| Literature DB >> 21939540 |
Sunyoung Hwang1, Byeonghwa Jeon, Jiae Yun, Sangryeol Ryu.
Abstract
BACKGROUND: Campylobacter jejuni is a leading foodborne pathogen worldwide. Despite the fastidious nature of C. jejuni growth, increasing numbers of human campylobacteriosis suggest that C. jejuni may possess unique mechanisms to survive under various stress conditions. C. jejuni possesses only three sigma factors (FliA, RpoD, and RpoN) and lacks stress-defense sigma factors. Since FliA and RpoD are dedicated to flagella synthesis and housekeeping, respectively, in this study, we investigated the role of RpoN in C. jejuni's defense against various stresses.Entities:
Mesh:
Substances:
Year: 2011 PMID: 21939540 PMCID: PMC3196706 DOI: 10.1186/1471-2180-11-207
Source DB: PubMed Journal: BMC Microbiol ISSN: 1471-2180 Impact factor: 3.605
Figure 1Growth of the . The C. jejuni strains were microaerobically cultured in MH broth at 42°C with shaking at 180 rpm (A) and without shaking (B). At the described time intervals, the optical density at 600 nm was measured, and viable cells were counted in static culture condition (without shaking) by plating serially-diluted C. jejuni cultures on MH agar plates. The results are the mean ± standard deviation of three independent experiments. ***: P < 0.001; the significance of results was statistically analyzed by two-way ANOVA analysis of variance with Bonferroni's post-tests at a 95% confidence interval using Prism software (version 5.01; GraphPad Software Inc., USA).
Figure 2Changes in viability and morphology under osmotic stress. (A) Viable cell counts of the rpoN mutant on MH agar pates containing 0.8% NaCl after incubation for 24 hr. Results are expressed as the mean ± standard deviation of three independent experiments. ***: P < 0.001; the significance of results was statistically analyzed by one-way ANOVA analysis of variance with Dunnett test at a 99.9% confidence intervals using Prism software (version 5.01; GraphPad Software Inc.). (B) Electron microphotographs of WT and mutants grown under high osmotic stress conditions (MH agar pates containing 0.8% NaCl). Bacteria were examined by EF-TEM with negative staining with 0.2% uranyl acetate. Each scale bar of the normal and 0.8% NaCl conditions correspond to 0.5 μm and 1 μm, respectively.
Figure 3Effect of the . (A) Growth of the rpoN mutant under different pH conditions was examined by dotting 10 μl of serially-diluted bacterial cultures. The results are representative of three independent experiments with similar results. (B) Viable cell counts on MH agar with different pH after 24 hr incubation. The % viability is expressed as mean ± standard deviation of three independent experiments. ***: P < 0.001; the significance of results was statistically analyzed by one-way ANOVA using Prism software (version 5.01; GraphPad Software Inc.).
Figure 4Resistance of the . After treatment with hydrogen peroxide (H2O2) for 1 hr, changes in viability were determined by dotting 10 μl of bacterial culture (A) or by plating culture aliquots on MH agar plates to count viable cells (B). The data (A) are representative of three independent experiments with similar results. The % viability (B) is expressed as mean ± standard deviation of three independent experiments. The significance of results was P < 0.05 indicated by an asterisk (Prism software version 5.01; GraphPad Software Inc.).
Bacterial strains, plasmids and primers used in this study
| Strains, plasmid and primers | Description | Source |
|---|---|---|
| DH5α | Invitrogen | |
| 81-176 | wild type, clinical isolate | [ |
| pUC19 | Cloning and suicide vector, Ampr | NEB |
| rpoN_F | ATGATAAGGGTAAGAATTATTTTGAT | |