Trypanosoma vivax, T. congolense "forest type" and T. simiae: prevalence in domestic animals of sleeping sickness foci of Cameroon.

In order to better understand the epidemiology of Human and Animal trypanosomiasis that occur together in sleeping sickness foci, a study of prevalences of animal parasites (Trypanosoma vivax, T. congolense "forest type", and T. simiae) infections was conducted on domestic animals to complete the previous work carried on T. brucei gambiense prevalence using the same animal sample. 875 domestic animals, including 307 pigs, 264 goats, 267 sheep and 37 dogs were sampled in the sleeping sickness foci of Bipindi, Campo, Doumé and Fontem in Cameroon. The polymerase chain reaction (PCR) based method was used to identify these trypanosome species. A total of 237 (27.08%) domestic animals were infected by at least one trypanosome species. The prevalence of T. vivax, T. congolense "forest type" and T. simiae were 20.91%, 11.42% and 0.34% respectively. The prevalences of 7 vivax and T. congolense "forest type" differed significantly between the animal species and between the foci (p < 0.0001); however, these two trypanosomes were found in all animal species as well as in all the foci subjected to the study. The high prevalences of 7 vivax and T congolense "forest type" in Bipindi and Fontem-Center indicate their intense transmission in these foci.

Introduction

Animal trypanosomosis constitutes a serious handicap to animal husbandry in all regions of sub- Saharan Africa infested by tsetse flies (Vaucel ). The infection agents are protozoans of the genus Trypanosoma. In tsetse infected areas, species and subspecies T. congolense, T. vivax, T. simiae and to a less extend T. b. brucei are pathogenic parasites to animals, especially Suidae and domestic ruminants (Omeke, 1994; Reifenberg ). Most of these trypanosome species pathogenic to animals are transmitted by tsetse flies. However, T. vivax can be mechanically transmitted by Tabanids or Stomoxys in Africa, and it is presumed to be transmitted only mechanically in areas not infested by tsetse flies (Gardiner & Wilson, 1987; Gardiner, 1989; D’Amico ). Moreover, experimental studies have demonstrated the possibility of mechanical transmission of T. congolense and T. brucei species by tabanids and Stomoxys (Mihok ; Sumba ). However, the importance of such transmission under natural conditions is still under debate (Desquesnes & Dia, 2003).

In animals, infection with trypanosome may result in a chronic, debilitating, emaciating and often fatal disease but the outcome of the infection differs substantially between trypanosome species or subspecies, between livestock species and within a livestock species among breeds depending on the challenge and virulence of the strains (Connor & van Den Bossche, 2004). Due to their frequencies, pathogenicity and consequence on productivity, T. congolense and T. vivax are the principal trypanosomes in domestic ruminants (Wellde ; Trail ).

Desoxyribonucleic acids (DNA) probes have allowed the identification of four different sub-species of T. congolense in different ecological zones: T. congolense “forest type”, T. congolense “savannah type”, T. congolense “Kilifi type” and T. congolense “Tsavo” (Majiwa ; Masiga ; Clausen ; Majiwa ). These variants of T. congolense are pathogenic and develop high parasitaemia accompanied by anemia and leucopenia (Sidibe ; Bengaly , b). However, there are clear differences in the pathogenicity among the various types of T. congolense and even within one single type. For example, experimental studies comparing the virulence of one strain of each subgroup in mice and cattle have shown differences between the subgroups with the T. congolense strain of the Savannah subgroup being the most virulent (Bengaly , b). Moreover, substantial differences in the virulence of T. congolense strains of the “savannah” subgroup, isolated in one geographical area from a single host species have also been recently reported (Masumu ).

For T. vivax infections, it is well known that animals infected by this trypanosome support better the infection because their genetic diversity is more limited than that of T. congolense and T. brucei (Authié ). However, fulminant and hemorrhagic forms of T. vivax that cause death or abortion have been described (Hudson, 1944; Olubayo ). T. congolense and T. vivax species have been shown to cause serious infections in horses and asses (Faye ; Dhollander ). T. simiae has been reported as a parasite of suidae (Stephen, 1966).

During herd control by veterinary services, T. vivax, T. congolense or T. b. brucei were found in pigs, ruminants and equines in West Africa (Mattioli ; Omeke et al., 1994; Solano ; Faye ; Dhollander ). In the Central African region, limited work has been conducted on animal trypanosomosis, especially in sleeping sickness foci where Trypanosoma brucei gambiense is the causative agent of the disease. Indeed, in the forest area of southern Cameroon where studies were undertaken in the historic sleeping sickness foci of Fontem and Mbam, T. congolense, T. vivax and T. simiae were identified in pigs and small domestic ruminants (Asonganyi ; Asonganyi ; Simo ). Moreover, the presence of T. brucei s.l., T. congolense and T. vivax were reported in cattle of the pastoral zone of Adamaoua (North-Cameroon) (Mamadou ). However, most of these works were performed either on one species of domestic animals or used parasitological and immunological methods. Given the low sensitivity and specificity of these methods, it is obvious that the prevalence of different trypanosomes species or subspecies were considerably underestimated. With the development of molecular biology during the last decades, specific DNA sequences of different trypanosome species and subspecies have been identified and several PCR based methods were developed to improve the detection of various parasites. Applied in human and animal trypanosomosis, PCR appeared as a reliable, sensitive and specific techniques enabling to detect different trypanosome species and subspecies in vertebrate hosts as well as in tsetse flies (Masiga ; Desquesnes & Tresse, 1996; Penchenier ; Mugutu ; Picozzi ; Geysen ; Delespaux ; Gonzales ; Cox ).

The present study reports the level of infections with T. vivax, T. congolense “forest type” and T. simiae in four species of domestic animals commonly found in sleeping sickness foci of forest areas of southern Cameroon.

Materials and Methods

Study area

The study was carried from 2002 to 2004 in four sleeping sickness foci of the forest region of Southern-Cameroon (Fig. 1):

Fig. 1.

Study area in Cameroon.

M: Molecular weight markers (100 bp); C + : T. vivax DNA (150 bp); C-: negative control; 1-9 samples; 2; 4; 7 and 8: negative samples; 1; 3; 5; 6 and 9: positive samples.

Bipindi (3°2’N, 10°22’E), is a historic sleeping sickness focus discovered in 1920 which has been in recrudescence recently (Grébaut ). It lies between Lolodorf and Kribi, at 75 Km from the Atlantic Ocean. Though, Glossina palpalis palpalis is the dominant tsetse fly species, other tsetse fly species like G. pallicera, G. caliginea and G. nigrofusca can be also found in this focus (Morlais ; Simo ). The domestic animals were bled in the villages Bijouka, Lambi, Memel, Bipindi-Centre and Ebimingbang.

Campo (2°20’N, 9°52’E), is a hypo-endemic focus where a few sleeping sickness patients are detected each year. It lies along the River Ntem which separates Cameroon and Equatorial Guinea and flows into the Atlantic Ocean. Several tsetse fly species including G. p. palpalis, and to a lesser extent, G. pallicera, G. caliginea and G. nigrofusca are encountered in this sleeping sickness focus (Morlais ; Simo ). Samples were taken from domestic animals in the villages Akak, Mabiogo, Ipono, and Campo center.

Fontem (5°40’N, 9°55’E) is a sleeping sickness focus known since 1949 where the prevalence of sleeping sickness has reduced considerably. It has a much varied topography with numerous hills and valleys through which high speed rivers flow in the South Western Region of Cameroon. G. p. palpalis is the only tsetse fly species found in this area (Morlais ; Simo ). The focus is divided into three sub-foci (North, Center and South). In the Center sub-focus where the samples were taken (villages of Menji, Fotabong, Soko, Azi), few sleeping sickness patients were detected during the last decade. In the Northern villages (Bechati, Folepi, Besali), no patients have been detected during the last 20 years (Ebo’o Eyenga, personal communication), although in pigs, the prevalence of T. b. gambiense group 1 infections was 15% in 1999 (Nkinin ).

Doumé (4°16’N, 13°25’E) is an old sleeping sickness focus in the Eastern Region of Cameroon where very few sleeping sickness patients were detected during the last decade. Glossina fuscipes is the main tsetse fly species found in this focus (Mbida Mbida ). Doumé is a degraded forest zone with many rivers and vast areas of wetlands. Samples were collected from domestic animals in the villages Medim, Paki, Baillon and Loumbou.

In these four sleeping sickness foci where cattle is rare, pigs, sheep, goats and chickens are kept to meet dietary, ceremonial and commercial needs. Dogs serve as pets and hunting companions.

Blood collection from animals

Domestic animals were sampled during five field surveys: one was done at Doumé (October 2002), one at Bipindi (July 2003), one at Fontem (October, 2003) and two at Campo (April 2003 and June 2004). During each survey, about one in three animals that has spent at least three months in the focus was sampled and bled with the cooperation of the owners, but some dogs did not cooperate. Goats and sheep were bled from the jugular vein; pigs from the sub-clavicular vein and dogs from the cephalic vein. The blood was put in EDTA coated tubes, labeled and preserved at 4 °C for molecular analyses.

All pigs and dogs sampled in this study were of a local breed, originating from a mixture of different breeds. The sheep and goats are Dwarf breeds (Djallonke West-African Dwarf for sheep and Guinea goat), which are known to be trypanotolerant.

Extraction and amplification of DNA

DNA was extracted from the samples using the kit “Ready Amp Genomic DNA purification system” (PROMEGA) essentially as described by Penchenier . The supernatant containing DNA was stored at -20 °C or used directly for PCR.

Amplification of trypanosome DNA was conducted using the primer pairs TCF1 (GGACACGCCAGAAGGTACTT) / TCF2 (GTTCTCGCACCAAATCCAAC), TVW1 (CTGAGTGCTCCATGTCCCAC) / TVW2 (CCACCAGAACACCAACCTGA), and TSM1 (CCGGTCAAAAACGCATT) / TSM2 (AGTCGCCCGGAGTCGAT) specific for T. congolense “forest type”, T. vivax and T. simiae respectively (Masiga ). The amplifications were conducted in a total volume of 25 μl containing 2.5 μl of PCR buffer 10X [10 mM Tris – HCl (pH 9.0), 50 mM KCl, 3 mM MgCl2], 15 picomoles of each primer, 200 μl of deoxynucleotide-triphosphate (dNTP), one unit of Taq DNA polymerase (Appligene-Oncor, USA), sterile water and 3 μl DNA extract. Amplification involved pre-denaturation at 94 °C for 3 min 30 s followed by 40 cycles of denaturation at 94 °C (30 s), hybridization of primers at 60 °C and elongation at 72 °C for 1 minute, then final elongation at 72 °C for 5 min. The amplification products were resolved on 2% agarose gel containing ethidium bromide (0.3 μg/ml). DNA bands were visualized under ultraviolet (UV) light.

Statistical analyses

The proportions of animals infected by different trypanosome species were compared between animals and localities using Chi-square (χ2) test of the Statistix Computer program.

Results

Fig. 2 shows an example of profiles obtained after resolution of PCR products from the amplification of T. vivax DNA. Tables I and II report the number of animals analyzed and the PCR-positive samples by animal species and localities. Although only the results of three trypanosomes species (T. vivax, T. congolense “forest type” and T. simiae) are reported in this study, T. brucei s.l. and T. b. gambiense group 1 (human infective trypanosome) were also investigated and the results are reported in Njiokou . These authors showed that 19.88% and 3.08% of the animals were infected by T. brucei s.l. and T. b. gambiense respectively. T. b. gambiense were harboured by pigs, already known to be reservoir hosts, but also by goats and sheep, pointing out their contribution to the epidemiology of HAT. The prevalences significantly varied according to the animal species and the focus, in connection with the level of endemicity of HAT. In this study, 27.08% (237/875) of animals analyzed were infected by at least one of the three trypanosome species (Tables I and II). The levels of infection differed significantly between animal species (χ2 = 77.92; p < 0.0001) and between localities (χ2 = 52.89; p < 0.0001). T. vivax was the most predominant trypanosome in animals with a global infection rate reaching 20.91% and more precisely 36.15% in pigs, 18.18% in goats, 8.61% in sheep and 2.7% in dogs. T. congolense “forest type” was identified in 11.42% of the animals, and 19.86%, 10.22%, 8.1% and 3.37% for pigs, goats, dogs and sheep respectively. T. simiae was rare (0.34%) and was diagnosed only in two (0.75%) goats and one (0.37%) sheep. The frequency of T. vivax and T. congolense “forest type” differed significantly between animal species and between localities (p < 0.0001). The comparison of T. vivax infection rates in different pairs of animal species showed significant differences, except for the sheep/dog pair. Significant differences were also observed for the T. congolense “forest type” infection rates for the pig/goat, pig/sheep and goat/sheep pairs.

Fig. 2.

Electrophoretic profile showing the resolution of T. vivax specific DNA.

Table I.

Number and percentage of animals infected with T. congolense, T. vivax and T. simiae.

	Number of positive PCR (percentage)
Animal species	NE	TCF	TVW	TSM	NP
Pigs	307	61 (19.86)	111 (36.15)	0 (0)	133 (43.32)
Goats	264	27 (10.22)	48 (18.18)	2 (0.75)	69 (26.13)
Sheep	267	9 (3.37)	23 (8.61)	1 (0.37)	31 (11.61)
Dogs	37	3 (8.1)	1 (2.7)	0 (0)	4 (10.81)
Total	875	100 (11.42)	183 (20.91)	3 (0.34)	237 (27.08)
χ2		39,5	76,15		77,92
p		0.0001	0.0001		0.0001

The number of positive PCR are given with their percentage in the brackets; TCF: Trypanosoma congolense “forest type”; TVW: Trypanosoma vivax, TSM: Trypanosoma simiae; NE: number of animals examined; NP: number of animals parasite-positive (having DNA of at least one species), χ2: Chi-square test; p: p value.

Table II.

Number and percentage of animals infected with T. congolense, T. vivax and T. simiae in various localities.

	Number of positive PCR (percentage)
Locality	NE	TCF	TVW	TSM	NP
Bipindi	204	30 (14.7)	65 (31.86)	0 (0)	80 (39.21)
Campo	310	32 (10.32)	65 (20.96)	2 (0.64)	82 (26.45)
Fontem-center	154	28 (18.18)	44 (28.57)	0 (0)	55 (35.71)
Doumé	207	10 (4.83)	9 (4.34)	1 (0.48)	20 (9.66)
Total	875	100 (11.42)	183 (20.91)	3 (0.34)	237 (27.08)
χ2		18.3	54.6		52.89
p		0.0001	0.0001		0.0001

The number of positive PCR are given with their percentage in the brackets; TCF: Trypanosoma congolense “forest type”; TVW: Trypanosoma vivax, TSM: Trypanosoma simiae; NE: number of animals examined; NP: number of animals parasite-positive (having DNA of at least one species), χ2: Chi-square test; p: p value.

The comparison by locality showed that animals from Bipindi and Fontem-Center are more frequently infected with T. vivax and T. congolense “forest type”. Howerver, the level of infection of these trypanosome species does not differ significantly between these two localities (χ2 = 0.44; p = 0.5) and (χ2 = 0.78; p = 0.37) respectively. Animals from Doumé were significantly less infected by T. vivax and T. congolense “forest type” than those of the other localities. Significant differences were observed between the T. vivax infection rates in Bipindi and Campo (χ2 = 7.72; p = 0.005) as well as between the T. congolense “forest type” infection rates in Fontem-Center and Campo (χ2 = 5.64; p = 0.017). However, animals from Bipindi and Fontem-Center are more infected by T. vivax and T. congolense “forest type” respectively.

Mixed infections were found in 32 animals including 26 pigs and 6 goats carrying both T. congolense “forest type” and T. vivax; one sheep carried both T. vivax and T. simiae; and one goat carried triple infections of T. congolense “forest type”, T. vivax and T. simiae (Table III). When taking into account the occurrence of T. b. gambiense revealed in Njiokou , three other double infections with T. b. gambiense group 1 and T. vivax are identified in one sheep and one goat while T. b. gambiense group 1 and T. congolense “forest type” was identified in one sheep. Furthermore, one goat was infected with four trypanosomes including T. b. gambiense group 1, T. vivax, T. congolense “forest type” and T. simiae.

Table III.

Type, nature and number of infections revealed by PCR in different domestic animal species.

		Number of single and mixed infections
Type of infections	Trypanosome identified	Pigs	Goats	Sheep	Dogs	Total
Single	TCF	70	31	11	1	113
	TVW	19	17	6	2	44
	TSM	0	1	0	0	1
Double	TCF et TVW	26	6	0	0	32
	TVW et TSM	0	0	1	0	1
Triple	TCF, TVW et TSM	0	1	0	0	1

TCF: Trypanosoma congolense “forest type”; TVW: Trypanosoma vivax, TSM: Trypanosoma simiae.

Discussion

In this study, PCR revealed infections with T. congolense “forest type”, T. vivax and T. simiae in the domestic animals, thus confirming the circulation of these parasites in the sleeping sickness foci of southern Cameroon as previously reported in tsetse flies (Morlais ), wild animals (Herder ; Njiokou ; Njiokou ) and pigs (Penchenier ; Simo ). The infection rate of 27.08% is in line with results obtained in pigs, small domestic ruminants, and dogs in the Central and West African regions (Asonganyi , 1990; Makumyaviri ; Omeke, 1994; Penchenier ; Dadah ; Kalu ), also out of any sleeping sickness areas.

The high prevalence of T. vivax corroborates other findings in domestic animals (Bourzat & Gouteux, 1990; Dadah ; Kalu ) as well as wild animals (Komoin-Oka ; Truc ; Herder ; Njiokou ; Njiokou ) of the Central and West Africa regions. This high prevalence of T. vivax may result from the level of pathogenicity of this trypanosome, which is generally low and better controlled by animals (Stephen, 1970; Authié ). It may result also from the mechanical transmission, which has not been reported in the other species studied here, except in certain extend T. congolense.

The identification of T. vivax in pigs is in accord with results obtained by Ng’ayo in East Africa. Using specific primers, these authors showed that T. vivax infections are frequent in pigs and goats. Penchenier and Simo also found numerous T. vivax infections in pigs from Cameroon, by PCR. These results need to be confirmed by other techniques because it is generally accepted that pigs are refractory to infections with T. vivax (Taylor & Authié, 2004). The fact that T. vivax is detected only by PCR based methods and not by parasitological techniques could be explained by ‘‘transient’’ infections. Moreover, with the development of new genotyping tools that do not require isolation of trypanosomes, it is urgent to characterize T. vivax circulating in pigs as well as in other vertebrate hosts in order to investigate if some strains might be infective to pigs and others non-infective. Indeed, previous studies have suggested genetic variation in T. vivax populations that renders some isolates more pathogenic than others (Mwongela ; Wellde ; Roeder ).

The lower prevalence of T. congolense “forest type” with respect to T. vivax in domestic animals may result from higher parasitemia in T. congolense infections, accompanied by serious anemia, which leads to the rapid death of the host animal (Sidibe ; Bengaly , b).

The very low prevalence of T. simiae as already reported in pigs (Penchenier ; Simo ) and wild animals (Herder ; Njiokou ) of several sleeping sickness foci indicates a low transmission of this parasite in various localities of Cameroon. The absence of T. simiae in pigs of various areas of Cameroon is likely due to its high pathogenicity because pigs infected with this trypanosome species would probably not survive. Our results corroborate those obtained by Simo in pigs of the Fontem sleeping sickness focus of Cameroon.

Our results also showed a significant difference in the prevalence of T. vivax and T. congolense “forest type” between the different animal species. Pigs are more infected than goats, sheep and dogs; this could either be indicative of a higher susceptibility of pigs to T. vivax and T. congolense, or of a higher frequency of contact with the tsetse fly vector. Indeed, it has been shown that G. p. palpalis takes more blood meals from pigs than from goats and sheep and rarely on carnivores (Dagnogo ; Sané ; Späth, 2000; Simo ). The keeping of pigs in sties near habitations exposes them to more contacts with peri-domestic tsetse flies (Frézil ) than animals that roam freely. Finally, the highest prevalences of T. vivax and T. congolense “forest type” in domestic animals from Bipindi and Fontem-Centre respectively, confirm the results reported in wild animals from Bipindi (Herder ; Njiokou ) and in domestic animals from Fontem (Asonganyi ) and indicate their intense transmission in these sleeping sickness foci.

The presence of T. vivax and T. congolense in all the localities studied is not only indicative of the ubiquity of the trypanosomes, but also of the presence of an appropriate vector in the foci. Their prevalence in Bipindi and Fontem where G. p. palpalis represents about 100% is higher than in Campo where G. p. palpalis represents only 56% and Doumé where G. fuscipes is the only tsetse fly species found (Mbida Mbida ).

Our results on mixed infections in pigs corroborate those of Jamonneau who reported a high proportion of mixed infection in pigs of the Bonon sleeping sickness focus in Côte d’Ivoire and those of Simo in pigs of the Fontem sleeping sickness focus in Cameroon. These results are in line with those obtained in tsetse flies (Morlais ; Masiga ; Reifenberg ; Malele ). Indeed, entomological studies showed that infected tsetse flies from the sleeping sickness foci of Cameroon (Morlais ) and other zones of Africa (Masiga ; Reifenberg ; Malele ) frequently harbour more than one trypanosome species. This demonstrates the high probability of tsetse flies to transmit several trypanosome species to vertebrate hosts. Up till now, the interaction and the evolution of different trypanosome species or subspecies in the infected hosts remain not yet well understood. Experimental studies have shown that primary infection with T. congolense prevents the establishment of a second strain of T. congolense (Morrison ) while an animal already infected with T. congolense becomes refractory to T. brucei s.l. infections (second infection), but not T. vivax (Dwinger ). Results of our study, especially the low proportion of mixed infection including T. congolense “forest type” and T. b. gambiense (see also Njiokou data) and the considerable numbers of mixed infections involving T. vivax and T. congolense “forest type” play in favor of these experimental studies. However, in the field conditions where tsetse flies are infected by several trypanosome species, it is obvious that several trypanosome species or subspecies are transmitted to the same hosts. In such conditions, the prevalence of each species of trypanosome in the mixed infections may reflect probably the prevalence of this trypanosome species in the locality. Our results on the mixed infections of several trypanosomes species in vertebrate hosts suggest further investigations on the establishment and the evolution of different trypanosomes species or subspecies in the vertebrate hosts. Such investigations may enable to understand some aspects of the Human African Trypanosomiasis as well as Animal African Trypanosomiasis. For example, these investigations may enable to know if some trypanosome species can prevent the establishment and the evolution of T. b. gambiense and if genetic exchanges between the same trypanosome species can occur in vertebrate hosts.