Literature DB >> 21890494

Combined deficiency of alpha and epsilon sarcoglycan disrupts the cardiac dystrophin complex.

Alessio Lancioni1, Ida Luisa Rotundo, Yvonne Monique Kobayashi, Luca D'Orsi, Stefania Aurino, Gerardo Nigro, Giulio Piluso, Dario Acampora, Mafalda Cacciottolo, Kevin P Campbell, Vincenzo Nigro.   

Abstract

Cardiomyopathy is a puzzling complication in addition to skeletal muscle pathology for patients with mutations in β-, γ- or δ-sarcoglycan (SG) genes. Patients with mutations in α-SG rarely have associated cardiomyopathy, or their cardiac pathology is very mild. We hypothesize that a fifth SG, ε-SG, may compensate for α-SG deficiency in the heart. To investigate the function of ε-SG in striated muscle, we generated an Sgce-null mouse and a Sgca-;Sgce-null mouse, which lacks both α- and ε-SGs. While Sgce-null mice showed a wild-type phenotype, with no signs of muscular dystrophy or heart disease, the Sgca-;Sgce-null mouse developed a progressive muscular dystrophy and a more anticipated and severe cardiomyopathy. It shows a complete loss of residual SGs and a strong reduction in both dystrophin and dystroglycan. Our data indicate that ε-SG is important in preventing cardiomyopathy in α-SG deficiency.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21890494      PMCID: PMC3209833          DOI: 10.1093/hmg/ddr398

Source DB:  PubMed          Journal:  Hum Mol Genet        ISSN: 0964-6906            Impact factor:   6.150


INTRODUCTION

Dilated cardiomyopathy is a multi-factor disease associated with both inherited and acquired forms of the disease (1). Specific genetic deficiencies in components of the dystrophin–glycoprotein complex (DGC) are associated with inherited cardiomyopathy (2). In striated muscle, the DGC primarily consists of dystrophin, the syntrophins, α- and β-dystroglycan, α-sarcoglycan (SG) (3), β-SG (4,5), γ-SG (6), δ-SG (7,8) and sarcospan (9). The DGC confers a structural link between laminin-2 in the extracellular matrix and F-actin of the cytoskeleton (10). The DGC is thought to protect muscle cells from contraction-induced injury (11). The SGs form a transmembrane sub-complex within the DGC (12). Sarcoglycanopathies are associated with mutations in α-, β-, γ- or δ-SG genes, and are responsible for childhood onset of proximal weakness in autosomal recessive limb-girdle muscular dystrophies (LGMD types 2D, 2E, 2F or 2C, respectively) (13). Patients with mutations associated with β-, γ- or δ-SG may or may not develop cardiomyopathy (14,15), whereas patients with mutations in the α-SG either do not display heart problems or else very mild symptoms of cardiac pathology (16). There is a fifth SG called ɛ-SG (17,18). Highly homologus to α-SG, ɛ-SG has a broader expression pattern compared with the striated muscle pattern of α-SG, thus the ɛ-SG protein is part of the vascular smooth muscle SG complex (19). The ɛ-SG gene is maternally imprinted (20,21), and mutations in the ɛ-SG gene are associated with the movement disorder myoclonus dystonia, with no skeletal or cardiac muscle involvement (22). Campbell and colleagues generated mouse models for LGMD2D, 2E and 2F. The mouse model for LGMD2D is deficient for α-SG (Sgca-null) (23). The SG–sarcospan complex is disrupted in this mouse, and the dystroglycan complex is disassociated from the DGC (24), leading to muscular dystrophy with either no or very mild cardiomyopathy. Residual β-, γ- and δ-SGs can be detected in Sgca-null skeletal muscle and the DGC without α-SG is detected in the Sgca-null cardiac muscle (23), which is consistent with the patient data. However, β- and δ-SG-deficient mouse models (Sgcb and Sgcd-null) not only develop muscular dystrophy but also cardiomyopathy (15,25). There is no detection of residual SGs in these latter mouse models, which is also observed in patients. These data suggest that a SG complex associated with ɛ-SG exists in striated muscle and that cardiomyopathy develops in β- and δ-SG deficiency because both SG complexes are disrupted. To understand the role of ɛ-SG in skeletal and cardiac muscle, we engineered an Sgce-null mouse. In addition, to investigate the impact of the concomitant loss of α- and ɛ-SG, we generated an Sgca-;Sgce-null mouse that lacks both α- and ɛ-SGs. Sgce-null mice did not display any skeletal or cardiac muscle differences compared with wild-type controls, consistent with myoclonus dystonia patient data. Deficiency in both α- and ɛ-SGs resulted in muscular dystrophy with progressive necrosis and fibrosis similar to Sgca-null mouse skeletal muscle pathology, except that there was no residual staining of the other SGs. Contrary to the lack of a cardiac involvement in the Sgca-null mice, the Sgca-;Sgce-null mice developed dilated cardiomyopathy.

RESULTS

Biochemical analysis of cardiac DGC of wild-type versus Sgca-null cardiac muscle

To understand whether ɛ-SG may have a role in the cardiac dystrophin-associated complex, we performed biochemical analyses of wild-type, Sgca-null and MCKeSG/Sgca-null mice that overexpress ɛ-SG in the α-SG-deficient mouse. On sucrose density gradients, the cardiac DGC of Sgca-null mice resembled that of wild-type mice, suggesting that the cardiac DGC is still intact due to the presence of ɛ-SG (Fig. 1A). Indeed, expression of ɛ-SG in the Sgca-null cardiac sucrose gradient was up-regulated on immunoblots (Fig. 1A). Interestingly, overexpression of ɛ-SG (MCKeSG/Sgca-null) striated muscle did not alter the biochemical sucrose density gradient profile of the DGC components (Fig. 1B and C). In contrast, in Sgcb-null and Sgcd-null mice, the cardiac DGC was completely absent and these animals develop cardiomyopathy (Fig. 1D). The mutation of dystrophin of mdx mice did not produce the absence of the SG complex (Fig. 1E) and mdx mice do not develop cardiomyopathy until after 1 year of age.
Figure 1.

Biochemical analysis. (A) Cardiac sucrose density gradient of wild-type mice versus Sgca-null mice. On sucrose density gradients, the cardiac DGC of Sgca-null mice resembles that of wild-type mice, suggesting that the cardiac DGC is still intact due to the presence of ɛ-SG. In fact, expression of ɛ-SG in the Sgca-null cardiac sucrose gradient appears up-regulated on immunoblots. (B) Biochemical figure-cardiac sucrose density gradient of MCKeSG/Sgca-null mice. Overexpression of ɛ-SG in Sgca-null striated muscle using the mouse muscle creatine kinase promoter does not alter the biochemical sucrose density gradients profile of the DGC components. (C) Immunofluorescent detection of ɛ-SG on wild-type versus MCKeSG/Sgca-null cardiac sections showing that ɛ-SG is overexpressed. (D) Biochemical figure-cardiac sucrose density gradient of Sgcb-null and Sgcd-null cardiac muscle showing loss of the SG–sarcospan complex in the hearts of these two mouse models, which both develop cardiomyopathy. (E) Biochemical figure-cardiac sucrose density gradient of mdx cardiac muscle showing that the cardiac DGC is present (except for dystrophin missing) may explain why mdx mice do not develop cardiomyopathy until after 1 year of age.

Biochemical analysis. (A) Cardiac sucrose density gradient of wild-type mice versus Sgca-null mice. On sucrose density gradients, the cardiac DGC of Sgca-null mice resembles that of wild-type mice, suggesting that the cardiac DGC is still intact due to the presence of ɛ-SG. In fact, expression of ɛ-SG in the Sgca-null cardiac sucrose gradient appears up-regulated on immunoblots. (B) Biochemical figure-cardiac sucrose density gradient of MCKeSG/Sgca-null mice. Overexpression of ɛ-SG in Sgca-null striated muscle using the mouse muscle creatine kinase promoter does not alter the biochemical sucrose density gradients profile of the DGC components. (C) Immunofluorescent detection of ɛ-SG on wild-type versus MCKeSG/Sgca-null cardiac sections showing that ɛ-SG is overexpressed. (D) Biochemical figure-cardiac sucrose density gradient of Sgcb-null and Sgcd-null cardiac muscle showing loss of the SG–sarcospan complex in the hearts of these two mouse models, which both develop cardiomyopathy. (E) Biochemical figure-cardiac sucrose density gradient of mdx cardiac muscle showing that the cardiac DGC is present (except for dystrophin missing) may explain why mdx mice do not develop cardiomyopathy until after 1 year of age.

Generation of Sgce-null mice and Sgca-;Sgce-null mice

To generate Sgce-null mice, we constructed a targeting vector in which exons 6–9 that encode the transmembrane and Cys-rich domains were replaced by neo and β-gal (Fig. 2A). We used this strategy, since mutations of either the transmembrane domain or Cys-rich domain of any SG gene generally produce a non-functional allele, while the inactivation of the first exon could activate a cryptic first exon or produce unwanted genomic perturbations. We obtained the homologous recombination in five clones that were checked for possible undesired chromosomal defects. The 133 clones were chosen and chimeras were produced that transmit the mutated ɛ-SG allele through the germline. We obtained homozygous mice that were crossed with C57BL/6 mice. Sgce-null mice were viable and fertile, and they did not present signs of muscular dystrophy.
Figure 2.

Generation of animal models. (A) Homologous recombination was obtained by a vector that replaces exons 6–9 of the mouse ɛ-SG gene with beta-galactosidase and neo gene. (B) 5′RACE that shows the presence of a unique RNA species that joins exons 6–10 in the KO animals only. (C) Expression of ɛ-SG maintains the maternal imprinting following KO. Western blot from the cardiac tissue using anti ɛ-SG antibody. +/+ indicates WT mice, +/− indicates heterozygous mice that have the mutation on the maternal allele that is not expressed, −/+ indicates heterozygous mice that have the mutation on the paternal allele and the normal allele is not expressed, −/− indicates homozygous mutated mice. (D) Allele-specific PCR used to genotype the α-SG mutation produces a 1061 bp and 618 bp for WT and KO, respectively. (E) Allele-specific PCR used to genotype the ɛ-SG mutation produces a 378 bp and 250 bp for WT and KO, respectively.

Generation of animal models. (A) Homologous recombination was obtained by a vector that replaces exons 6–9 of the mouse ɛ-SG gene with beta-galactosidase and neo gene. (B) 5′RACE that shows the presence of a unique RNA species that joins exons 6–10 in the KO animals only. (C) Expression of ɛ-SG maintains the maternal imprinting following KO. Western blot from the cardiac tissue using anti ɛ-SG antibody. +/+ indicates WT mice, +/− indicates heterozygous mice that have the mutation on the maternal allele that is not expressed, −/+ indicates heterozygous mice that have the mutation on the paternal allele and the normal allele is not expressed, −/− indicates homozygous mutated mice. (D) Allele-specific PCR used to genotype the α-SG mutation produces a 1061 bp and 618 bp for WT and KO, respectively. (E) Allele-specific PCR used to genotype the ɛ-SG mutation produces a 378 bp and 250 bp for WT and KO, respectively. At least 10 generations of mice were produced, to exclude other co-segregating unwanted alleles and obtain a wild-type background. The homozygous mice do not express ɛ-SG, but an insignificant amount of mRNA (<1%) was seen by 3′RACE analysis that directly joins exon 5 to exon 10 (Fig. 2B). This transcript is in frame, but no protein was seen. No expression of chimeric ɛ-SG/neo or ɛ-SG/β-gal was detected. This confirmed that our Sgce-null mice are true null, since they do not express any ɛ-SG allele. In addition, the correct maternal imprinting was maintained, since the heterozygous Sgce−/+ mice were also null, when receiving the mutated allele from the male germline (Fig. 2C). To generate Sgca-;Sgce-null mice, we crossed our Sgce-null mice with the Sgca-null homozygous mice (Fig. 2D and E) (23). We first generated double heterozygotes and we crossed them to obtain the homozygotes. Due to the maternal imprinting, the Sgca-;Sgce-null mice are identical to the Sgca-null/Sgce heterozygote (+/−) receiving the mutated allele from the male germline.

Sgca-;Sgce-null mice show a striking cardiac pathology

To evaluate the effect of the absence of ɛ-SG and the combined absence of α-SG and ɛ-SG on the skeletal muscle morphology, we compared hematoxylin and eosin (H&E)—stained sections of the quadriceps and gastrocnemius in wild-type, Sgce-null mice, Sgca-null mice and Sgca-;Sgce- null mice between the ages of 2 months and 1 year (Fig. 3A). The Sgce-null mice did not show any morphological abnormalities at any of the ages analyzed, while the Sgca-null mice and Sgca-;Sgce-null mice showed extensive pathological alterations already at 2 months of age. The Sgca; Sgce-null mice showed large necrotic areas, inflammatory infiltration and centralized nuclei comparable with the Sgca-null mice. At 1 year of age, lesions worsened in both animal models and severe necrotic areas were observed.
Figure 3.

Histological analysis. (A) H&E staining of tissue sections from skeletal muscle (quadriceps) and cardiac muscle at the indicated times in the wild-type animal, Sgce-null, Sgca-null and Sgca-;Sgce-null. The worsening with time is evident. (B) In the cardiac muscle, there is an evident and reproducible worsening of the pathology in the DKO mice when compared with the Sgca-null mice. There is no evidence of necrosis in the Sgce-null mice.

Histological analysis. (A) H&E staining of tissue sections from skeletal muscle (quadriceps) and cardiac muscle at the indicated times in the wild-type animal, Sgce-null, Sgca-null and Sgca-;Sgce-null. The worsening with time is evident. (B) In the cardiac muscle, there is an evident and reproducible worsening of the pathology in the DKO mice when compared with the Sgca-null mice. There is no evidence of necrosis in the Sgce-null mice. We next examined cardiac tissue. The Sgce-null mice were comparable with the wild-type without any fibrotic infiltration at all ages (Fig. 3B). The cardiac muscle of the Sgca-null mice at about 6 months of age was characterized by a mild cardiac tissue fibrosis, while the Sgca-;Sgce-null mice showed an important cardiac pathology characterized by fibrosis and necrotic areas. At 1 year of age, the Sgca-;Sgce-null mice showed a more severe pathology with a greater number of necrotic areas and fibrotic tissue compared with the Sgca-null mice.

The Sgce-null mice retain the SG complex

Immunofluorescence analysis was performed for each component of the SG complex on wild-type and Sgce-null mice on frozen sections of the quadriceps, gastrocnemius and heart (Fig. 4A). All the components of the SG complex (δ, β, γ and α) were present and there was no difference in their expression.
Figure 4.

Immunofluorescence and western blot analysis in Sgce-null mice. (A) IF using a panel of antibodies (SGs, dystroglycans and dystrophin) in Sgce- null mice that confirms the maintenance of all the DGC in the skeletal and cardiac muscle membrane. (B) WB analysis, which confirms the absence of Sgce and the presence of normal amounts of all the other DGC proteins.

Immunofluorescence and western blot analysis in Sgce-null mice. (A) IF using a panel of antibodies (SGs, dystroglycans and dystrophin) in Sgce- null mice that confirms the maintenance of all the DGC in the skeletal and cardiac muscle membrane. (B) WB analysis, which confirms the absence of Sgce and the presence of normal amounts of all the other DGC proteins. We then analyzed the α- and β-dystroglycan and dystrophin and observed the presence of an intact DGC complex. To measure the amount of the SG and DGC complex, immunoblot analysis was performed on protein membrane preparations for wild-type and Sgce-null mice from skeletal and cardiac muscle (Fig. 4B). As expected, ɛ-SG expression was only detectable in the wild-type mice and was absent in the knock-out animals. All the others components (δ-, β-, γ- and α-SGs) were present in comparable amounts to the control animals. The DGC complex was analyzed for β-dystroglycan and dystrophin proteins, and we did not observe any differences between the Sgce-null mice and the control animals.

The Sgca-;Sgce-null mice show an almost complete loss of the DGC

Frozen sections from wild-type, Sgca-null mice and Sgca-;Sgce-null mice from the quadriceps, gastrocnemius and heart were analyzed by immunofluorescence (Fig. 5A and B).
Figure 5.

Immunofluorescence analysis in Sgca and Sgca-;Sgce-null mice. (A) IF using a panel of antibodies (SGs, dystroglycans and dystrophin) in Sgca-null and Sgca-;Sgce-null mice in both cardiac and (B) skeletal muscle. The figures show the absence of the SG complex in both strains and in both tissues, while the reduction in dystroglycan and dystrophin is more severe in the Sgca-;Sgce-null mice compared with the Sgca-null mice. This is more evident in the heart.

Immunofluorescence analysis in Sgca and Sgca-;Sgce-null mice. (A) IF using a panel of antibodies (SGs, dystroglycans and dystrophin) in Sgca-null and Sgca-;Sgce-null mice in both cardiac and (B) skeletal muscle. The figures show the absence of the SG complex in both strains and in both tissues, while the reduction in dystroglycan and dystrophin is more severe in the Sgca-;Sgce-null mice compared with the Sgca-null mice. This is more evident in the heart. δ-, β- and γ-SGs were greatly reduced in both the Sgca-null and Sgca-;Sgce-null mice, suggesting the secondary loss of the other components of the SG complex in the muscle membrane. α-dystroglycan, β-dystroglycan and dystrophin were also reduced in comparison to wild-type animals, but, interestingly, the Sgca-;Sgce-null mice dystrophin showed a much stronger reduction compared with the Sgca-null mice in which it is already reduced. The wild-type, Sgca-null mice and Sgca-;Sgce-null mice membrane preparations from the skeletal and cardiac muscle were analyzed by western blot analysis (Fig. 6A). The Sgca-null and Sgca-;Sgce-null mice displayed the absence of α-SG, while we observed the absence of ɛ-SG only in the Sgca-;Sgce-null mice. The other components of the SG complex (δ-, β- and γ-SGs) were strongly reduced and we can assume that there was a loss of the SG complex in both animals.
Figure 6.

Western blot analysis in Sgca and Sgca-;Sgce-null mice. (A) WB analysis in Sgca-null and Sgca-;Sgce-null mice in both cardiac and skeletal muscle using antibodies versus α-, β-, γ-, δ-SG, β-dystroglycan and C-terminal dystrophin. The extent of the reduction in the signal of β-dystroglycan and dystrophin in the Sgca-;Sgce-null mice compared with the Sgca-null mice is much more evident. (B) Pool of cardiac tissue belonging to three (5-months old) mice per group to quantify the amount of dystrophin. The strong reduction in dystrophin in the Sgca-;Sgce-null mice compared with the Sgca-null mice is evident.

Western blot analysis in Sgca and Sgca-;Sgce-null mice. (A) WB analysis in Sgca-null and Sgca-;Sgce-null mice in both cardiac and skeletal muscle using antibodies versus α-, β-, γ-, δ-SG, β-dystroglycan and C-terminal dystrophin. The extent of the reduction in the signal of β-dystroglycan and dystrophin in the Sgca-;Sgce-null mice compared with the Sgca-null mice is much more evident. (B) Pool of cardiac tissue belonging to three (5-months old) mice per group to quantify the amount of dystrophin. The strong reduction in dystrophin in the Sgca-;Sgce-null mice compared with the Sgca-null mice is evident. Western blot analysis confirmed what we had observed by immunofluorescence analysis: the reduction is much more evident in the Sgca-;Sgce-null mice compared with the Sgca-null mice and the wild-type. In the same way, the β-dystroglycan and the dystrophin were reduced in the Sgca-null animals and strongly reduced in the Sgca-;Sgce-null mice (Fig. 6B). To search for ultrastructural alterations, we performed electron microscopy (EM) analyses of wild-type, Sgce-null, Sgca-null and Sgca-;Sgce-null mice on skeletal and cardiac muscle at 7 months of age. Mitochondria appeared normal in all models in number and shape. Interestingly, there was a marked disorganization of cardiac muscle fibers and a thickened Z-disk in Sgca-;Sgce-null mice in comparison with the other mice. This could be related to the effect of concomitant dystrophin–dystroglycan reduction (Fig. 7).
Figure 7.

EM analysis. (A and B) a and a′ (wild-type mice); b and b′ (Sgce-null mice); c and c′ (Sgca-null mice); and d and d′ (Sgca-;Sgce-null mice). We notice that there are no evident structural changes in the skeletal muscle, while in the Sgca-;Sgce- null mice there is an increase in the distance between the fibers in the cardiac muscle.

EM analysis. (A and B) a and a′ (wild-type mice); b and b′ (Sgce-null mice); c and c′ (Sgca-null mice); and d and d′ (Sgca-;Sgce-null mice). We notice that there are no evident structural changes in the skeletal muscle, while in the Sgca-;Sgce- null mice there is an increase in the distance between the fibers in the cardiac muscle.

Exercise dramatically worsen the cardiac pathology in the Sgca-;Sgce-null mice

To evaluate the impact of the major reduction in the SG complex and the dystrophin protein in the Sgca-;Sgce-null mice, we exercised wild-type (n= 6), Sgce-null mice (n= 6), Sgca-null mice (n= 6) and Sgca-;Sgce-null mice (n= 6) starting at 4 months of age using the treadmill. We generated a control group in rest condition composed of wild-type (n= 6), Sgce-null mice (n= 6), Sgca-null mice (n= 6) and Sgca-;Sgce-null mice (n= 6) at the same age. The Sgce-null mice showed a performance similar to the wild-type animals, running for 40 min in the first run at 28 cm/s and in the second run at 20 cm/s. In contrast, the Sgca-null and Sgca-;Sgce-null mice, after 2 min at 28 cm/s and 10 min at 20 cm/s were exhausted and they were not able to complete the exercise. One week after the exercise period, we performed echocardiography analysis (data not shown) and 1 week later we sacrificed three animals from each group for histological analysis. Interestingly, whole-mount analysis showed a cardiac dilation in the exercised Sgca-null mice and Sgca-;Sgce-null mice (Fig. 8A).
Figure 8.

Cardiac analysis. (A) Whole-mount, (B) H&E staining, (C) Masson's trichrome staining, (D) Evan's blue dye. The dramatic inflammatory response in the Sgca-;Sgce-null mice compared with the Sgca-null mice is evident following physical exercise on the treadmill.

Cardiac analysis. (A) Whole-mount, (B) H&E staining, (C) Masson's trichrome staining, (D) Evan's blue dye. The dramatic inflammatory response in the Sgca-;Sgce-null mice compared with the Sgca-null mice is evident following physical exercise on the treadmill. Hystological analysis of the exercised Sgca-;Sgce-null mice heart revealed extensive alterations including large and numerous foci of necrosis (Fig. 8B), and the Masson Trichrome staining (Fig. 8C) and Evan's blue dye uptake (Fig. 8D) confirmed the presence of fibrotic and necrotic tissue and inflammatory infiltration. No signs of necrosis were present in the exercised Sgce-null mice and control animals, and a minor number of necrotic areas characterized the Sgca-null mice cardiac tissues. In the groups of animals in rest condition, the cardiac muscle dimension was normal in the Sgce-null and Sgca-null mice in comparison to the wild-type animals (data not shown); in the Sgca-;Sgce-null mice in rest condition, we could observe a cardiac pathology that became more severe after exercise that induced stress and consequent heart damage with a major impact compared with the Sgca-null mice. In diaphragm, no substantial difference was observed between Sgca-null mice and Sgca-;Sgce-null mice (Supplementary Material, Fig. S2).

DISCUSSION

In the present paper, we investigated whether or not the heterotetrameric SG complex is composed of functionally equivalent members. Previous observations indicate that Sgca-null mice do not develop cardiomyopathy and LGMD2D patients show less severe cardiac involvement than the other forms. First, we biochemically analyzed the sucrose density gradient detection pattern of the cardiac DGC components of wild-type versus Sgca-null mice. Despite being α-SG deficient, the sucrose density gradient pattern of the cardiac DGC from Sgca-null mice had a similar pattern to that of wild-type mice except that ɛ-SG appeared up-regulated. The cardiac sucrose density gradient pattern of mice overexpressing ɛ-SG on an Sgca-null background (MCKeSG/Sgca-null) (26) was very similar to that of wild-type and Sgca-null mice. To understand the role of ɛ-SG in the cardiac muscle, we generated two mouse models involving ɛ-SG: (i) the Sgce-null mouse, and (ii) the Sgca-;Sgce-null mouse by crossing Sgca-null (23) and Sgce-null mice. Consistent with patients with mutation in SGCE, Sgce-null mice did not show any signs of muscular dystrophy or cardiomyopathy. A different Sgce-null mouse was previously reported (21) with prevalent behavioral alterations: differences with our model are possibly linked to the different mutation type. Disruption of α-SG expression leads to a progressive muscular dystrophy, but without the development of cardiomyopathy in Sgca-null mice and rarely in LGMD2D patients. Detection of β-, γ-, and δ-SG residual expression in the Sgca-null mouse and patient biopsies suggests that there is another protein that is weakly compensating the α-SG deficiency, which is consistent with α-SG deficiency being the least severe of the sarcoglycanopathies. However, the complete absence of β-, γ- and δ-SGs in Sgca-;Sgce-null skeletal and cardiac muscle, but also in smooth muscle vein (Supplementary Material, Fig. S1) supported the idea that ɛ-SG is the compensating protein. In Sgca-;Sgce-null skeletal and cardiac muscle, there was a much stronger reduction in dystrophin and dystroglycan expression compared with that of Sgca-null mice. Necrosis and inflammation were more evident in the cardiac tissue from Sgca-;Sgce-null mice. The latter develop a cardiac disfunction progressing to dilated cardiomyopathy at 6 months of age as measured by echocardiography (Supplementary Material, Table S1). Although some animals undergoing echocardiography were bradycardic for the anesthesia, the signs of cardiomyopathy were observed in Sgca-;Sgce-null also following a milder physical training (Supplementary Material, Table S1). In contrast, the Sgce-null and Sgca-null mice maintained normal parameters at this age. Our data support that ɛ-SG expression in striated muscle compensates for α-SG deficiency to prevent the development of cardiomyopathy. This compensation could be exerted either by maintaining the SG–sarcospan complex or by maintaining a residual amount of dystrophin and dystroglycan in cardiac muscle and in smooth muscle vein. Interestingly, the requirement of the different SG proteins could be different since the Sgcg-null mice also develop a cardiomyopathy, while maintaining residual SG proteins (27). Recently, the importance of maintaining a residual dystrophin in protecting from mechanical stress has been proposed (28). Our data suggest that, at least in mice, ɛ-SG is an important modifying factor of the cardiomyopathy that develops in sarcoglycanopathies.

MATERIALS AND METHODS

Experimental animals

All mice were housed and handled in accordance with the guidelines of the Institutional Animal Care and Use Committee of I.G.B. Institute of Genetics and Biophysics Naples, Auth. Italy n.137/2006-A. Mice were bred for at least 10 generations with C57BL/6 mice to generate and analyze the mutant mice in a pure genetic background. All the other animals used were also in C57Bl6J background.

Vector construction

We amplified a 1.3 kb fragment that comprises intron 5 and a 9.5 kb fragment that comprises intron 9 of the mouse Sgce gene from Sv129 DNA. All long-range polymerase chain reactions (PCRs) were performed using proofreading enzymes and a low number of cycles to reduce replication errors. Both fragments were inserted in the same orientation as the neomycin resistance gene and the lacZ reporter gene. Fragments were used to obtain homologous recombination in embryonic stem (ES) cells replacing exon 6–9 with β-gal and neo.

Generation of Sgce-null mice

The 16 kb linearized construct was introduced into HM-1 ES cells by electroporation. Positive selection was carried out for 11 days at 350 mg/ml G418. Resistant colonies were picked and DNA was extracted from a fraction (1/5) of the cells for a PCR test of homologous recombination event. Targeting fidelity was determined by vectorette-PCR, sequencing and southern blot analyses. Ten to 15 ES cells were microinjected into C57Bl/6 blastocysts. Injected blastocysts were reimplanted in the uterine horn of pseudopregnant recipient females. Chimeric animals were back-crossed to B6/D2 mice and germline transmission was scored by the presence of agouti coat pigmentation. After germline transmission, the genotypes were determined by PCR on DNA from tail biopsies. The following primers and PCR conditions were used for the epsilon SG: (i) meSG/i5-137F—CAG AGA TGA CTC TAG TTA AGC CCTC; (ii) LacZ3/R—CCA GTC ACG ACG TTG TAA AAC GACG; (iii) meSG/i6+78R—ATG GTA TGT CCA GAC ACA TCA CTGC: initial denaturation at 95°C (7 min) was followed by 35 cycles with denaturation at 95°C (30 s), annealing at 58°C (1 min 30 s) and extension at 68°C for 1 min + 3 s for cycle. All three primers were used in the same PCR reaction. Wild-type and null alleles corresponded to PCR fragments of 378 and 250 bp, respectively. Sgca-null homozygous mice were obtained from Kevin Campbell. For α-SG, the following primers and PCR conditions were used: (i) INT1 in intron1: CAGGGCTGGGAGCTGGGTTCTG; (b) EX2 in intron 3 (deleted in the null allele): CCCAGGGCCTTGATGCCT; and (iii) NEOTR: GCTATCAGGACATAGCGTTGGCTA: first denaturation at 96°C (12 min) was followed by 34 cycles with denaturation at 95°C (30 s), annealing at 64°C (1 min 30 s) and extension at 68°C for 1 min + 3 s for cycle. All three primers were used in the same PCR reaction. Wild-type and null alleles corresponded to PCR fragments of 1061 and 618 bp, respectively.

Generation of Sgca-;Sgce-null mice

To generate Sgca-;Sgce-null mice, we crossed our Sgce-null mice with the Sgca-null mice. We first generated double heterozygotes and crossed them to obtain the homozygotes. Due to the maternal imprinting, the Sgca-;Sgce-null mice are identical to the Sgca-null/ Sgce heterozygotes (+/−) with the mutation in the paternal allele. These heterozygous were, however, not used for the experiment here reported: when we indicate ‘Sgca-;Sgce-null mice’ we always mean the true homozygous animal. At least 10 generations of mice were produced, to exclude other co-segregating unwanted alleles and a wild-type background.

Race

3′Race was performed from 2 μg of total RNA from the mouse skeletal muscle and heart reverse trascripted (SuperScript III) from the same random oligo T18 5′-gcgaattctagatctcgaggtaccttttttttttttttttttv-3′. First amplification of each cDNA was performed starting from the specific reverse forward primer 5′-agaagaattcccgttgccatatca-3′ located in exon 5 and T18, while the nested PCRs were performed with RACE–LINKER 5′-agcgaattctagatctcgaggtacct-3′ and the specific 5′-ataatgtcagcagaagaattcccgt-3′ located in the 4–5 exon junction. The PCR reactions were carried out using 20 μl reaction with 0.6 μm of each primer, 3.5 mm dNTP, 1X multibuffer JD (composition available on request) and 0.5 U of AmpliTaq polymerase (Applied Biosystem). Initial denaturation at 99°C (60 s) was followed by 30 cycles with denaturation at 95°C (30 s), annealing at 59°C (30 s) and extension at 68°C for 2 min.

Sucrose density gradients

Glycoprotein enrichment and sucrose gradient fractionation of skeletal and cardiac muscle DGC―cardiac muscle (1.5 g) from wild-type, Sgca-, Sgcb-, and Sgcd-null, MCKeSG/Sgca-null, and mdx mice was dissected from mice was solubilized by dounce homogenization in 10–15 ml cold buffer A (50 mm Tris–HCl, pH 7.4, 500 mm NaCl, 1% digitonin) with protease inhibitors (0.6 mg/ml pepstatin A, 0.5 mg/ml aprotinin, 0.5 mg/ml leupeptin, 0.1 mm phenyl methyl sulfonyl fluoride, 0.75 mm benzamidine, 5 mm calpain inhibitor I and 5 mm calpeptin). The homogenate was rotated at 4°C for 1 h, and subsequently spun at 142 400g for 37 min at 4°C. The resulting supernatant was pooled and incubated at 4°C with WGA-Agarose (Vector Laboratories). The WGA-Agarose beads were washed extensively in buffer B [50 mm Tris–HCl, pH 7.4, 500 mm NaCl, 0.1% digitonin with protease inhibitors (as above)] and proteins were eluted with 0.3 m N-acetyl glucosamine (Sigma Chemical Co.) in buffer B. The elution was diluted to 50 mm NaCl with 50 mm Tris–HCl, pH 7.4, containing 0.1% digitonin and protease inhibitors (buffer C) and applied to a DEAE-cellulose column, which was subsequently washed in buffer C. The DGC was eluted from the column 500 mm NaCl in buffer C. The 500 mm NaCl fraction was concentrated to 0.4 ml using Centricon 10-filters and applied to a 5–30% sucrose gradient at pH 7.4, as described previously (29).

Antibodies

Monoclonal antibodies from Monosan against alpha SG (Ad1/20A6), β-SG (bSARC/5B1),γ-sarcoglycan (35DAG/21B5), dystrophin C-term (DY8/6C5), β-dystroglycan (43DAG1/885) and α-dystroglycan (via4-1millipore) were used at recommended working dilutions. The polyclonal anti-delta SG was previously characterized (7) and the polyclonal anti-epsilon SG (R284) was previously described (26). Secondary anti-rabbit Alexa Fluor 568 (Invitrogen) and anti-mouse Alexa Fluor 568 (Invitrogen) were used for immunofluorescence analysis. Horseradish peroxidase-conjugated secondary antibodies from BIORAD were used for western blot analysis.

Hematoxilin and eosin staining (H&E)

The skeletal and cardiac muscle were collected at different ages. The samples were processed by cryosections at 10 μm thickness. The cryosections of the muscular tissues were fixed in 4% paraformaldehyde, then washed in phosphate-buffered saline (PBS-1×) buffer (10 mm Tris–HCl, 200 mm NaCl, 0.05% NP 40, 0.05% TWEEN 20) and stained in haematoxylin for 4 min and in eosin for 6 min. The cryosections were dried in ethanol, fixed in xylene and mounted with the EUKITT mounting kit (O.Kindler GmbH & CO). All sections were acquired under a Zeiss microscope (Carl Zeiss Inc.), using Axio Vision software at a magnification of ×5 and ×10.

Masson's trichrome staining

The cryosections of the muscular tissues were fixed in Bouin's Solution at 56°C for 15 min, cooled and washed in running tap water to remove the yellow color from the sections. They were stained in Working Weigert's Iron Haematoxylin Solution for 5 min, washed in running tap water for 5 min and stained in Biebrich Scarlet–Acid Fucsin for 5 min, then rinsed in deionised water, placed in Working Phosphotungstic/Phosphomolybdic acid solution for 5 min, stained in Aniline Blue solution for 5 min and in acid acetic 1% for 2 min. All sections were acquired under a Zeiss microscope (Carl Zeiss Inc.), using Axio Vision software at a magnification of ×5 and ×10.

Immunofluorescence analysis

For immunofluorescence analysis, 10 μm transverse cryosections were prepared. The sections were blocked with bovine serum albumin in PBS 1× for 1 h at room temperature and then incubated with a primary antibody overnight at 4°C. After washing with PBS 1×, the sections were incubated with a conjugated secondary antibody (1:300) for 1 h at room temperature and then washed with PBS1X. The sections were mounted with Vectashield with 4′,6-diamidino-2-phenylindole mounting medium (Vector Laboratories, Inc.) and acquired under a Zeiss fluorescence microscope (Carl Zeiss Inc.), using Axio Vision software at a magnification of ×20.

Western blotting

Muscle or other tissues were homogenized in a lyses assay buffer [Urea 8 m, sodium dodecyl sulphate (SDS) 4%, 125 mm Tris–HCl pH 6.8]. The samples were separated on SDS-10% polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane. After blocking in 10% no fat dry milk in Tween-Tris-buffered saline (TTBS 1×) buffer (10 mm Tris–HCl, 150 mm NaCl, 0.05% TWEEN 20) for 1 h, the membranes were incubated with primary antibodies in TTBS 1× at room temperature for 2 h. Following primary antibody incubation and rinses, the membranes were incubated with the secondary antibody in milk 0.5% and TTBS 1×. After 45 min of antibody incubation and five washes with TTBS 1× buffer, the protein band was visualized with a chemiluminescence reagent (Supersignal, WestPico, Pierce) and exposed to X-ray film. To perform this analysis, Coomassie blue staining was used for the evaluation of the myosin protein expression to understand the variations in the levels of the proteins loaded.

Electron microscopy (EM)

The hearts and muscle (quadriceps muscle) were cut out from WT and KO mice and fixed in 1% glutaraldehyde in 0.2 m 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid buffer. Then small blocks of the heart and muscle tissue were prepared and post-fixed in OsO4 and in uranyl acetate. After dehydration in a graded series of ethanol, the tissue samples were cleaned in propylene oxide, embedded in epoxy resin (Epon 812) and polymerized at 60°C for 24 h. From each sample, ultrathin (60 nm thick) sections were cut with a Leica ultracut UCT ultramicrotome. EM images were acquired from thin sections using a JEOL JEM-1011 electron microscope (Tokyo, Japan) equipped with a Morada CCD digital camera. Quantification of the sarcomere and z-line thickness was evaluated using iTEM software (Soft Imaging Systems GmbH, Munster, Germany).

Treadmill

The animals were exercised using the Treadmill (Treadmill Control LE8706—Pamlab Technology), which has an adjustable belt speed (0–80 cm/s) and shock bars with an adjustable amperage (0–2.0 mA). In the first experiment, 4-month-old mice were exercised at 7 cm/s for 5 min to familiarize them with the environment and shock grids, at 15 cm/s for 10 min and at 28 cm/s for the remaining 40 min. One week later, we repeated the treadmill exercising the mice at 7 cm/s for 5 min, at 11 cm/s for 10 min and at 22 cm/s for the remaining 40 min. If an animal became exhausted, the shock bar was turned off and the animal was allowed to rest at the back of treadmill for a short period of time.

SUPPLEMENTARY MATERIAL

Supplementary Material is available at . Conflict of Interest statement. None declared.

FUNDING

V.N. was supported by grants from Telethon, Italy (TIGEM-TVNP01TELC), from FP7/2007-2013 under grant agreement n 223143 (project acronym: TECHGENE), and from Ministero della Salute (Ricerca Finalizzata RF-MUL-2007-666195). This work is supported in part by the Senator Paul D. Wellstone Muscular Dystrophy Cooperative Research Center (1U54NS053672). K.P.C. is an investigator of the Howard Hughes Medical Institute. Y.M.K. was supported by an NIH/National Research Service Award (NRSA) Training Fellowship from the University of Iowa Cardiovascular Interdisciplinary Research (NHLBI/T32HL07121), an NRSA Fellowship (NIAMS/F32AR48742), an NIAMS/R01AR051199, a Senator Paul D. Wellstone Fellowship (NINDS/U54NS053672-S), an American Recovery and Reinvestment Act grant (NIAMS/R01AR051199-S) and an Institute for Clinical and Translation Science Pilot Grant Award (NCRR/UL1RR0024979). Funding to pay the Open Access publication charges for this article was provided by Telethon Foundation (Italy).
  29 in total

Review 1.  Molecular and cell biology of the sarcoglycan complex.

Authors:  Eijiro Ozawa; Yuji Mizuno; Yasuko Hagiwara; Toshikuni Sasaoka; Mikiharu Yoshida
Journal:  Muscle Nerve       Date:  2005-11       Impact factor: 3.217

Review 2.  The role of cytoskeletal proteins in cardiomyopathies.

Authors:  J A Towbin
Journal:  Curr Opin Cell Biol       Date:  1998-02       Impact factor: 8.382

3.  Distinct pathophysiological mechanisms of cardiomyopathy in hearts lacking dystrophin or the sarcoglycan complex.

Authors:  DeWayne Townsend; Soichiro Yasuda; Elizabeth McNally; Joseph M Metzger
Journal:  FASEB J       Date:  2011-06-10       Impact factor: 5.191

4.  Disruption of heart sarcoglycan complex and severe cardiomyopathy caused by beta sarcoglycan mutations.

Authors:  R Barresi; C Di Blasi; T Negri; R Brugnoni; A Vitali; G Felisari; A Salandi; S Daniel; F Cornelio; L Morandi; M Mora
Journal:  J Med Genet       Date:  2000-02       Impact factor: 6.318

5.  epsilon-sarcoglycan replaces alpha-sarcoglycan in smooth muscle to form a unique dystrophin-glycoprotein complex.

Authors:  V Straub; A J Ettinger; M Durbeej; D P Venzke; S Cutshall; J R Sanes; K P Campbell
Journal:  J Biol Chem       Date:  1999-09-24       Impact factor: 5.157

6.  Sarcospan, the 25-kDa transmembrane component of the dystrophin-glycoprotein complex.

Authors:  R H Crosbie; J Heighway; D P Venzke; J C Lee; K P Campbell
Journal:  J Biol Chem       Date:  1997-12-12       Impact factor: 5.157

7.  Purification of dystrophin from skeletal muscle.

Authors:  J M Ervasti; S D Kahl; K P Campbell
Journal:  J Biol Chem       Date:  1991-05-15       Impact factor: 5.157

8.  Animal models for muscular dystrophy show different patterns of sarcolemmal disruption.

Authors:  V Straub; J A Rafael; J S Chamberlain; K P Campbell
Journal:  J Cell Biol       Date:  1997-10-20       Impact factor: 10.539

9.  Autosomal recessive limb-girdle muscular dystrophy, LGMD2F, is caused by a mutation in the delta-sarcoglycan gene.

Authors:  V Nigro; E de Sá Moreira; G Piluso; M Vainzof; A Belsito; L Politano; A A Puca; M R Passos-Bueno; M Zatz
Journal:  Nat Genet       Date:  1996-10       Impact factor: 38.330

10.  Progressive muscular dystrophy in alpha-sarcoglycan-deficient mice.

Authors:  F Duclos; V Straub; S A Moore; D P Venzke; R F Hrstka; R H Crosbie; M Durbeej; C S Lebakken; A J Ettinger; J van der Meulen; K H Holt; L E Lim; J R Sanes; B L Davidson; J A Faulkner; R Williamson; K P Campbell
Journal:  J Cell Biol       Date:  1998-09-21       Impact factor: 10.539

View more
  21 in total

Review 1.  Engineering animal models of dystonia.

Authors:  Janneth Oleas; Fumiaki Yokoi; Mark P DeAndrade; Antonio Pisani; Yuqing Li
Journal:  Mov Disord       Date:  2013-06-15       Impact factor: 10.338

Review 2.  Finding the sweet spot: assembly and glycosylation of the dystrophin-associated glycoprotein complex.

Authors:  Dewayne Townsend
Journal:  Anat Rec (Hoboken)       Date:  2014-09       Impact factor: 2.064

Review 3.  What do mouse models of muscular dystrophy tell us about the DAPC and its components?

Authors:  Charlotte Whitmore; Jennifer Morgan
Journal:  Int J Exp Pathol       Date:  2014-09-30       Impact factor: 1.925

4.  Abnormal nuclear envelope in the cerebellar Purkinje cells and impaired motor learning in DYT11 myoclonus-dystonia mouse models.

Authors:  Fumiaki Yokoi; Mai T Dang; Guang Yang; Jindong Li; Atbin Doroodchi; Tong Zhou; Yuqing Li
Journal:  Behav Brain Res       Date:  2011-10-21       Impact factor: 3.332

5.  Abnormal nuclear envelopes in the striatum and motor deficits in DYT11 myoclonus-dystonia mouse models.

Authors:  Fumiaki Yokoi; Mai T Dang; Tong Zhou; Yuqing Li
Journal:  Hum Mol Genet       Date:  2011-11-11       Impact factor: 6.150

6.  Dilated cardiomyopathy mutations in δ-sarcoglycan exert a dominant-negative effect on cardiac myocyte mechanical stability.

Authors:  Matthew D Campbell; Marc Witcher; Anoop Gopal; Daniel E Michele
Journal:  Am J Physiol Heart Circ Physiol       Date:  2016-03-11       Impact factor: 4.733

Review 7.  ε-Sarcoglycan: Unraveling the Myoclonus-Dystonia Gene.

Authors:  Ana Cazurro-Gutiérrez; Anna Marcé-Grau; Marta Correa-Vela; Ainara Salazar; María I Vanegas; Alfons Macaya; Àlex Bayés; Belén Pérez-Dueñas
Journal:  Mol Neurobiol       Date:  2021-04-22       Impact factor: 5.590

8.  Mutation in ε-Sarcoglycan Induces a Myoclonus-Dystonia Syndrome-Like Movement Disorder in Mice.

Authors:  Jiao Li; Yiqiong Liu; Qin Li; Xiaolin Huang; Dingxi Zhou; Hanjian Xu; Feng Zhao; Xiaoxiao Mi; Ruoxu Wang; Fan Jia; Fuqiang Xu; Jing Yang; Dong Liu; Xuliang Deng; Yan Zhang
Journal:  Neurosci Bull       Date:  2020-12-23       Impact factor: 5.203

9.  Right atrial preference pacing algorithm in the prevention of paroxysmal atrial fibrillation in myotonic dystrophy type 1 patients: a long term follow-up study.

Authors:  Gerardo Nigro; Vincenzo Russo; Anna Rago; Andrea Antonio Papa; Alberto Palladino; Luisa Politano
Journal:  Acta Myol       Date:  2012-10

Review 10.  The heart and cardiac pacing in Steinert disease.

Authors:  Gerardo Nigro; Andrea Antonio Papa; Luisa Politano
Journal:  Acta Myol       Date:  2012-10
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.