weihong Qi; Daniela Guthörl; Christian Sailer; Manuel Waller; Philip Rosenstiel; Ueli Grossniklaus
Journal:  PLoS Genet       Date:  2014-07-10       Impact factor: 5.917

9.  Genome-scale mRNA and small RNA transcriptomic insights into initiation of citrus apomixis.

Authors:  Jian-Mei Long; Zheng Liu; Xiao-Meng Wu; Yan-Ni Fang; Hui-Hui Jia; Zong-Zhou Xie; Xiu-Xin Deng; Wen-Wu Guo
Journal:  J Exp Bot       Date:  2016-09-12       Impact factor: 6.992

10.  Apomixis Technology: Separating the Wheat from the Chaff.

Authors:  Diego Hojsgaard
Journal:  Genes (Basel)       Date:  2020-04-10       Impact factor: 4.096

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.