The effects of triazophos on the trehalose content, trehalase activity and their gene expression in the brown planthopper Nilaparvata lugens (Stål) (Hemiptera: Delphacidae).

A previous study demonstrated that the flight capacity of Nilaparvata lugens adults treated with triazophos was enhanced significantly. However, the physiological and regulative mechanisms of the flight enhancement are not well understood. Trehalose is a primary blood sugar in insects, and the enzyme trehalase is involved in energy metabolism. The present study investigated the effects of triazophos on the trehalose content, trehalase activity (soluble trehalase and membrane-bound trehalase) and the mRNA transcript levels of their corresponding genes (NlTre-1 and NlTre-2) in fifth instar nymphs, as well as in the brachypterous and macropterous N. lugens adult females. Our findings showed that the trehalose content in fifth instar nymphs as well as in the brachypterous and the macropterous adults significantly decreased following triazophos treatment. However, the glucose content, soluble trehalase activity and expression level of NlTre-1 mRNA increased significantly compared to the controls. No significant enhancement of NlTre-2 expression was found, indicating that regulation of energy metabolism of triazophos-induced flight capacity in N. lugens was not associated with NlTre-2 expression. In addition, soluble trehalase activity and the expression level of NlTre-1 mRNA in the macropterous females was significantly higher than that in the brachypterous females. The present findings provide valuable information on the molecular and regulative mechanisms of the increased flight capacity found in adult N. lugens after treatment with triazophos.

Introduction

The brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae), is a major rice pest in many parts of Asia and a long-distance migratory pest in temperate eastern Asia. It is also a typical recurrent pest induced by pesticides [1-3]. Our previous study demonstrated that the soluble sugar content in adults treated with triazophos significantly increased [2] and the flight capacity of treated adults was also significantly enhanced [4]. However, the physiological mechanism of flight enhancement induced by triazophos is not yet understood. Trehalose is considered a blood sugar in insects [5]. Trehalase can catabolize one mole of trehalose to two moles of glucose. Catabolism of these sugars provides energy for flight and other physiological activities [6]. Thus, trehalose is the main sugar reserve in the hemolymph of larvae, pupae and adult insects [5,7-10]. It has been demonstrated that energy substances used in the N. lugens flying process are mainly derived from glycogen in hemolymph [11]. Therefore, the flight capacity of insects is associated with trehalose content and trehalase activity. In addition, N. lugens adults possess two wing forms: long wings (macropterous) for flight and short wings (brachypterous) for non-flight.

The objective of the present study is to examine changes in trehalose content and trehalase activity in adults treated with triazophos. Additionally, we measure the expression levels of two genes (NlTre-1 and NlTre-2) to understand the regulative mechanisms of flight enhancement in triazophos-treated adults.

Materials and methods

Rice variety and culture

Rice (Oryza sativa L.) variety Nijing 4 (japonica rice) was used in trials. This variety of rice was selected because it is commonly planted in the Jiangsu province, China. Seeds were sown outdoors in standard rice-growing soil in cement tanks (height 60 cm, width 100 cm and length 200 cm). When seedlings reached the six-leaf stage, they were transplanted into 16-cm diameter plastic pots with four hills per pot and three plants per hill. All rice plants used in experiments reached the tillering stage.

Insect culture and insecticide

A laboratory strain of N. lugens that was originally obtained from the China National Rice Research Institute (CNRRI; Hangzhou, China) was reared in a greenhouse at an ecological laboratory at Yangzhou University. N. lugens was kept in an ecological laboratory at 26 ± 1 °C, with 70–80% humidity and a 16-h light/8-h dark photoperiod. Technical triazophos (87% [AI]) was purchased from the Shenli Pesiticide Co., Ltd., Ningguo, Anhui, China.

Experiments

Triazophos was dissolved with acetone. Ten percent emulsifier was then added and diluted into four concentrations (10, 20, 40 and 80 ppm) based on previous results from a sublethal test [2,12]. A total of 160 third instars per hill were released onto potted rice plants. Rice plants at the tillering stage were sprayed with a series of concentrations of triazophos 24 h after insects were released using a Jacto sprayer (Maquinas Agricolas Jacto S.A., Brazil) equipped with a cone nozzle (1-mm diameter orifice, pressure 45 psi, flow rate 300 ml/min). Control plants at the same stages were sprayed with the same amount of acetone and emulsifier. Each treatment and control was replicated three times. The treated and control plants were covered with cages (screen size: 80-mesh). Nymphs on the treated and control plants were collected at the fifth instar stage following foliar sprays. Trehalose content and trehalase activity in the fifth nymphs were measured. To measure the trehalose content and trehalase activity in adults (macropterous and brachypterous), a single fifth instar nymph was placed into a glass jar (10-cm diameter, 12-cm height) and reared with untreated rice plants at 26 ± 1 °C with a 16L:8D photoperiod until adult emergence. After the adults emerged, females were separated. The trehalose content and trehalase activity were measured at 1, 2 and 3 days after emergence (1, 2 and 3 DAE). Twenty milligrams of fifth instar nymphs or adults were used for each replication in each treatment and control.

Measurement of trehalose content

Trehalose content was estimated by the method designed by Steele et al. [13] and Feng [14]. Twenty milligrams of whole insect bodies was homogenized at 0 °C after adding 2 ml of 20 mM phosphate buffer (PBS, pH 5.8) and then vibrated on a supersonic cell pulverizer (Ninbo Xin Yi Science Instrument Ltd., Co., Ninbo, Zhejiang) for 30 min. The sample solution was centrifuged at 1000 rpm for 10 min at 4 °C, the cuticle debris was removed and then centrifuged at 12,000 rpm for 10 min at 4 °C. Two hundred microliters of the supernatant was put into a 5 ml tube, 200 μl of 1% H2SO4 was added, the tube was bathed in 90 °C boiling water for 10 min, and 200 μl of 30% NaOH was added after it cooled on ice for 3 min. The supernatant was bathed in 90 °C boiling water for 10 min again and then bathed in 3 ml of developer with 0.02 g anthrone (Sigma, USA). Then, 10 ml of 80% H2SO4 was added after it cooled on ice for 3 min. The absorbance at 630 nm was determined in the UV755B spectrometer (Shanghai Precision Instrument Co., Ltd., Shanghai, China). Trehalose content was calculated based on a standard curve.

Measurement of glucose content

Glucose levels were determined using the glucose oxidase method (Sigma, USA) [15]. Two milliliters of 20 mM phosphate buffer (PBS, pH 5.8) was added into 20 mg of whole insect bodies and then homogenized at 0 °C. The sample solution was centrifuged at 10,000 rpm for 10 min at 4 °C. Fifty microliters of 0.6 mol L−1 perchloric acid was added into 50 μl of the supernatant to remove the protein in solution, centrifuged at 3000 rpm for 5 min at 4 °C, and 450 μl of 0.2 mol L−1 sodium phosphate buffer (pH 7.4) was then added into 50 μl of the supernatant. Two hundred microliters of chromogen reagent (Covance, New Jersey, USA) and 150 μl of glucose oxidase were added to 50 μl of the sample solution, which was incubated at 37 °C for 5 min. The absorbance at 625 nm was determined with a UV755B spectrometer (Shanghai Precision Instrument Co., Ltd., Shanghai, China). The glucose content in the sample solution was calculated based on a standard curve.

Measurement of soluble trehalase and membrane-bound trehalase activity

The separation of trehalase proteins was carried out as described by Tatun et al. [16] and Gu et al. [17]. Two milliliters of 20 mM phosphate buffer (PBS, pH 5.8) was added into 20 mg of whole insect bodies, homogenized at 0 °C, and then vibrated on a supersonic cell pulverizer (Ninbo Xin Yi Science Instrument Ltd., Co., Ninbo, Zhejiang) for 30 min. The sample solution was centrifuged at 1000 rpm for 10 min at 4 °C, and the cuticle debris was removed and centrifuged at 105,000 rpm for 10 min at 4 °C. The supernatant was directly used for measuring the activity of soluble trehalase. The residual was resuspended with 100 μl PBS for the measurement of membrane-bound trehalase. We followed the procedure described by Li et al. [18] to measure protein content using Coomassie Brilliant Blue G-250 (Shanghai Chemical Agent Co., Ltd., Shanghai, China). A standard curve was established based on a standard protein (bovine serum albumin, Shanghai Biochemistry Research Institute, Shanghai, China). The absorbance at 595 nm was determined in the UV755 B spectrometer (Shanghai Precision Instrument Co., Ltd., Shanghai, China). Fifty microliters of 40 mM trehalose (Sigma, St. Louis, MO, USA) and 110 μl of PBS were added into 40 μl of the supernatant (soluble trehalase), and 40 μl of the suspended solution (membrane-bound trehalase) was added into 50 μl of 40 mM trehalose (Sigma, St. Louis, MO, USA) and 110 μl PBS. The mixture solution was incubated at 37 °C for 30 min, bathed in 95 °C boiling water for 5 min, centrifuged at 12,000 rpm at 4 °C for 10 min after cooling on ice for 10 min. Then, the coagulated protein was removed. Trehalase activities (soluble and membrane-bound trehalase) were detected by measuring the quantity of released glucose after adding hexokinase and glucose-6-phosphate dehydrogenase [19]. Fifty units of hexokinase, 100 U of glucose-6-phosphate dehydrogenase, 2 mM NADP and 2.8 mM ATP (Roche Diagnostics GmbH, Mannheim, Germany) were added in the reaction solution and incubated at 37 °C for 30 min. Trehalase activity was determined based on a calibration curve established by a glucose standard (Sigma, St. Louis, MO, USA). The enzyme activities were expressed as μmol. mg−1 Protein.min−1.

Total RNA isolation and cDNA preparation

Total RNA was isolated from 10 adult females using an SV Total Isolation System Kit (Promega Corporation, Madison, WI, USA). Synthesis of first-strand cDNA was carried out according to the PrimeScript™ RT reagent Kit (TaKaRa Biotechnology Dalian Co., Ltd). The first-strand cDNA synthesis was performed in a 10 μl total reaction volume containing 0.5 μg total RNA, 0.5 μl PrimeScript™ RT Enzyme mix I, 0.5 μl Oligo dT Primer (50 μM), 2 μl random hexamers (100 μM), 2 μl 5 × PrimeScriptTM Buffer (for Real Time), X μl total RNA, and the addition of RNase-free dH2O up to 10 μl. The cDNA reverse transcriptase polymerase chain reaction was done with the following cycling regime: 37 °C for 15 min, 85 °C for 5 s and 4 °C for 5 min.

Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR)

mRNA levels were measured by qRT-PCR using the One Step SYBR Premix Ex Taq™ II Kit (TaKaRa Biotechnology Dalian Co., Ltd). qRT-PCR was performed in a 20 μl total reaction volume containing 0.1 μg total RNA, 0.8 μl primer mix containing 10 μM of each forward and reverse gene specific primers, 0.4 μl ROX Reference Dye II (50×), 2 μl cDNA, 10.0 μl SYBR Premix EX Taq™ II and 6.0 μl of H2O. Non-template reactions (NTC) (total RNA was replaced with H2O) and reverse transcriptase controls (PrimeScript RT Enzyme Mix was replaced with H2O) were used as negative controls. qRT-PCR was done with the following cycling regime: initial incubation at 50 °C for 2 min and at 95 °C for 5 min, 40 cycles at 95 °C for 15 s, at 58 °C for 15 s and at 72 °C for 40 s. The fluorescent signals yielded by the PCR products were detected by subjecting the products to a heat-dissociation protocol (temperature range, 56–95 °C) during the last step of each cycle. Following amplification, melting curves were constructed, and data analysis was performed by using the 7500 system SDS software. β-Actin (EU179846) was used as an internal control. mRNA levels of Nltre-1 (FJ790319) and Nltre-2 (FJ790320) were quantified in relation to the expression of β-actin. The primer pair of each gene was designed to amplify 150 bp PCR products, which were verified by nucleotide sequencing. Means and standard errors for each time point were obtained from the average of three independent sample sets. Gene specific primers for Nltre-1, Nltre-2, Nltps, and β-actin used are as follows: Nltre-1F: GTCTCACTGGTCAAGCGGTTCG, Nltre-1R: CTGT ATGATTCGGGTCTCGGAC, β-F: TGGACTTCGAGCAGGAAATGG, β-R: ACGTCGCACTTCAGATCGAG, Nltre-2F: TCGTGCCAGGTGGACGGTTTAG; Nltre-2R: CAGAACTCGAACTCTTTCTCCAG. The specificity of the primers was confirmed by using NCBI BLAST algorithms (http://www.ncbi.nlm.nih.gov/). The results were standardized to the expression level of β-actin, which is constitutively expressed in N. lugens. An NTC sample was run to detect contamination and to determine the degree of dimer formation. A relative quantitative method (△△Ct) was used to evaluate the quantitative variation [20].

Statistical analysis

Data were evaluated for normality and homogeneity of variance. Trehalose content, glucose content, trehalase activity and the corresponding genes in fifth instar nymphs were analyzed using one-way ANOVA. Brachypterous and macopterous individuals were analyzed using two-way ANOVA (wing-form and insecticide concentrations). Multiple comparisons of the means were conducted using Tukey’s test. Differences between means was deemed significant when P ≦ 0.05 [21,22].

Results

Effects of triazophos on trehalose content, glucose content, trehalase activity and the corresponding genes’ mRNA expression in fifth instar nymphs

ANOVA data in Fig. 1 shows that the trehalose content in fifth instar nymphs significantly decreased with an increase of insecticide concentrations (F = 30.2, df = 4, 14, P = 0.0001). Grand means of trehalose content in fifth instar nymphs decreased by 23.8% compared to the control (Fig. 1A). The minimum content was 11.82 ± 1.43 mg/g at 40 ppm triazophos (Fig. 1A). However, glucose content significantly increased with the same triazophos concentrations (F = 59.6, df = 4, 14, P = 0.0001). The grand mean of glucose content increased by 33.6% compared to the control. The maximum glucose content was 0.63 ± 0.03 mg/g at 40 ppm triazophos (Fig. 1B).

Fig. 1

Relationship between trehalose content (A), glucose content (B), trehalase activities (C) and NlTre-1 and NlTre-2 mRNA levels (D) in fifth instar nymphs and triazophos concentrations. Bars with different letters on the same line are significantly different at the 5% level. Means ± SE, the mRNA level is normalized relative to β-actin transcript levels. Each treatment and control was repeated three times.

Triazophos treatment resulted in a significant enhancement of soluble trehalase activity (Fig. 1C) and an increase in the level of NlTre-1 mRNA (Fig. 1D) (F = 21.6, df = 4, 14, P = 0.0001 for soluble trehalase; F = 78.6, df = 4, 14, P = 0.0001 for gene expressive level). For example, grand means of soluble trehalase activity increased by 25.2% and the level of NlTre-1 mRNA in treated fifth instar nymphs increased 1.34 times compared to the control. Similar to trehalose and glucose, the maximum values were found at 40 ppm triazophos. In contrast, no significant enhancements of both membrane-bound trehalase activity and the level of NlTre-2 mRNA were found, indicating that the activity of soluble trehalase was mainly induced by triazophos (Fig. 1C and D).

Effects of triazophos on trehalose content in brachypterous and macropterous adult females

The two-way ANOVA in Fig. 2 showed that there were significant differences in trehalose contents between the brachypterous and the macropterous adult females at different days after adult emergence (DAE) (F = 265.6, 65.9 and 60.2, P = 0.0001, 0.001 and 0.0001 for 1, 2 and 3 DAE), and among triazophos concentrations (F = 115.9, 45.3 and 81.1, P = 0.0001, 0.001 and 0.0001 for 1, 2 and 3 DAE). However, no significant interaction effects between wing-form and triazophos concentrations were found (F = 0.52, 1.93 and 0.2, P = 0.72, 0.14 and 0.93 for 1, 2 and 3 DAE). Trehalose content significantly decreased with insecticide concentration, regardless of whether the individual was brachypterous or macropterous (Fig. 2). Multiple comparisons indicated that trehalose content in adult females treated with triazophos was significantly lower than those in control females. Trehalose content decreased by 31.2%, 45.3% and 40.6% for the macropterous females and by 40.3%, 57.7%, and 48.1% for the brachypterous females at 1, 2 and 3 DAE, respectively. In addition, the average trehalose content in macropterous females was significantly lower than that in brachypterous females. Trehalose content decreased by 32.8%, 36.4% and 24.5% at 1, 2 and 3 DAE, respectively.

Fig. 2

Comparison of trehalose content (mg/g) in the brachypterous (left) and the macropterous (right) N. lugens adult females following triazophos treatment. DAE is days after adult emergence. Bars with different letters with graphs are significantly different at the 5% level. Means ± SE. Each treatment and control was repeated three times.

Effects of triazophos on glucose content in brachypterous and macropterous adult females

The two-way ANOVA in Fig. 3 showed that there were significant differences in glucose contents between the brachypterous and the macropterous adult females at different days after adult emergence (DAE) (F = 263.2, 434.9 and 160.2, P = 0.0001, 0.0001 and 0.0001 for 1, 2 and 3 DAE), and among triazophos concentrations (F = 86.2, 176.0 and 105.8, P = 0.0001, 0.0001 and 0.0001 for 1, 2 and 3 DAE). Additionally, there were significant interaction effects between wing-form and triazophos concentrations (F = 14.4, 26.4 and 12.6, P = 0.0001, 0.0001 and 0.0001 for 1, 2 and 3 DAE). Glucose content significantly increased with insecticide concentration (Fig 3) but tended to decline at 80 ppm triazophos at 1, 2 and 3 DAE. Multiple comparisons of the means indicated that the glucose content in adult females treated with triazophos was significantly higher than that in control females. Grand means of glucose content in brachypterous and the macropterous females increased by 49.8%, 88.0% and 75.3%, and by 82.0%, 131.8% and 106.8% at 1, 2 and 3 DAE, respectively. In addition, average trehalose content in the macropterous females was significantly higher than that in the brachypterous females and increased by 63.9%, 71.0% and 49.6% at 1, 2 and 3 DAE, respectively.

Fig. 3

Comparison of glucose content (mg/g) between brachypterous (left) and macropterous (right) N. lugens adult females following triazophos treatment. DAE is days after adult emergence. Bars with different letters with graphs are significantly different at the 5% level. Means ± SE. Each treatment and control was repeated three times.

Changes of triazophos-induced activity of soluble trehalase and membrane-bound trehalase in brachypterous and macropterous adult females

Two-way ANOVA of the data from Fig. 4 showed that triazophos significantly affected soluble trehalase activity in the brachypterous and macropterous adult females but did not influence membrane-bound trehalase activity (Table 1). Soluble trehalase activity in the brachypterous or the macropterous females significantly increased with insecticide concentration but showed a decline at 80 ppm triazophos (Fig 4). Grand means of soluble trehalase activity in the brachypterous and the macropterous females increased by 38.3%, 67.2% and 22.9% at 1, 2 and 3 DAE, compared to the control, and by 62.8%, 111.1% and 86.2%, respectively. Average soluble trehalase activity in the macropterous females was significantly higher than that in the brachypterous females, increasing by 116%, 122% and 109% at 1, 2 and 3 DAE. Multiple comparisons of means indicated that trehalase activity in adult females treated with triazophos were significantly higher than that in control females. In addition, the activity of soluble trehalase was much higher than membrane-bound trehalase (Fig. 4).

Fig. 4

Comparison of activity of soluble trehalase and membrane-bound trehalase (μmol. mg−1 Protein.min−1) in the brachypterous (left) and the macropterous (right) N. lugens adult females after treatment with triazophos. DAE is days after adult emergence. The different letters in the same line indicates significant differences at the 5% level. Means ± SE. Each treatment and control was repeated three times.

Table 1

ANOVA of activity of soluble trehalase and membrane-bound trehalase in the brachypterous and macropterous adult females from Fig. 3.

DAE	Source of variance	Df	Soluble F-value	P-value	Membrane-bound F-value	P-value
1	Wing-form(A)	1	1473.4	0.0001	34.5	0.0001
	Concentration (B)	4	1118.4	0.0001	1.34	0.2885
	A × B	4	29.9	0.0001	0.013	0.9996
2	A	1	1718.4	0.0001	18.9	0.0003
	B	4	229.2	0.0001	0.73	0.5843
	A × B	4	59.7	0.0001	0.15	0.9622
3	A	1	1852.4	0.0001	5.6	0.0284
	B	4	225.5	0.0001	1.9	0.1453
	A × B	4	52.1	0.0001	0.35	0.8415

Df is degrees of freedom. DAE is days after adult emergence.

Changes of expression in triazophos-induced NlTre-1 and NlTre-2 mRNA in the brachypterous and the macropterous adult females

Two-way ANOVA of the data from Fig. 5 showed that triazophos significantly enhanced expression levels of NlTre-1 mRNA in the brachypterous and the macropterous females (Table 2). NlTre-1 mRNA expression levels in the brachypterous and the macropterous females significantly increased with insecticide concentrations (Fig 5) but maximized at 40 ppm triazophos at 1, 2 and 3 DAE. Grand means of expression levels of NlTre-1 mRNA in the brachypterous and the macropterous females treated with triazophos increased by 148%, 194% and 177% at 1, 2 and 3 DAE, compared to control females, and by 191%, 270% and 223%, respectively. In contrast, no increase in NlTr-2 mRNA expression was found (Fig. 5). In addition, the average NlTre-1 mRNA expression of macropterous females was much higher than that of the brachypterous females and increased by 61.1%, 78.1% and 63.2% at 1, 2 and 3 DAE, respectively. Multiple comparisons of means indicated that the expression levels of NlTre-1mRNA in adult females treated with all concentrations of triazophos was significantly higher than those of control females.

Fig. 5

Comparison of expression levels of NlTre-1 and NlTre-2 mRNA of the brachypterous (left) and macropterous (right) N. lugens adult females after treatment with triazophos. DAE is days after adult emergence. The different letters in the same line indicates significant differences at the 5% level. Means ± SE. The mRNA level is normalized relative to β-actin transcript levels. Each treatment and control was repeated three times.

Table 2

ANOVA of expression levels of NlTre-1 and NlTre-2 in the brachypterous and macropterous adult females from Fig. 4.

DAE	Source of variance	Df	NlTre-1 F-value	P-value	NlTre-2 F-value	P-value
1	Wing-form(A)	1	794.1	0.0001	10.6	0.0039
	Concentration (B)	4	202.7	0.0001	1.47	0.2492
	A × B	4	24.9	0.0001	0.49	0.7457
2	A	1	1231.8	0.0001	13.8	0.0014
	B	4	434.3	0.0001	0.61	0.6615
	A × B	4	57.6	0.0001	0.10	0.9831
3	A	1	639.4	0.0001	9.4	0.0061
	B	4	225.3	0.0001	0.93	0.4683
	A × B	4	25.2	0.0001	0.18	0.9438

Df is degrees of freedom. DAE is days after adult emergence.

Discussion

The brown planthopper, N. lugens (Stål) (Hemiptera: Delphacidae), is a long-distance migratory insect pest in temperate eastern Asia and a typical recurrent pest induced by pesticides [23]. The previous study demonstrated that three insecticide treatments (imidacloprid, triazophos and deltamethrin) on rice plants result in a significant increase in the soluble sugar and crude fat content in nymphs and adults compared to untreated controls [2]. Furthermore, the crude fat content in the fifth instar nymphs and adults that developed from rice plants treated with insecticides and from a migratory population was significantly higher than that from a non-migratory population [24]. Therefore, flight capacity of adults N. lugens developed from nymphs feeding on rice plants treated with insecticides (including triazophos) was enhanced [4], indicating that treated rice plants supply more energy for N. lugens flight, which is mainly attributed to pesticide-induced susceptibility of rice to N. lugens (treated rice plants are beneficial to feeding of N. lugens) [48]. However, the mechanism behind the increase of these energy reserves in both the brachypterous and the macropterous females following the triazophos treatment is unknown. Additionally, the molecular and regulative mechanisms of energy metabolism in N. lugens adult females treated with triazophos have not been investigated.

In insects, trehalose is the primary blood sugar and is present at high concentrations in the hemolymph [5,8,10]. Trehalose and trehalase activity play an important role in the regulation of insect development and growth [25]. Our findings show that the trehalose content in different developmental stages of N. lugens significantly decreased with triazophos treatment (Figs. 1 and 2). In contrast, glucose content significantly increased (Fig. 3), indicating that glucose supplies energy in the initial phase of N. lugens flight and is beneficial to N. lugens adult migration. The energetic substances used for flying insect are mainly sugars and lipids. The tethered-flight experiment demonstrated that N. lugens adult utilizes fat as fuel during flight [26]. Shen and Chen [27] revealed that the fecundity of N. lugens adult females significantly increased after long-distance migration. Additionally, the molted larvae (Bombyx mori) exhibited a further decrease in trehalose levels and an increase in glucose and trehalase activity when exposed to high temperature (36 °C) [28].

Tang et al. [29] showed that trehalase is one of main factors that regulate trehalose levels in insect hemolymph. The use of sugar as an energy source in flight, or osmotic regulation, is controlled by trehalase activity [30]. The present findings show that soluble trehalase activity accounts for two-thirds of the total activity in fifth instar nymphs and the brachypterous adult females, which is significantly lower than the three-quarters found in macropterous adult females (Figs. 1 and 4). Soluble trehalase activity was much higher in the macropterous than in the brachypterous N. lugens adult females. We found no apparent increase in the membrane-bound trehalase activity for both the macropterous and the brachypterous adult females under the same conditions (Fig. 4). However, the membrane-bound activity and NlTre-2 mRNA levels in the macropterous were higher than in the brachypterous females, indicating that glucose utilization was higher in the macropterous’ flight muscle than in the brachypterous’. The membrane-bound enzyme and SbTre-2 are involved in incorporating trehalose from the blood into muscular cells and then providing the energy required by visceral muscles to support peristaltic movement of the midgut for active feeding [31,32]. Trehalase activity was enhanced in the midgut of silkworms treated with fenvalerate [33]. However, the enhanced trehalase activity may also be due to increased hydrolysis of trehalose to two glucose moieties. This reaction plays an important role in silkworm carbohydrate metabolism [34]. Similar disturbances in carbohydrate metabolism and related enzymes other than trehalase from organophosphorous insecticides have been reported in B. mori [35].

Trehalase activity in various insects is at least in part under hormonal regulation. Hormones that regulate trehalase include juvenile hormone (JH), 20-hydroxyecdysone (20E) and diapause hormone (DH) [36-39]. Exogenous 20E has been shown to lower the hemolymph trehalose content in B. mori and Omphisa fuscidentalis, indicating that 20E can induce trehalase activity [40,41]. Our findings show that exogenous triazophos significantly induced soluble trehalase activity and the expression of NlTre-1 mRNA in brachypterous and macropterous adult females but did not induce membrane-bound trehalase activity or the level of NlTre-2 mRNA (Figs. 4 and 5). In O. fuscidentalis, the genes OfTre-1 and OfTre-2 encode two forms of trehalase, but only soluble trehalase activity and OfTre-1 mRNA levels were induced by exogenous 20E [16]. In N. lugens, exogenous 20E significantly induced soluble trehalase and the expression of NlTre-1 in macropterous adult females [17]. In Spodoptera exigua, RNA interference (RNAi) of SeTre-1 and SeTre-2 causes high mortality during the larva–pupal stage and pupal–adult stage. Additionally, the change trends of concentration of trehalose and glucose appeared reciprocally in RNAi-mutants [42].

Trehalose is a major fuel in the initial phase of locust flight, and trehalase activity increases at the start of flight, when flight muscles utilize lipids as the main fuel during prolonged flight [43]. Mythimna separate (Walker) uses glycogen for fuel during its initial period of flight [44]. The primary energy sources for Helicoverpa armigera (Hubner) flight are triglycerides and glycogen [45]. However, some studies demonstrate that lipids are also the primary energy substances for flight [11,26,46]. In addition, there are conflicting data regarding the energy form utilized during flight even within a single species of insect [46,47]. This variability may also be associated with the age of the insect. Our findings showed that triazophos induced soluble trehalase activity and increased NlTre-1 mRNA levels in the macropterous and the brachypteous adult females, indicating that soluble trehalase activity and the levels of NlTre-1 mRNA play an important role in the long-distance migration and fecundity of N. lugens. This is being further investigated in our laboratory.