A polymorphic microsatellite from the Squalius alburnoides complex (Osteichthyes, Cyprinidae) cloned by serendipity can be useful in genetic analysis of polyploids.

A new microsatellite locus (SAS1) for Squalius alburnoides was obtained through cloning by serendipity. The possible usefulness of this new species-specific microsatellite in genetic studies of this hybrid-species complex, was explored. The polymorphism exhibited by SAS1 microsatellite is an important addition to the set of microsatellites previously used in genetic studies in S. alburnoides complex, that mostly relied in markers described for other species. Moreover, the SAS1 microsatellite could be used to identify the parental genomes of the complex, complementing other methods recently described for the same purpose..

The taxon Squalius alburnoides is a small endemic cyprinid inhabiting the rivers of the Iberian Peninsula and is among the most complex polyploid systems known in vertebrates.

Based on molecular markers information, S. alburnoides is recognized as a hybrid taxon resulting from an ancient and unidirectional hybridization between S. pyrenaicus females (P genome) and males (A genome) of an extinct species sister to Anaecypris hispanica (reviewed in Alves , Robalo ). For this reason, all the S.alburnoides fishes carry S.pyrenaicus mitochondrial DNA.

Actually, the S. alburnoides complex combines the diploid (2n = 50) and polyploid (3n = 75 and 4n = 100) bio-types of both sexes and different nuclear genomes, that, by intercrossing, combine sexual and asexual reproductive modes.

The asexual modes range from clonal inheritance to hybridogenesis or meiotic hybridogenesis (in which one genome is excluded from gamete formation), whereby sympatric bisexual Squalius species act as sperm donors and contribute with new genetic material, i.e.., S. pyrenaicus, mainly in the southern basins of the Iberian Peninsula (P genome), and S. carolitertii in the northern (C genome)) (reviewed in Alves ; Pala ). The predominant S. alburnoides specimens in nature are triploids with the sex ratio biased towards females, with the CAA biotype across the distribution range of S. carolitertii, and the PAA biotype across the S. pyrenaicus range.

As in other asexual complexes (Ambystoma: Bogart, 1989; Rana: Hotz ; Phoxinus: Goddard and Schultz, 1993), the S. alburnoides complex have regenerated and maintained the extinct parental species genotype (AA, all males) through the fertilization of A ovocytes from PAA females by reduced A sperm produced by AA males of hybrid origin (Alves ). This AA genotype is apparently absent from the northern populations

Although in recent times, single nucleotide polymorphisms (SNPs) have disputed with microsatellites the role of a prominent tool in genetic studies (Coates ), mainly through single nucleotide changes being universally comparable, polymorphic DNA microsatellites remain as a very useful (and less expensive) class of genetic markers in population genetics. Moreover, in general, microsatellites are more neutral than SNPs, since the latter frequently give evidence of selection

Microsatellites, by addressing topics, such as genetic identification, population structure, parentage, kinship and population variability assessment (Jarne and Lagoda, 1996; Goldstein ; Ellegren, 2004; Hamilton and Tyler, 2008), are traditionally considered as the markers of choice for genotyping, due to their abundance, polymorphism in repeat numbers and reliability (Jones ).

Microsatellites display a very high content of genetic information, as they are codominant, with multiple alleles, and showing high expected heterozygosity values.

In addition to the abundance of microsatellites in vertebrate genomes (Weber, 1990; Jarne and Lagoda, 1996; Goldstein and Schlötterer, 1999), it is notable that, in fish, microsatellite-loci are longer, have a larger range in allele size, are more degenerated (i.e., contain more base substitutions or deletions), and are very abundant, when compared to mammals (e.g., Brooker ; Colbourne ; O’Reilly ; Neff and Gross, 2001). The possibility of using microsatellites described for another closely related species (transferability of microsatellite loci) is a consequence of homology of flanking regions in simple sequence repeats (Turner ). Studies in freshwater fish have already demonstrated the high rate of transferability of microsatellite loci among taxonomically related species (e.g. Huang ; Salgueiro ; Turner ; Holmen ).

Efforts to determine the copy number of microsatellite alleles in polyploid species have, in many cases, been unsuccessful (Falque ) and in some cases no attempts have even been made to assign precise allelic configurations (Becher ; Bockelmann ). There are many applications where considerably more information would be gained from a proper quantification of the alleles in the loci analysed, such as population genetics and paternity analysis.

In the S. alburnoides complex, microsatellite loci are often used for estimating population genetic diversity and evolutionary potential (Pala and Coelho, 2005; Crespo-López ; Cunha , 2011), verifying inheritance patterns (Alves ), and analyzing reproduction modes (Crespo-López ). They are also efficient markers, not only for detecting diagnostic alleles for each parental genome, but also for characterizing genetic variability in polyploids (e.g. Christiansen, 2005; Lampert ; Ramsden ; Cunha ).

In the present report, the cloning by serendipity of a polymorphic microsatellite from a diploid S. alburnoides specimen from Estena River (Guadiana basin, Spain) is described, with a discussion of its possible application in studies of the characterization of genetic variability and parental assignment in this species complex.

The microsatellite was discovered during a series of trials for cloning short opsin fragments from S. alburnoides (Boto unpublished). Briefly, amplification of a short fragment of the exon five in the putative SWS1 opsin gene was attempted, by using a degenerate universal vertebrate forward primer OPF 5GCGAATTCGCNTCNACNCARAARGCNGA 3 (Carleton ) and a primer designed against a short Cyprinus carpio SWS1 sequence OPC1R 5CCTTGTTTGTATCCTCAGCA 3. DNA was extracted from fins preserved in ethanol, using standard methods (Sambrook ).

Gradient Polymerase Chain Reaction (Eppendorf MasterCycler Gradient) (3 min. at 94 °C, 35 cycles of 1 min. at 94 °C, 1 min. at 52 ± 10 °C, 1 min. at 72 °C, and a final step of 3 min. at 72 °C), yielded bands compatible with the expected opsin fragment at temperatures of 42.1 to 44.2 °C.

An aliquot of 15 μL of a pooled mix of amplified fragments was precipitated with isopropanol and ligated to a PGEM-T vector. TOPO-competent bacteria were transformed with the ligation mix and plated onto LB/agar/ampicilin.

From the 18 transformants bearing an insert of compatible length with the expected fragment sequenced (ABI 3730), 15 bore an AG microsatellite sequence.

Three of these sequences presented 12 repeats of the AG motif, five 13, two 24, two 25 and three 26. Seeing that DNA polymerase is capable of copying the same allele with different repeat numbers (Hauge and Litt, 1993; Clarke ; Ellegren, 2004), the cloning of two different alleles (12–13 repeats and 24–26 repeats) from this microsatellite can be inferred.

A representative sequence, denominated SASI, is deposited in GenBank under accession number FJ652104.

In order to explore both the polymorphic character of this microsatellite, and its usefulness in further studies of the S. alburnoides complex, DNA from individuals of different geographic origin, genome composition and ploidy level, as well as several S.pyrenaicus and S. carolitertii samples, was amplified (Table 1), using OPF and OPC1R primers (the latter marked with FAM), at a hybridization temperature of 43.5 °C. Fragments were analyzed with an ABI 3730 using GeneMapper v3.7.

Table 1

SAS1 genotypes from various S.alburnoides, S.pyrenaicus and S. carolitertii individuals, coming from different basins and presenting a diverse ploidy and genomic composition.

Species	Basin	Genomic composition	Genotype
S. pyrenaicus	Guadiana	PP	110/116
S. Pyrenaicus	Guadiana	PP	108/114
S. pyrenaicus	Guadiana	PP	100/112
S. pyrenaicus	Guadiana	PP	104/128
S. pyrenaicus	Guadiana	PP	104/116
S. pyrenaicus	Guadiana	PP	100/100
S. pyrenaicus	Guadiana	PP	110/110
S. pyrenaicus	Guadiana	PP	116/124
S. pyrenaicus	Guadiana	PP	102/102
S. pyrenaicus	Guadiana	PP	116/132
S. pyrenaicus	Guadiana	PP	116/116
S. carolitertii	Douro	CC	108/110
S. carolitertii	Douro	CC	114/114
S. carolitertii	Douro	CC	108/108
S. carolitertii	Douro	CC	108/108
S. carolitertii	Douro	CC	104/104
S. carolitertii	Douro	CC	104/112
S. carolitertii	Douro	CC	108/114
S.alburnoides	Guadiana	AA	92/94
S. alburnoides	Guadiana	AA	92/92
S. alburnoides	Guadiana	AA	90/90
S. alburnoides	Guadiana	AA	92/92
S. alburnoides	Guadiana	AA	90/92
S. alburnoides	Tagus	AP	92/130
S. alburnoides	Tagus	AP	86/136
S. alburnoides	Douro	ACC	86/114/114
S. alburnoides	Douro	ACC	86/114/114
S. alburnoides	Douro	AAC	86/88/108
S. alburnoides	Douro	AAC	88/88/118
S. alburnoides	Douro	AAC	88/88/108
S. alburnoides	Douro	AAC	88/88/108
S. alburnoides	Tagus	AAP	86/86/110
S. alburnoides	Tagus	AAP	86/86/134
S. alburnoides	Guadiana	AAP	92/92/112
S. alburnoides	Guadiana	AAP	92/94/112
S. alburnoides	Douro	AACC	86/86/112/112
S. alburnoides	Douro	AACC	86/86/118/118
S. alburnoides	Douro	AACC	86/86/114/114
S. alburnoides	Douro	AACC	86/86/114/114

After prior identification of the biotype, according to procedures by Cunha , 2009), ploidy levels were determined through flow cytometry (FCM) of blood cells, as previously described (Collares-Pereira and Moreira de Costa, 1999).

As shown (Table 1), this microsatellite facilitates the discrimination between alleles coming from the genome of the extinct ancestor close to Anaecypris hispanica (Robalo ) - genome A (allele length below 100 bp), and those from the P or C genomes corresponding to the S. pyrenaicus and S. carolitertii sperm donors (allele lengths above 100 bp). As such, this microsatellite could be used to differentiate individuals with hybrid genomes from individuals with a single genome.

This microsatellite does not allow distinguishing the alleles coming from the sperm donors, with genomes P or C, whose alleles overlap in length. However, this is a minor problem, since populations carrying P or C genomes are allopatric

Due to manifest polymorphism, the SAS1 microsatellite became an important addition to those previously used in genetic studies of the S. alburnoides hybrid complex [n7k4, n7j4, e2f8 and e1g6 (Mesquita ; Pala and Coelho, 2005) lco1, lco3, lco4 and lco5 (Turner ) loci], since only two (e2f8 and e1g6) were really S.alburnoides-complex specific.

Furthermore, the identification of heterozygotes with the SAS1 microsatellite could be of use for detecting the genome copy number of intergeneric hybrids, despite the existence of new methods for quickly defining the genomic composition of Squalius alburnoides, based on determining the relative genome dosage by the semiquantitative polymerase chain reaction (PCR) method (Sousa-Santos ; Inacio ).

As shown above, the microsatellite loci previously used in genetic studies of S. alburnoides (Pala and Coelho, 2005; Crespo-López , 2007; Cunha ) were mostly heterologous ones. This frequently leads to the appearance of null alleles (alleles which are not amplified) and a loss in polymorphism information in the species in which the marker was being tested. The increase in the number of microsatellite loci in genetic studies has been shown to be a beneficial strategy, through minimizing problems derived from characteristics of the microsatellites themselves (high mutation rate, presence of null alleles, size homoplasy, etc.). Hence, the addition of a new one constitutes a powerful tool for increasing knowledge