Literature DB >> 21958395

Curcumin is a potent modulator of microglial gene expression and migration.

Marcus Karlstetter1, Elena Lippe, Yana Walczak, Christoph Moehle, Alexander Aslanidis, Myriam Mirza, Thomas Langmann.   

Abstract

BACKGROUND: Microglial cells are important effectors of the neuronal innate immune system with a major role in chronic neurodegenerative diseases. Curcumin, a major component of tumeric, alleviates pro-inflammatory activities of these cells by inhibiting nuclear factor kappa B (NFkB) signaling. To study the immuno-modulatory effects of curcumin on a transcriptomic level, DNA-microarray analyses were performed with resting and LPS-challenged microglial cells after short-term treatment with curcumin.
METHODS: Resting and LPS-activated BV-2 cells were stimulated with curcumin and genome-wide mRNA expression patterns were determined using DNA-microarrays. Selected qRT-PCR analyses were performed to confirm newly identified curcumin-regulated genes. The migration potential of microglial cells was determined with wound healing assays and transwell migration assays. Microglial neurotoxicity was estimated by morphological analyses and quantification of caspase 3/7 levels in 661W photoreceptors cultured in the presence of microglia-conditioned medium.
RESULTS: Curcumin treatment markedly changed the microglial transcriptome with 49 differentially expressed transcripts in a combined analysis of resting and activated microglial cells. Curcumin effectively triggered anti-inflammatory signals as shown by induced expression of Interleukin 4 and Peroxisome proliferator activated receptor α. Several novel curcumin-induced genes including Netrin G1, Delta-like 1, Platelet endothelial cell adhesion molecule 1, and Plasma cell endoplasmic reticulum protein 1, have been previously associated with adhesion and cell migration. Consequently, curcumin treatment significantly inhibited basal and activation-induced migration of BV-2 microglia. Curcumin also potently blocked gene expression related to pro-inflammatory activation of resting cells including Toll-like receptor 2 and Prostaglandin-endoperoxide synthase 2. Moreover, transcription of NO synthase 2 and Signal transducer and activator of transcription 1 was reduced in LPS-triggered microglia. These transcriptional changes in curcumin-treated LPS-primed microglia also lead to decreased neurotoxicity with reduced apoptosis of 661W photoreceptor cultures.
CONCLUSIONS: Collectively, our results suggest that curcumin is a potent modulator of the microglial transcriptome. Curcumin attenuates microglial migration and triggers a phenotype with anti-inflammatory and neuroprotective properties. Thus, curcumin could be a nutraceutical compound to develop immuno-modulatory and neuroprotective therapies for the treatment of various neurodegenerative disorders.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21958395      PMCID: PMC3192695          DOI: 10.1186/1742-2094-8-125

Source DB:  PubMed          Journal:  J Neuroinflammation        ISSN: 1742-2094            Impact factor:   8.322


Background

Microglial cells are resident macrophages of the nervous system with pivotal roles in innate immune regulation and neuronal homeostasis [1,2]. They are cells of the mononuclear phagocyte lineage but their unique localization within the nervous system and their morphological features clearly distinguish them from other macrophage populations [3]. Ramified microglial cells actively scan their environment with their long protrusions [4,5] and continuous inhibitory signals from neurons prevent microglial toxicity [6,7]. Disconnection of the microglia-neuron cross-talk [8], local danger signals such as released ATP [9], or neurotransmitter gradients [10] can lead to a functional transformation of microglial populations with a variety of effector functions. Consequently, alarmed microglia and reactive microgliosis have been identified in a variety of neurodegenerative diseases including Alzheimer's disease [11], Parkinson's disease [12], amyotrophic lateral sclerosis [13], multiple sclerosis [14], and inherited photoreceptor dystrophies [15]. The concept of a microglia-targeted pharmacotherapy to prevent neurodegeneration in the brain and the retina is therefore a promising approach under active investigation [16,17]. There is a growing interest in the identification of natural compounds that limit neuroinflammation and simultaneously support neuronal survival [18,19]. Among the naturally occuring immuno-modulators, curcumin ((E, E)-1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione), a major constituent of tumeric, is a herbal medicine used for centuries in India and China [20]. Curcumin has a wide range of pharmacological activities including anti-inflammatory, anti-microbial, antioxidant, and anti-tumor effects [21]. Curcumin is a particularly potent immuno-regulatory agent that can modulate the activation and function of T-cells, B-cells, neutrophils, natural killer cells and macrophages [22]. Curcumin treatment effectively inhibits the activation of microglial cells by diminishing the production of nitric oxide [23] and reducing the secretion of pro-inflammatory cytokines such as IL1β, IL6 and TNF [24]. Moreover, curcumin blocks the LPS-mediated induction of cyclooxygenase-2 (COX2) via inhibition of the transcription factors nuclear factor kappa B (NFkB), activator protein 1 (AP1), and signal transducers and activators of transcription (STATs) [25,26]. Recent experiments have also demonstrated that curcumin protects dopaminergic neurons against microglia-mediated neurotoxicity [27], limits brain inflammation [28], and rescues retinal cells from stress-induced cell death [29]. The inhibitory role of curcumin on pro-inflammatory gene expression in microglia is well documented. However, this information is limited to only a few well-studied examples including pro-inflammatory cytokines, Nos2 and COX2. In a genome-wide search for target genes, we investigated the transcriptomic effects of curcumin in resting and LPS-activated BV-2 microglial cultures using DNA-microarrays. Furthermore, we validated the curcumin-regulated expression of microglial transcripts with qRT-PCR and studied the related microglial migration and neurotoxicity.

Methods

Reagents

Curcumin and E.coli 0111:B4 lipopolysaccharide were purchased from Sigma Aldrich (Steinheim, Germany). Curcumin was dissolved in DMSO and added in concentrations that did not exceed 0.05% of the total volume in any of the cell culture experiments.

Cell culture

BV-2 microglia-like cells were provided by Professor Ralph Lucius (Clinic of Neurology, Christian Albrechts University, Kiel, Germany). BV-2 cells were cultured in RPMI/5% FCS supplemented with 2 mM L-Glutamine and 195 nM β-mercaptoethanol. BV-2 cells were stimulated with 100 ng/ml LPS, 20 μM of curcumin, or DMSO as control for 6 h. These stimulation conditions were adapted from previously published experiments [24,30]. MTT assays revealed that 100 ng/ml LPS, 20 μM curcumin, or a combination of both had no cytotoxic effects on BV-2 cells (data not shown). 661W photoreceptor-like cells were a gift from Prof. Muayyad Al-Ubaidi (University of Illinois, Chicago, IL) and the culture conditions have been described elsewhere [31].

Scratch assay

500.000 BV-2 cells were grown in 6-well plates as 80% confluent monolayers and were wounded with a sterile 100 μl pipette tip. Thereafter, the cells were stimulated with 100 ng/ml LPS, 20 μM of curcumin, 100 ng/ml LPS + 20 μM of curcumin, or DMSO as solvent control. Migration into the open scar was documented with microphotographs at different time points after wounding. The number of migrating cells was quantified by counting all cells within a 0.4 mm2 region in the center of each scratch. A minimum of 5 individual cultures was used to calculate the mean migratory capacity of each cell culture condition.

Transwell migration assay

The Costar Transwell System (8-μm pore size polycarbonate membrane) was used to evaluate vertical cell migration. 1 Mio BV-2 cells in 1.5 ml serum-free medium were added to the upper well, and 2.6 ml serum-free medium was added to the lower chamber. 100 ng/ml LPS, 20 μm curcumin, 100 ng/ml LPS + 20 μm curcumin, or DMSO as solvent control were added to the lower chamber medium. At the end of a 24 h incubation period, cells that had migrated to the lower surface were quantified by counting the migrated cells on the lower surface of the membrane using microscopy.

661W co-culture in microglia-conditioned medium and apoptosis assay

To test microglial neurotoxicity, a culture system of 661W photoreceptors with microglia conditioned medium was established. 661W cells were incubated for 48 h either in their own medium or with culture supernatants from unstimulated, 100 ng/ml LPS, 20 μM curcumin, or 100 ng/ml LPS + 20 μM curcumin treated microglial cells. The 661W cell morphology was assessed by phase contrast microscopy and apoptotic cell death was determined with the Caspase-Glo® 3/7 Assay (Promega). Cells were lysed and incubated with a luminogenic caspase-3/7 substrate, which contains the tetrapeptide sequence DEVD. Luminescence was then generated by addition of recombinant luciferase and was proportional to the amount of caspase activity present. The luminescent signal was read on a BMG FluoStar Optima plate reader (Labtech, Offenburg, Germany). A blank reaction was used to measure background luminescence associated with the cell culture system and Caspase-Glo® 3/7 Reagent. The value for the blank reaction was subtracted from all experimental values. Negative control reactions were performed to determine the basal caspase activity of 661W cells. Relative luciferase units (RLU) reflect the level of apoptotic cell death in the different 661W cell cultures.

RNA isolation and reverse transcription

Total RNA was extracted from cultured microglial cells according to the manufacturer's instructions using the RNeasy Protect Mini Kit (Qiagen, Hilden, Germany). Purity and integrity of the RNA was assessed on the Agilent 2100 bioanalyzer with the RNA 6000 Nano LabChip® reagent set (Agilent Technologies, Böblingen, Germany). The RNA was quantified spectrophotometrically and then stored at -80°C. First-strand cDNA synthesis was performed with RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany).

DNA-microarray analysis

4 × 44 K microarrays (014868) (Agilent Technologies) were used for hybridization with three independent RNAs from non-stimulated BV-2 microglial cells or cultures treated for 6 h with 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS, respectively. Briefly, 200 ng of total RNA were labeled with Cy3 using the Agilent Quick-Amp Labeling Kit - 1 color according to the manufacturer's instructions. cRNA was purified with the RNeasy Mini Kit (Qiagen) and labeling efficiency was determined with a NanoDrop ND-1000 photometer (PeqLab). The arrays were incubated with cRNAs in Agilent SureHyb chambers for 17 hours at 65°C while rotating. After washing, scanning was done with the Agilent G2565CA Microarray Scanner System and the resulting TIFF files were processed with Agilent Feature Extraction software (10.7.). Minimum information about a microarray experiment (MIAME) criteria were met [32]. The microarray dataset of this study is publicly available at the National Center for Biotechnology Information Gene Expression Omnibus http://www.ncbi.nlm.nih.gov/geo/ as series record GSE23639.

Bioinformatic data analysis

Integrative analysis of genome-wide expression activities from BV-2 cells was performed with the Gene Expression Dynamics Inspector (GEDI), a Matlab (Mathworks, Natick, MA) freeware program which uses self-organizing maps (SOMs) to translate high-dimensional data into a 2D mosaic [33]. Each tile of the mosaic represents an individual SOM cluster and is color-coded to represent high or low expression of the cluster's genes, thus identifying the underlying pattern. The Partek Genomics Suite (Partek Inc.) was used for ANOVA analysis and hierarchical clustering of normalized expression values. Differentially regulated transcrips in curcumin-stimulated versus non-treated and curcumin + LPS versus LPS-treated BV-2 cells, respectively, were retrieved with the Genomatix ChipInspector program (Genomatix Software GmbH, Munich, Germany), applying the Significance Analysis of Microarray (SAM) algorithm using a false-discovery rate of 0.1%.

Quantitative real-time RT-PCR

Amplifications of 50 ng cDNA were performed with an ABI7900HT machine (Applied Biosystems) in triplicates in 10 μl reaction mixtures containing 1×TaqMan Universal PCR Master Mix (Applied Biosystems), 200 nM of primers and 0.25 μl dual-labeled probe (Roche ProbeLibrary). The reaction parameters were as follows: 2-min 50°C hold, 30-min 60°C hold, and 5-min 95°C hold, followed by 45 cycles of 20-s 94°C melt and 1-min 60°C anneal/extension. Measurements were performed in triplicate. Results were analyzed with an ABI sequence detector software version 2.3 using the ΔΔCt method for relative quantitation. A Ct (cycle threshold) < 35 was used as cutoff for estimating significantly expressed transcripts and cDNA samples with values > 35 were marked with n.e. for not expressed. Ct-values between 35 and 40 were solely used for calculation of relative expression differences in treated cells versus control cells. Primer sequences and Roche Library Probe numbers are listed in Table 1.
Table 1

Primer pairs and Roche library probes for real-time qRT-PCR validation

GeneF-Primer (5'-3')R-Primer (5'-3')Roche Library Probe
Atp5bggcacaatgcaggaaaggtcagcaggcacatagatagcc77
C3accttacctcggcaagtttctttgtagagctgctggtcagg76
Ccl2catccacgtgttggctcagatcatcttgctggtgaatgagt62
Dll1ttcaactgtgagaagaagatggatgccgaggtccacacactt103
Egr2ctacccggtggaagacctcaatgttgatcatgccatctcc60
Il4catcggcattttgaacgagcgagctcactctctgtggtg2
Il6gatggatgctaccaaactggatccaggtagctatggtactccaga6
Nos2ctttgccacggacgagactcattgtactctgagggctga13
Ntng1aggggcaagagaccaaggagggatggtgtctatcgtcct103
Pecam1cggtgttcagcgagatcccgacaggatggaaatcacaa45
Perp1tcatatgccggctcacctatccactggcgtctggagt110
Pparαccgagggctctgtcatcagggcagctgactgaggaa11
Ptgs2gatgctcttccgagctgtgggattggaacagcaaggattt45
Stat1aaatgtgaaggatcaagtcatgtgcatcttgtaattcttctagggtcttga15
Tlr2accgaaacctcagacaaagccagcgtttgctgaagagga49
Primer pairs and Roche library probes for real-time qRT-PCR validation

Statistical analyses

Statistical analyses were performed on ΔΔCt data using the Mann-Whitney Rank Sum test and quantitative expression data are expressed as mean ± SD plotted at a logarithmic scale. Gene expression levels in control BV-2 cells were used as calibrators. The Student's t test or Mann-Whitney Rank Sum test were used for the comparison of experimental groups in cell migration assays and apoptosis assays as indicated. p < 0.05 was considered significant.

Results

Curcumin has a major impact on the microglial transcriptome

To determine the transcriptional profiles of resting and LPS-activated BV-2 microglial cells after treatment with 20 μM curcumin for 6 h, we performed DNA-microarray analyses from three independent stimulations. We first applied the Gene Expression Dynamics Inspector (GEDI) on the complete dataset to visualize the global patterns of gene expression in the four different conditions, untreated, curcumin-treated, LPS-treated, and curcumin + LPS-treated cells. GEDI uses self-organizing maps to capture genome-wide transcriptome activity via 'gestalt' recognition [33]. GEDI facilitates the identification of genome-wide patterns with each mosaic tile in the map representing a gene cluster that is expressed at similar levels. The four GEDI maps, with blue color indicating low and red color high mRNA expression levels, show a dynamic regulation of gene transcription in the cultured microglial cells (Figure 1A). The major difference between curcumin-treated resting microglial cells and control cells was a region with higher expression at the bottom of the map (Figure 1A, white rectangles). In the LPS-treated condition, mimicking a highly activated state, curcumin elicited a largely converse expression pattern with a pronounced area of weakly expressed genes (Figure 1A, white circles). These data indicate that curcumin stimulates gene expression in resting, non-activated cells but mainly dampens activation-associated transcriptional programs in LPS-primed microglia.
Figure 1

Curcumin influences global gene expression in resting and LPS-activated BV-2 microglial cells. (A) Gene Expression Dynamics Inspector (GEDI) analysis of the complete DNA-microarray dataset from control BV-2 cells or cells treated with 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 6 hours. The white rectangles and circles denote the most prominent expression changes in corresponding gene clusters. (B) Hierarchical clustering of normalized expression levels after one-way ANOVA at p < 0.01. Triplicate microarrays were analyzed for each condition and the pseudo-color scale indicates high (red) or low (blue) expression levels. LPS and curcumin-related clusters are marked with A and B, respectively.

Curcumin influences global gene expression in resting and LPS-activated BV-2 microglial cells. (A) Gene Expression Dynamics Inspector (GEDI) analysis of the complete DNA-microarray dataset from control BV-2 cells or cells treated with 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 6 hours. The white rectangles and circles denote the most prominent expression changes in corresponding gene clusters. (B) Hierarchical clustering of normalized expression levels after one-way ANOVA at p < 0.01. Triplicate microarrays were analyzed for each condition and the pseudo-color scale indicates high (red) or low (blue) expression levels. LPS and curcumin-related clusters are marked with A and B, respectively. We next calculated hierarchical clusters of each individual microarray dataset after filtering for significantly altered gene expression using one way ANOVA at p < 0.01. This analysis showed a clear separation of the four different conditions with their own characteristic gene expression profiles (Figure 1B). The clustering revealed two distinct groups of inversely regulated genes. Group A (Figure 1B) contains LPS-induced genes, which are no longer up-regulated in the presence of curcumin. Group B (Figure 1B) represents genes selectively up-regulated by curcumin treatment of resting microglial cells. Together with the GEDI analysis, these results demonstrate that stimulation with curcumin impacts distinct patterns of gene expression in resting and LPS-activated microglial cells, respectively. To narrow down the identified global gene clusters to a subset of genes with significantly different mRNA expression in the different curcumin-treated conditions, we used the Genomatix ChipInspector tool applying the Significance Analysis of Microarray (SAM) algorithm at a false discovery rate of 0.1% and a minimum fold change of 2.0 [34]. Thereby, 35 significantly regulated transcripts were identified in curcumin-treated versus resting microglial cells (Table 2) and 30 differentially expressed genes were detected in curcumin + LPS versus LPS-stimulated cells (Table 3). Comparison of the total numer of differentially expressed transcripts and considering overlapping gene sets revealed that curcumin affects both resting and LPS-activated BV-2 cells.
Table 2

Differentially expressed transcripts after 6 h stimulation of BV-2 cells with 20 μM curcumin

NrIDSymbolGene NameFC
UP-REGULATED
180883Ntng1Netrin G1313.0
218613Pecam1Platelet/endothelial cell adhesion molecule 142.8
313388Dll1Delta-like 135.5
412824Col2a1Collagen, type II, alpha 121.6
514103FaslFas ligand (TNF superfamily, member 6)12.8
612653ChgbChromogranin B11.9
766184Rps4y2Ribosomal protein S4, Y-linked 29.7
869816Perp1RIKEN cDNA 2010001M09 gene9.7
916992LtaLymphotoxin A9.4
1019206Ptch1Patched homolog 15.9
1119013PparaPeroxisome proliferator activated receptor alpha4.6
12109685Hyal3Hyaluronoglucosaminidase 34.5
1320997TBrachyuri4.2
1417246Mdm2Transformed mouse 3T3 cell double minute 23.1
1514102FasFas2.8
1614183Fgfr2Fibroblast growth factor receptor 22.7
1713645EgfEpidermal growth factor2.2
1814179Fgf8Fibroblast growth factor 82.1
1920655Sod1Superoxide dismutase 12.1
2014526GcgGlucagon2.0
DOWN-REGULATED
124088Tlr2Toll-like receptor 2-6.9
218505Pax3Paired box gene 3-6.6
314281FosFBJ osteosarcoma oncogene-4.4
411622AhrAryl-hydrocarbon receptor-4.1
516835LdlrLow density lipoprotein receptor-3.8
613654Egr2Early growth response 2-3.5
768010BambiBMP and activin membrane-bound inhibitor-3.3
812048Bcl2l1BCL2-like 1-3.3
919225Ptgs2Prostaglandin-endoperoxide synthase 2-3.0
1020296Ccl2Chemokine (C-C motif) ligand 2-2.8
1112393Runx2Runt related transcription factor 2-2.8
1217311KitlKit ligand-2.4
1316869Lhx1LIM homeobox protein 1-2.4
1412977Csf1Colony stimulating factor 1-2.4
1520528Slc2a4Solute carrier family 2, member 4-2.2

Significance analysis of triplicate microarrays was performed with a false discovery rate of 0.1%. ID, Entrez Gene ID; FC: Fold change.

Table 3

Differentially expressed transcripts after 6 h stimulation with 20 μM curcumin + 100 ng/ml LPS versus 100 ng/ml LPS

NrIDSymbolGene NameFC
UP-REGULATED
180883Ntng1Netrin G186.2
218613Pecam1Platelet/endothelial cell adhesion molecule 111.7
312824Col2a1Collagen, type II, alpha 19.0
412653ChgbChromogranin B8.1
514103FaslFas ligand (TNF superfamily, member 6)6.9
619206Ptch1Patched homolog 16.5
769816Perp1RIKEN cDNA 2010001M09 gene5.4
814526GcgGlucagon5.0
9109685Hyal3Hyaluronoglucosaminidase 34.1
1016189Il4Interleukin 43.8
1120655Sod1Superoxide dismutase 13.5
1219013PparaPeroxisome proliferator activated receptor alpha3.1
1320997TBrachyuri2.6
14640627Gm9789ENSMUSG000000442272.6
1516147IhhIndian hedgehog homolog2.6
1617246Mdm2Transformed mouse 3T3 cell double minute 22.5
1799439Duox1Dual oxidase 12.3
18257956Olfr1307Olfactory receptor 13072.3
1914179Fgf8Fibroblast growth factor 82.1
DOWN-REGULATED
116193Il6Interleukin 6-93.1
218126Nos2Nitric oxide synthase 2-55.7
319225Ptgs2Prostaglandin-endoperoxide synthase 2-17.6
420296Ccl2Chemokine (C-C motif) ligand 2-14.7
512266C3Complement C3-9.1
620846Stat1Signal transducers and activator of transcription 1-7.4
712048Bcl2l1BCL2-like 1-5.4
814281FosFBJ osteosarcoma oncogene-4.6
916835LdlrLow density lipoprotein receptor-4.1
1016992LtaLymphotoxin A-3.5
1117395Mmp9Matrix metallopeptidase 9-2.2

Significance analysis of triplicate microarrays was performed with a false discovery rate of 0.1%. ID, Entrez Gene ID; FC: Fold change.

Differentially expressed transcripts after 6 h stimulation of BV-2 cells with 20 μM curcumin Significance analysis of triplicate microarrays was performed with a false discovery rate of 0.1%. ID, Entrez Gene ID; FC: Fold change. Differentially expressed transcripts after 6 h stimulation with 20 μM curcumin + 100 ng/ml LPS versus 100 ng/ml LPS Significance analysis of triplicate microarrays was performed with a false discovery rate of 0.1%. ID, Entrez Gene ID; FC: Fold change.

qRT-PCR confirmation of novel curcumin target genes in microglial cells

To validate selected differentially expressed genes identified by DNA-microarrays, real-time qRT-PCR assays were performed with RNA samples from three independent BV-2 stimulation series. We especially focused on genes which have not been previously shown to be curcumin targets. In the first set of experiments, mRNA levels of genes highly up-regulated by curcumin compared to control cells were assessed (Figure 2). Transcripts of Netrin G1 (Ntng1), Platelet endothelial cell adhesion molecule 1 (Pecam1), Delta-like 1 (Dll1), Plasma cell endoplasmic reticulum protein 1 (Perp1), Peroxisome proliferator activated receptor alpha (PPARα), and Interleukin 4 (Il4) were all significantly increased by stimulation with curcumin (Figure 2). Ntng1 showed the strongest expression difference with a change of more than 1800-fold. Perp1 and PPARα transcripts were not significantly expressed in resting microglia and were switched on to intermediate levels after curcumin treatment (Figure 2). All six transcripts after combined LPS/curcumin treatment remained similarly high as after curcumin stimulation alone, indicating that the effects of curcumin persist in activated microglial cells.
Figure 2

Curcumin induces genes related to adhesion and anti-inflammatory response. Real-time qRT-PCR validation of transcripts in BV-2 microglia stimulated with 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 6 hours. Relative mRNA levels were quantified for Netrin G1 (Ntng1), Platelet endothelial call adhesion molecule 1 (Pecam1), Delta-like 1 (Dll1), Plasma cell induced endoplasmic reticulum protein 1 (Perp1), Peroxisome proliferator activated receptor α (PPARα), and Interleukin 4 (Il4). Expression was normalized to the control gene Atp5b and mRNA levels (+/- SD) are graphed relative to control cells. Results are calculated from three independent experiments performed in triplicate measurements. * p ≤ 0.05, *** p ≤ 0.001 for curcumin vs. control, Mann-Whitney Rank Sum test. n.e., not expressed.

Curcumin induces genes related to adhesion and anti-inflammatory response. Real-time qRT-PCR validation of transcripts in BV-2 microglia stimulated with 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 6 hours. Relative mRNA levels were quantified for Netrin G1 (Ntng1), Platelet endothelial call adhesion molecule 1 (Pecam1), Delta-like 1 (Dll1), Plasma cell induced endoplasmic reticulum protein 1 (Perp1), Peroxisome proliferator activated receptor α (PPARα), and Interleukin 4 (Il4). Expression was normalized to the control gene Atp5b and mRNA levels (+/- SD) are graphed relative to control cells. Results are calculated from three independent experiments performed in triplicate measurements. * p ≤ 0.05, *** p ≤ 0.001 for curcumin vs. control, Mann-Whitney Rank Sum test. n.e., not expressed. In the next series of qRT-PCR experiments, down-regulated transcripts known to be involved in pro-inflammatory activation of microglial cells were analyzed. Toll-like receptor 2 (Tlr2), Early growth response 2 (Egr2), Prostaglandin endoperoxide synthase 2 (Ptgs2, alias Cox2), and Chemokine (C-C-motif) ligand 2 (Ccl2, alias Mcp1) showed diminished transcript levels in curcumin-treated resting BV-2 cells (Figure 3A). In the activated state, microglial cells also had the tendency to expressed lower amounts of these transcript but only Ccl2 levels reached the level of statistical significance. When LPS-activated BV-2 cells were incubated in the presence of curcumin, transcription of Interleukin 6 (Il6), nitric oxide synthase 2 (Nos2, alias iNos), Signal transducer and activator of transcription 1 (Stat1), and Complement factor C3 (C3) were all repressed (Figure 3B).
Figure 3

Curcumin potently blocks pro-inflammatory gene expression. Real-time qRT-PCR validation of transcripts in BV-2 microglia stimulated with 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 6 hours. Relative mRNA levels were quantified for (A) Toll-like receptor 2 (Tlr2), Early growth response 2 (Egr2), Prostaglandin endoperoxide synthase 2 (Ptgs2), Chemokine ligand 2 (Ccl2), and (B) Interleukin 6 (Il6), Nitric oxide synthase 2 (Nos2, alias iNos), Signal transducer and activator of transcription 1 (Stat1), Complement C3 (C3). Expression was normalized to the control gene Atp5b and mRNA levels (+/- SD) are graphed relative to control cells. Results are calculated from three independent experiments performed in triplicate measurements. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001 for curcumin vs. control, and # p ≤ 0.05, ## p ≤ 0.01 for curcumin + LPS vs. LPS, Mann-Whitney Rank Sum test.

Curcumin potently blocks pro-inflammatory gene expression. Real-time qRT-PCR validation of transcripts in BV-2 microglia stimulated with 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 6 hours. Relative mRNA levels were quantified for (A) Toll-like receptor 2 (Tlr2), Early growth response 2 (Egr2), Prostaglandin endoperoxide synthase 2 (Ptgs2), Chemokine ligand 2 (Ccl2), and (B) Interleukin 6 (Il6), Nitric oxide synthase 2 (Nos2, alias iNos), Signal transducer and activator of transcription 1 (Stat1), Complement C3 (C3). Expression was normalized to the control gene Atp5b and mRNA levels (+/- SD) are graphed relative to control cells. Results are calculated from three independent experiments performed in triplicate measurements. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001 for curcumin vs. control, and # p ≤ 0.05, ## p ≤ 0.01 for curcumin + LPS vs. LPS, Mann-Whitney Rank Sum test.

Curcumin has an inhibitory effect on microglial migration

The induction of several transcripts related to cell motility and adhesion (Ntng1, Pecam1, and Perp1) prompted us to study the effect of curcumin on microglial migration. We first cultured BV-2 microglia on plastic dishes until 80% confluence and then created a scratch with a pipette tip. 12 hours after stimulation of resting microglia or LPS-activated cells with 20 μM of curcumin, migration into the cell-free scratch area was documented. Representative microscopic images clearly showed that curcumin-treated resting cells as well as activated BV-2 cells exhibit a highly reduced migratory potential (Figure 4A). The statistical analysis of five independent experiments revealed a significantly reduced number of migrating cells when curcumin was present in the culture medium (Figure 4B). As an independent measure of microglial cell motility and to study the long term effects of curcumin, we performed transwell migration assays over a period of 24 hours. Similar as in the scratch assays, the migratory capacity of BV-2 cells was not changed by the activation agent LPS alone (Figure 4C). In both, the resting and the activated microglial phenotype, curcumin caused a significant attenuation of microglial migration (Figure 4C). These results indicate that curcumin-mediated signaling events have functional consequences related to microglial motility.
Figure 4

Curcumin reduces microglial migration. (A, B) Scratch assays in BV-2 microglia treated with solvent control, 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 12 hours. (A) Micrographs from one representative experiment out of five independent experiments are shown. (B) Results of scratch assayss are calculated mean values ± SEM from five independent experiments. (C) Transwell chamber migration of BV-2 microglial cells treated with solvent control, 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 24 hours. The absolute number of migrating cells was counted in the lower chamber and mean values ± SEM are displayed. p ≤ 0.05 for curcumin vs. control, and # p ≤ 0.05 for curcumin + LPS vs. LPS, Student's t test.

Curcumin reduces microglial migration. (A, B) Scratch assays in BV-2 microglia treated with solvent control, 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 12 hours. (A) Micrographs from one representative experiment out of five independent experiments are shown. (B) Results of scratch assayss are calculated mean values ± SEM from five independent experiments. (C) Transwell chamber migration of BV-2 microglial cells treated with solvent control, 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS for 24 hours. The absolute number of migrating cells was counted in the lower chamber and mean values ± SEM are displayed. p ≤ 0.05 for curcumin vs. control, and # p ≤ 0.05 for curcumin + LPS vs. LPS, Student's t test.

Curcumin inhibits LPS-induced microglial neurotoxicity

To test whether the transcriptomic changes in curcumin-stimulated cells influence microglial neurotoxicity, 661W photoreceptor cells were incubated with conditioned medium from BV-2 cells. 661W is a retinoblastoma-derived cell line, which represents an established model to study microglial neurotoxicity in the special context of retinal degeneration [30,31,35]. 661W cells were incubated for 48 h with culture supernatants from unstimulated, curcumin-, LPS- or LPS + curcumin-treated BV-2 cells and 661W photoreceptor cell morphology was assessed by phase contrast microscopy. 661W cells in their own medium grew in a spindle-like shape with only few rounded apoptotic cells (Figure 5A). Conditioned media from control- or curcumin-treated microglial cells did not affect this morphology (Figure 5A). In contrast, 661W cells incubated with LPS-stimulated BV-2 supernatant appeared apoptotic, leading to larger cell-free areas in the culture (Figure 5A). When conditioned media from LPS + curcumin-stimulated BV-2 cells was used, a nearly normal 661W cell morphology was retained (Figure 5A). Direct incubation of 661W cells with curcumin, LPS, or both had no effects on the cell cultures (data not shown), demonstrating that the observed changes in 661W cell characteristics stem from secreted microglial compounds.
Figure 5

Curcumin reduces microglial neurotoxicity on photoreceptors. (A) Phase contrast micrographs showing morphological changes of 661W photoreceptor cell cultures treated with conditioned media from BV-2 cells for 48 hours. The supernatant from control-stimulated, 20 μM curcumin-treated, 100 ng/ml LPS-treated, or 20 μM curcumin + 100 ng/ml LPS-treated cells was added to 661W photoreceptor cells, respectively. The micrographs shown are from one representative experiment out of three independent experiments with the same tendencies. (B) Apoptosis-related caspase 3/7 activation in 661W photoreceptor cells incubated with conditioned media from control-stimulated, 20 μM curcumin-treated, 100 ng/ml LPS-treated, or 20 μM curcumin + 100 ng/ml LPS-treated BV-2 cells. Results are calculated from three independent experiments performed in duplicate measurements. * p ≤ 0.05 for LPS vs. control and # p ≤ 0.05 for curcumin + LPS vs. LPS, respectively, Mann-Whitney Rank Sum test. RLU, relative luciferase units.

Curcumin reduces microglial neurotoxicity on photoreceptors. (A) Phase contrast micrographs showing morphological changes of 661W photoreceptor cell cultures treated with conditioned media from BV-2 cells for 48 hours. The supernatant from control-stimulated, 20 μM curcumin-treated, 100 ng/ml LPS-treated, or 20 μM curcumin + 100 ng/ml LPS-treated cells was added to 661W photoreceptor cells, respectively. The micrographs shown are from one representative experiment out of three independent experiments with the same tendencies. (B) Apoptosis-related caspase 3/7 activation in 661W photoreceptor cells incubated with conditioned media from control-stimulated, 20 μM curcumin-treated, 100 ng/ml LPS-treated, or 20 μM curcumin + 100 ng/ml LPS-treated BV-2 cells. Results are calculated from three independent experiments performed in duplicate measurements. * p ≤ 0.05 for LPS vs. control and # p ≤ 0.05 for curcumin + LPS vs. LPS, respectively, Mann-Whitney Rank Sum test. RLU, relative luciferase units. To corroborate these morphological findings with further functional data, we analyzed the influence of microglia-derived products on caspase-related apoptotic cell death. 661W cells cultured with supernatants from LPS-stimulated BV-2 cells showed a significant induction of caspase 3/7 activity (Figure 5B). When using conditioned media from microglial cells co-treated with LPS + curcumin, 661W apoptosis was still present but was significantly diminished (Figure 5B). These data clearly implicate that curcumin may limit the production of pro-apoptotic compounds in activated microglial cells or even promote the release of neurotrophic factors.

Discussion

Oxidative stress and neuroinflammation are major factors in the pathogenesis of neurodegenerative disorders [36]. Therefore, antioxidant and anti-inflammatory compounds like curcumin may be treatment options for this group of diseases [37]. However, only few experimental data are available that report on curcumin-triggered transcriptional mechanisms and direct signaling targets in microglia. Our transcriptomic analysis in BV-2 cells sheds some light on target genes and potential signaling mechanisms. We identified a prominent transcriptional response of resting as well as LPS-activated microglial cells after curcumin treatment. Distinct gene clusters were detected that reflect up-regulated and suppressed transcripts in both microglial phenotypes. We identifed and validated six genes that were constistently induced in resting as well as activated BV-2 cells that have not been described as curcumin targets before. Among these, four curcumin target genes are related to cell migration. Netrin G1 is a lipid-anchored protein that is structurally related to the netrin family of axon guidance molecules [38]. It regulates synaptic interactions between neurons by binding to transmembrane netrin G ligands [39]. Interestingly, the related Netrin 1 molecule is a broad inhibitor of leukocyte chemotaxis [40] and Netrin G1 may have a similar function in microglia. The adhesion molecule PECAM1 is also directly involved in monocyte/macrophage migration [41]. Another migration-related gene induced by curcumin is Plasma cell endoplasmic reticulum protein 1. PERP 1 is a molecular chaperone required for proper folding and secretion of immunoglobulins in B-cells [42,43]. Related to our study, a recent report linked PERP 1 (alias MZB1) to calcium signaling, activation of integrins and cell adhesion [44]. Expression of the Notch-ligand Delta-like 1 has been demonstrated in BV-2 cells and primary rat brain microglial cells, where Notch-1 signaling negatively regulates TNF release [45]. Our data show that basal Dll1 expression in resting microglial cells can be potently induced by curcumin, which could potentially trigger Notch-signaling to prevent migration associated with pro-inflammatory priming of BV-2 cells. These transcriptomic data of curcumin-treatment promoted us to analyze its effects on microglial motility. Both types of assays, the wound healing assays and the transwell migration experiments, showed that BV-2 cell migration was significantly inhibited by 20 μM curcumin over a period of 12 hours to 24 hours. These findings are in good agreement with papers reporting reduced migration of tumor cells, endothelial cells, and dendritic cells after treatment with comparable doses of cucumin [46-48]. In the homeostatic state, microglia constantly scan their environment with their long protrusions without movement of the somata [5]. In contrast, migration of microglial cells is a hallmark of pro-inflammatory and chronic activation during early phases of neurodegeneration. Thus, curcumin may support the homeostatic state of microglia and prevent their early and excessive transformation into migrating phagocytes. It is well known that curcumin broadly inhibits pro-inflammatory gene expression by targeting different signal pathways and transcriptional regulators including NFkB, AP1, EGR1, and STAT3 [49]. Our microarray data corroborate these findings especially in LPS-activated BV-2 cells by showing curcumin-triggered suppression of Ptgs2, Ccl2, Il6, and Nos2, which are NFkB, AP1, and STAT3 target genes [21]. Moreover, the curcumin-regulated transcriptomic profiles revealed lower gene expression of toll-like receptor 2 in resting microglia and complement factor 3 in activated cells. These two factors broadly support the conversion of microglial cells to the pro-inflammatory state [50,51] and hence curcumin signaling may abrogate both pathways. Our data also showed diminished mRNA expression of the transcription factors Egr2 and Stat1 following curcumin-treatment. This indicates that curcumin may further dampen microglial activation by interfering with two other key transcription factors expressed in activated microglial cells. In addition to its inhibitory effects on pro-inflammatory signaling, two well known anti-inflammatory molecules, PPARα and IL4, were significantly induced by curcumin. PPARα and IL4 both specifically inhibit pro-inflammatory activation of microglial cells [52,53] and some of the immune-dampening effects of curcumin may be mediated via this signaling axis. The cell culture experiments with conditioned media from BV-2 cells showed that curcumin significantly reduced LPS-triggered microglial neurotoxicity on 661W photoreceptor cells. We hypothesize that the strong suppression of LPS-induced Nos2 transcription by curcumin is a major pathway responsible for this phenomenon. In this context, Mandal et al. have recently demonstrated that curcumin protects 661W cells from hydrogen peroxide-induced cell death [29]. This effect is very likely mediated by the antioxidant and radical-scavenging capacity of curcumin. In a model of light-induced retinal degeneration, curcumin also suppressed inflammatory marker expression in vivo [29], which could be potentially mediated by its attenuating effect on retinal microglia.

Conclusions

We have shown that curcumin triggered global changes in the transcriptome of resting and LPS-activated microglial cells. In addition to its known function in blocking pro-inflammatory gene expression via interference with NFkB signaling, curcumin induced novel anti-inflammatory targets in microglia. Curcumin also significantly inhibited microglial migration and cytotoxicity, which are key features of neuroinflammation. Our publicily avialable dataset provides a basis to understand the pleiotropic beneficial effects of curcumin on microglia as key innate immune cells of the nervous system. Moreover, the results of this study also underscore the importance of curcumin as a promising dietary compound for the treatment of various neurodegenerative disorders associated with inflammation.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

MK, EL, and YW carried out cell culture stimulations and qRT-PCR experiments. MK and EL analyzed qRT-PCR and functional data. CM performed microarray analysis. AA performed scratch assays. MM critically read and corrected the paper. TL designed the study, obtained funding, carried out biostatistical analyses of microarrays and wrote the manuscript. All authors read and approved the final manuscript.
  53 in total

1.  Minimum information about a microarray experiment (MIAME)-toward standards for microarray data.

Authors:  A Brazma; P Hingamp; J Quackenbush; G Sherlock; P Spellman; C Stoeckert; J Aach; W Ansorge; C A Ball; H C Causton; T Gaasterland; P Glenisson; F C Holstege; I F Kim; V Markowitz; J C Matese; H Parkinson; A Robinson; U Sarkans; S Schulze-Kremer; J Stewart; R Taylor; J Vilo; M Vingron
Journal:  Nat Genet       Date:  2001-12       Impact factor: 38.330

2.  Gene Expression Dynamics Inspector (GEDI): for integrative analysis of expression profiles.

Authors:  Gabriel S Eichler; Sui Huang; Donald E Ingber
Journal:  Bioinformatics       Date:  2003-11-22       Impact factor: 6.937

Review 3.  Control of myeloid activity during retinal inflammation.

Authors:  Andrew D Dick; Debra Carter; Morag Robertson; Cathryn Broderick; Edward Hughes; John V Forrester; Janet Liversidge
Journal:  J Leukoc Biol       Date:  2003-08       Impact factor: 4.962

Review 4.  Can consuming flavonoids restore old microglia to their youthful state?

Authors:  Saebyeol Jang; Rodney W Johnson
Journal:  Nutr Rev       Date:  2010-12       Impact factor: 7.110

5.  Constitutive retinal CD200 expression regulates resident microglia and activation state of inflammatory cells during experimental autoimmune uveoretinitis.

Authors:  Cathryn Broderick; Robert M Hoek; John V Forrester; Janet Liversidge; Jonathon D Sedgwick; Andrew D Dick
Journal:  Am J Pathol       Date:  2002-11       Impact factor: 4.307

Review 6.  The unfolding tale of PECAM-1.

Authors:  Denise E Jackson
Journal:  FEBS Lett       Date:  2003-04-10       Impact factor: 4.124

7.  The netrin-G1 ligand NGL-1 promotes the outgrowth of thalamocortical axons.

Authors:  John C Lin; Wei-Hsien Ho; Austin Gurney; Arnon Rosenthal
Journal:  Nat Neurosci       Date:  2003-11-02       Impact factor: 24.884

Review 8.  An inflammatory review of Parkinson's disease.

Authors:  C F Orr; D B Rowe; G M Halliday
Journal:  Prog Neurobiol       Date:  2002-12       Impact factor: 11.685

9.  Curcumin suppresses Janus kinase-STAT inflammatory signaling through activation of Src homology 2 domain-containing tyrosine phosphatase 2 in brain microglia.

Authors:  Hee Young Kim; Eun Jung Park; Eun-Hye Joe; Ilo Jou
Journal:  J Immunol       Date:  2003-12-01       Impact factor: 5.422

10.  Curcumin suppresses lipopolysaccharide-induced cyclooxygenase-2 expression by inhibiting activator protein 1 and nuclear factor kappab bindings in BV2 microglial cells.

Authors:  Gu Kang; Pil-Jae Kong; Young-Jin Yuh; So-Young Lim; Sung-Vin Yim; Wanjoo Chun; Sung-Soo Kim
Journal:  J Pharmacol Sci       Date:  2004-03       Impact factor: 3.337

View more
  37 in total

1.  Curcumin and its derivatives: their application in neuropharmacology and neuroscience in the 21st century.

Authors:  Wing-Hin Lee; Ching-Yee Loo; Mary Bebawy; Frederick Luk; Rebecca S Mason; Ramin Rohanizadeh
Journal:  Curr Neuropharmacol       Date:  2013-07       Impact factor: 7.363

2.  A genetically engineered thermally responsive sustained release curcumin depot to treat neuroinflammation.

Authors:  S Michael Sinclair; Jayanta Bhattacharyya; Jonathan R McDaniel; David M Gooden; Ramesh Gopalaswamy; Ashutosh Chilkoti; Lori A Setton
Journal:  J Control Release       Date:  2013-07-03       Impact factor: 9.776

3.  Curcumin restores innate immune Alzheimer's disease risk gene expression to ameliorate Alzheimer pathogenesis.

Authors:  B Teter; T Morihara; G P Lim; T Chu; M R Jones; X Zuo; R M Paul; S A Frautschy; G M Cole
Journal:  Neurobiol Dis       Date:  2019-04-02       Impact factor: 5.996

Review 4.  Role of dietary phenols in mitigating microglia-mediated neuroinflammation.

Authors:  Parakalan Rangarajan; Aparna Karthikeyan; S T Dheen
Journal:  Neuromolecular Med       Date:  2016-07-27       Impact factor: 3.843

5.  Protective effects of curcumin against rotenone-induced rat model of Parkinson's disease: in vivo electrophysiological and behavioral study.

Authors:  L V Darbinyan; L E Hambardzumyan; K V Simonyan; V A Chavushyan; L P Manukyan; S A Badalyan; N Khalaji; V H Sarkisian
Journal:  Metab Brain Dis       Date:  2017-07-10       Impact factor: 3.584

6.  Classical and Alternative Activation of Cyanobacterium Oscillatoria sp. Lipopolysaccharide-Treated Rat Microglia in vitro.

Authors:  Alejandro M S Mayer; Joseph Murphy; David MacAdam; Christopher Osterbauer; Imaan Baseer; Mary L Hall; Domonkos Feher; Phillip Williams
Journal:  Toxicol Sci       Date:  2015-11-25       Impact factor: 4.849

Review 7.  Curcumin and neurodegenerative diseases.

Authors:  Adriana Monroy; Gordon J Lithgow; Silvestre Alavez
Journal:  Biofactors       Date:  2013-01-10       Impact factor: 6.113

Review 8.  Friend or Foe? Resident Microglia vs Bone Marrow-Derived Microglia and Their Roles in the Retinal Degeneration.

Authors:  Ni Jin; Lixiong Gao; Xiaotang Fan; Haiwei Xu
Journal:  Mol Neurobiol       Date:  2016-06-18       Impact factor: 5.590

9.  Activation of proprotein convertase in the mouse habenula causes depressive-like behaviors through remodeling of extracellular matrix.

Authors:  Hikaru Ito; Kanako Nozaki; Kenji Sakimura; Manabu Abe; Shigeto Yamawaki; Hidenori Aizawa
Journal:  Neuropsychopharmacology       Date:  2020-09-17       Impact factor: 7.853

10.  Liposomal Encapsulated Curcumin Effectively Attenuates Neuroinflammatory and Reactive Astrogliosis Reactions in Glia Cells and Organotypic Brain Slices.

Authors:  Christina Schmitt; Anna Lechanteur; François Cossais; Coralie Bellefroid; Philipp Arnold; Ralph Lucius; Janka Held-Feindt; Geraldine Piel; Kirsten Hattermann
Journal:  Int J Nanomedicine       Date:  2020-05-25
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.