Literature DB >> 21658736

Characterization of enterotoxigenic E. coli (ETEC), Shiga-toxin producing E. coli (STEC) and necrotoxigenic E. coli (NTEC) isolated from diarrhoeic Mediterranean water buffalo calves (Bubalus bubalis).

G Borriello1, M G Lucibelli, E De Carlo, C Auriemma, D Cozza, G Ascione, F Scognamiglio, G Iovane, G Galiero.   

Abstract

Two hundred and twenty Escherichia coli isolates from 314 Mediterranean water buffalo calves less than 4 weeks old affected by severe diarrhoea with a lethal outcome were characterized for the presence of the virulence factors LT, ST, Stx1, Stx2, haemolysins, intimin, CNF1, CNF2, CDT-I, CDT-II, CDT-III, CDT-IV, and F17-related fimbriae (F17a, F17b, F17c, F17d). The prevalence of ETEC, STEC and NTEC were 1.8%, 6.8% and 20.9%, respectively. The ETEC isolates were all LT-positive and ST-negative. The STEC isolates were all Stx and intimin-positive, with Stx1 (80%) more frequent than Stx2 (27%). The NTEC isolates were all CNF and Hly-positive, with CNF2 (83%) more frequent than CNF1 (22%). Susceptibility assays to 11 antimicrobials displayed high rates of resistance (>30%) to antimicrobials tested. These data show that the most prevalent strains in diarrhoeic water buffalo calves were NTEC, mostly CNF2 and HlyA-positive, with strong associations CNF2/CDT-III and CNF2/F17c.
Copyright © 2011 Elsevier Ltd. All rights reserved.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21658736      PMCID: PMC7118792          DOI: 10.1016/j.rvsc.2011.05.009

Source DB:  PubMed          Journal:  Res Vet Sci        ISSN: 0034-5288            Impact factor:   2.534


Escherichia coli infections can be caused both in humans and animals by different pathovars, most frequently identified as enterotoxigenic E. coli (ETEC), enterohaemorrhagic E. coli (EHEC) including Shiga-toxin producing E. coli (STEC) and enteropathogenic E. coli (EPEC). These pathovars can induce a variety of diseases, such as diarrhoea, haemorrhagic colitis, and extra intestinal infections (Croxen and Finlay, 2010). Their pathogenic mechanisms can be attributed to different virulence factors including enterotoxins and colonization factors such as flagella, fimbriae, capsule, lipopolysaccharide and adhesins (Croxen and Finlay, 2010, Gyles and Fairbrother, 2010). In addition other pathovars such as necrotoxigenic E. coli (NTEC) can often be isolated from extra intestinal infections, and are found to possess two cytotoxic necrotizing factors (CNF1 and CNF2), as well as a cytolethal distending toxin (CDT). Some or all of these pathovars can also express other virulence factors such as intimin, encoded by the eae gene (Croxen and Finlay, 2010), and haemolysins, acting as pore-forming cytolysins on eukaryotic target cells (Mainil and Daube, 2005). The Mediterranean water buffalo (Bubalus bubalis) is one of the most important livestock species bred in Italy. Its economic importance is due to the production of the worldwide famous mozzarella cheese (Mozzarella di Bufala Campana). High mortality rates in water buffalo calves less than 4 weeks old are caused by gastro-enteric pathologies primarily characterized by diarrhoea. The main etiological agents are E. coli, Salmonella spp., Clostridium perfringens, rotavirus, coronavirus, and Cryptosporidium spp. (Fagiolo et al., 2005). Among these pathogens, a predominant role is played by E. coli, either alone or in combination with other microorganisms (Fagiolo et al., 2005). ETEC and STEC have been shown to be primarily affecting water buffalo calves, and the Mediterranean water buffalo is recognized to be an important reservoir of E. coli O157 (Galiero et al., 2005). A significant correlation has also been found between the presence of STEC and diarrhoea episodes in calves bred in Vietnam and Bangladesh (Islam et al., 2008, Vu-Khac and Cornick, 2008). The spread of such pathogens among domestic ruminant herds might cause additional concern related to the emergence and dissemination of antibiotic resistant bacteria in response to the wide use of antimicrobial molecules to address infectious diseases in young animals (van den Bogaard and Stobberingh, 2000). The aims of this study were to investigate the presence of ETEC, STEC and NTEC in water buffalo calves affected by diarrhoeic syndrome and to characterize the isolates for the presence of virulence factors and antibiotic resistance. Intestinal contents from 314 water buffalo calves less than 4 weeks old were collected from 32 different farms located in the Campania region within a range of about 50 km during the years 2006–2009. The animals were all female, bred in single cages and fed with powdered milk. The sampled animals were affected by diarrhoeic syndrome and were sent to the Istituto Zooprofilattico Sperimentale del Mezzogiorno for post-mortem analysis. Pools of fecal material from small and large intestines were aseptically collected, kept at 4 °C and, within 8 h, were processed for the detection of E. coli. Fecal samples (10 g) were homogenized and serially diluted in saline peptone water, plated onto MacConkey’s agar (Oxoid, Hampshire, UK) and incubated overnight at 37 °C. E. coli was considered as plausibly related to the diarrhoeic syndrome only when exhibiting a concentration of at least 108  CFU/g of intestinal content (Acres, 1985), and the corresponding samples were therefore considered as positive to E. coli detection. Three colonies from all the E. coli-positive samples were chosen and confirmed by standard biochemical tests performed with the Vitek 2 compact instrument (BioMérieux, Craponne, France). All the E. coli isolates were screened by PCR for the presence of the genes encoding for the virulence factors listed in Table 1 . Bacterial DNA was extracted by boiling a single colony suspended in 100 μl of water at 100 °C for 10 min and pelleting cellular debris. DNA amplification was performed in a final reaction volume of 50 μl containing 10 μl of template DNA, reaction buffer 1×, MgCl2 1.2 mM, dNTPs 0.2 mM each, 50 pmol of each primer, 2 U of Taq polymerase (Roche Diagnostics, Basel, Switzerland). Primers and PCR conditions for each amplification are summarized in Table 1. PCR products were resolved by electrophoresis on 2% agarose gels and visualized under UV light after ethidium bromide staining.
Table 1

PCR primers and conditions used in this study.

PrimerSequence (5′–3′)Target genePCR productReference strainsReferencePCR Conditions
Stx1FCAGTTAATGTGGTGGCGAAGGstx1348 bpC2103; ED 669Vidal et al. (2005)35×90 s at 94 °C90 s at 60 °C90 s at 72 °C
Stx1RCACCAGACAATGTAACCGCTG
Stx2FATCCTATTCCCGGGAGTTTACGstx2584 bpC210–03Vidal et al. (2005)35×90 s at 94 °C90 s at 60 °C90 s at 72 °C
Stx2RGCGTCATCGTATACACAGGAGC
EaeFTCAATGCAGTTCCGTTATCAGTTeae482 bpC210–03;ED 669Vidal et al. (2005)35×90 s at 94 °C90 s at 60 °C90 s at 72 °C
EaeRGTAAAGTCCGTTACCCCAACCTG
LtFGCACACGGAGCTCCTCAGTCltII218 bpH10407Vidal et al. (2005)35×90 s at 94 °C90 s at 60 °C90 s at 72 °C
LtRTCCTTCATCCTTTCAATGGCTTT
StFAAAGGAGAGCTTCGTCACATTTTstII129 bpEA-11Vidal et al. (2005)35×90 s at 94 °C90 s at 60 °C90 s at 72 °C
StRAATGTCCGTCTTGCGTTAGGAC
Cnf1FGGGGGAAGTACAGAAGAATTAcnf11111 bpEF-176Toth et al. (2003)30×60 s at 94 °C60 s at 55 °C60 s at 72 °C
Cnf1RTTGCCGTCCACTCTCTCACCAGT
Cnf2FTATCATACGGCAGGAGGAAGCACCcnf21240 bpEF-147Toth et al. (2003)30×60 s at 94 °C60 s at 55 °C60 s at 72 °C
Cnf2RGTCACAATAGACAATAATTTTCCG
Cdt1FCAATAGTCGCCCACAGGAcdt-I411 bpEF-133Toth et al. (2003)30×60 s at 94 °C60 s at 55 °C60 s at 72 °C
Cdt1RATAATCAAGAACACCACCAC
Cdt2FGAAAATAAATGGAATATAAATGTCCGcdt-II556 bp9142–88Toth et al. (2003)30×60 s at 94 °C60 s at 55 °C60 s at 72 °C
Cdt2RTTTGTGTTGCCGCCGCTGGTGAAA
Cdt3FGAAAATAAATGGAATATAAATGTCCGcdt-III555 bpEF-147Toth et al. (2003)30×60 s at 94 °C60 s at 55 °C60 s at 72 °C
Cdt3RTTTGTGTCGGTGCAGCAGGGAAAA
Cdt4FCCTGATGGTTCAGGAGGCTGGTTCcdt-IV350 bpE253Toth et al. (2003)30×60 s at 94 °C60 s at 55 °C60 s at 72 °C
Cdt4RTTGCTCCAGAATCTATACCT
F17aFGCTGGAAGGGTGCAATACGCCTGf17a321 bp25KH9Bertin et al. (1996)25×120 s at 94 °C60 s at 55 °C60 s at 72 °C
F17aRATTCGTAACCCGCTCTCGTCC
F17bFCAACTAACGGGATGTACAGTTTCf17b323 bpS5Bertin et al. (1996)25×120 s at 94 °C60 s at 55 °C60 s at 72 °C
F17bRATTCGTAACCCGCTCTCGTCC
F17cFGCAGGAACCGCTCCCTTGGCf17c416 bp31ABertin et al. (1996)25×120 s at 94 °C60 s at 55 °C60 s at 72 °C
F17cRCAACTAACGGGATGTACAGTTTC
F17dFGATAGTCATAACCTTAATATTGCAf17d239 bp111KH86Bertin et al. (1996)25×120 s at 94 °C60 s at 55 °C60 s at 72 °C
F17dRCAACTAACGGGATGTACAGTTTC
PCR primers and conditions used in this study. Heat-stable enterotoxins (STs) were detected by the competitive immunoenzymatic assay E. coli ST EIA (Oxoid, Hampshire, UK) as described by the manufacturer. Heat-labile enterotoxin (LT), Shiga-toxins (Stx1 and Stx2) and cytotoxic necrotizing factors (CNF1 and CNF2) production was tested by a cytotoxicity assay on Vero cells as previously described (Caprioli et al.,1983). Cell monolayers were incubated at 37 °C with 5% CO2 and examined after 24, 48, and 72 h by a phase contrast inverted microscope (Zeiss, Göttingen, Deutschland). LT and Stxs activities were determined by morphological changes in the exposed cells according to Konowalchuk et al. (1977). All the tests performed on Vero cells included the use of proper positive and negative controls (Table 1). Haemolysin production was evaluated based on the method by Beutin et al. (1989) by inoculation of bacterial strains onto blood agar base (Difco Laboratories, Detroit, MI) supplemented with 10 mM CaCl2 and sheep blood cells (Oxoid) washed with PBS. The plates were incubated at 37 °C for 24 h and observed for haemolysis after 3 h (for expression of α-haemolysin, hlyA) and 24 h (for enterohaemolysin, Ehly). ETEC isolates grown on Minca agar (Guinée et al., 1977) plus IsoVitalex (Becton Dickinson, Heidelberg, Germany) were tested for the presence of the fimbrial antigen F5 (K99) by latex agglutination test with a specific monoclonal antibody (FIMBREX K99 kit, VLA, Weybridge, UK). STEC isolates were characterized for the O-serogroups O26, O103, O111, O145 and O157 by Real-Time PCR as previously described by Perelle et al., 2004, Perelle et al., 2005. Antimicrobial susceptibilities were determined by the agar disk diffusion method on Mueller–Hinton Agar (Oxoid) according to Clinical and Laboratory Standards Institute guidelines (CLSI, 2008). All the E. coli isolates were assayed for susceptibility to the antimicrobials listed in Table 2 . Inhibition diameters were measured and interpreted as resistant, intermediate or susceptible according to CLSI guidelines (CLSI, 2008).
Table 2

Antimicrobial susceptibility patterns of 220 Escherichia coli isolates collected from 314 diarrhoeic water buffalo calves less than 4 weeks old.

E. coli (%)bAntimicrobialsa
AmpOtSxtCtNNaAprCnUbEnrAmc
R81.87445.941.548.549.333.531.231.930.642.6
I9.585.312.229.112.819.39.611.11119
S8.71848.746.322.237.747.159.157.258.338.3

Antimicrobial molecules included in the study: ampicillin (Amp) – 10 μg, oxytetracycline (Ot) – 30 μg, sulphamethoxazole/trimethoprim (Sxt) – 25 μg, colistin (Ct) – 10 μg, neomycin (N) – 30 μg, nalidixic acid (Na) – 30 μg, apramycin (Apr) – 15 μg, gentamicin (Cn) – 10 μg, flumequine (Ub) – 30 μg, enrofloxacin (Enr) – 5 μg and amoxicillin/clavulanic acid (Amc) – 30 μg.

Percentage of resistant (R), intermediate susceptible (I) and susceptible (S) E. coli isolates.

Antimicrobial susceptibility patterns of 220 Escherichia coli isolates collected from 314 diarrhoeic water buffalo calves less than 4 weeks old. Antimicrobial molecules included in the study: ampicillin (Amp) – 10 μg, oxytetracycline (Ot) – 30 μg, sulphamethoxazole/trimethoprim (Sxt) – 25 μg, colistin (Ct) – 10 μg, neomycin (N) – 30 μg, nalidixic acid (Na) – 30 μg, apramycin (Apr) – 15 μg, gentamicin (Cn) – 10 μg, flumequine (Ub) – 30 μg, enrofloxacin (Enr) – 5 μg and amoxicillin/clavulanic acid (Amc) – 30 μg. Percentage of resistant (R), intermediate susceptible (I) and susceptible (S) E. coli isolates. The prevalence of E. coli responsible for gastroenteritis in Mediterranean water buffalo calves is poorly investigated. However, epidemiologic studies of both bovine and water buffalo calves have implicated E. coli as the major cause of neonatal diarrhoea (Fagiolo et al., 2005, Foster and Smith, 2009). Our study shows a prevalence of about 70% (220 out of 314) of E. coli in water buffalo calves less than 4 weeks old affected by diarrhoeic syndrome with a lethal outcome. The collected isolates were tested by phenotypic and molecular analyses for the identification of ETEC, STEC and NTEC. As a result of the molecular screening for virulence factors, four ETEC (1.8%), 15 STEC (6.8%) and 46 NTEC (20.9%) were identified. The results of the phenotypic assays were consistent with those obtained by PCR, except for a few cases. In fact, two false negative STEC and three NTEC were observed by phenotypic tests. A considerable number (155) of isolates did not harbour the virulence factors investigated and were most probably part of the gut’s natural commensal microflora. All the ETEC isolates could produce LT, but were negative to ST detection (Table 3 ). Unlike bovine calves, our study shows that in diarrhoeic water buffalo calves ETEC strains are infrequent. The differences between bovine and water buffalo ETEC strains also lie in the expressed virulence factors. Indeed, water buffalo ETEC strains exhibited the production of LT toxin, while ETEC strains of bovine origin have been shown to primarily produce ST toxin (Holland, 1990), even if ETEC with the genes for LT have been isolated also from cows, buffaloes and mithuns (Gyles and Fairbrother, 2010, Rajkhowa et al., 2009). Moreover, our results show that, unlike ETEC strains from diarrhoeic bovine calves (Gyles and Fairbrother, 2010), ETEC isolates from diarrhoeic water buffalo calves do not possess the F5 antigen. As a practical consequence, the common use of scours vaccines containing E. coli expressing the F5 fimbria is unsuitable to prevent ETEC infections in Mediterranean water buffalo calves.
Table 3

Distribution of virulence factors in Escherichia coli isolates collected from diarrhoeic water buffalo calves less than 4 weeks old.

E. coli typeFrequency (%)Virulence factorsaNo. of isolates
ETEC1.8LT4
ST0
AEEC4.1Stx1; eae5
Stx2; eae3
Stx1; Stx2; eae1
EHEC2.7Stx1; eae; Ehly6
NTEC20.9CNF1; HlyA8
CNF1; CNF2; CDT-III; HlyA2
CNF2; HlyA2
CNF2; F17c; HlyA1
CNF2; CDT-III; HlyA28
CNF2; CDT-III; F17c; HlyA5
E. coli70.5None detected155
Total220

Virulence factors included in the study: heat-labile enterotoxin (LT), heat-stable enterotoxins (ST) Shiga-toxins (Stx1 and Stx2), α-haemolysin (HlyA), enterohaemolysin (Ehly), intimin (eae), cytotoxic necrotizing factors (CNF1 and CNF2), cytolethal distending toxins (CDT-I, CDT-II, CDT-III and CDT-IV), and F17 fimbriae family (F17a, F17b, F17c and F17d).

Distribution of virulence factors in Escherichia coli isolates collected from diarrhoeic water buffalo calves less than 4 weeks old. Virulence factors included in the study: heat-labile enterotoxin (LT), heat-stable enterotoxins (ST) Shiga-toxins (Stx1 and Stx2), α-haemolysin (HlyA), enterohaemolysin (Ehly), intimin (eae), cytotoxic necrotizing factors (CNF1 and CNF2), cytolethal distending toxins (CDT-I, CDT-II, CDT-III and CDT-IV), and F17 fimbriae family (F17a, F17b, F17c and F17d). The STEC isolates were all Stx and intimin-positive, and were therefore classified as attaching and effacing E. coli, AEEC (Gyles and Fairbrother, 2010). In particular 11 isolates were Stx1-positive, three isolates were Stx2-positive, and one isolate was positive to both Stx1 and Stx2 (Table 3). Among these isolates, six also exhibited the production of enterohaemolysin (Ehly) and were therefore classified as EHEC (Table 3). Leomil et al. (2003)) reported a frequency of STEC in bovine diarrhoeic and non-diarrhoiec calves of 12.7%, among which the incidence of eae and Ehly-positive STEC was 18.2%. A recent study on buffaloes at slaughterhouse in Bangladesh reported a prevalence of STEC of 37.9%, mostly eae-positive, with an incidence of 14.4% of the serotype O157 (Islam et al., 2008). In Vietnam, a similar study showed that intimin-positive STEC strains could be recovered from 27% of rectal swabs from randomly selected buffaloes, but no serotype O157 could be isolated (Vu-Khac and Cornick, 2008). In Brazil Oliveira et al. (2007) described healthy water buffalo as an important reservoir of STEC, while in Italy adult water buffalo has been reported as a natural reservoir of the serotype O157 (Galiero et al., 2005). In the present study, eae-positive STEC were recovered from 6.8% of the E. coli isolates but none of the serotypes O26, O103, O111, O145 or O157 was identified. The difference between our results and the previous evidence of a prevalence of the serotype O157 in water buffaloes might reflect a different distribution of E. coli serotypes between young and adult animals. Instead, the prevalence of eae-positive STEC mostly Stx1-positive observed in this study in water buffalo calves, is consistent with data reported for diarrhoeic bovine calves where Stx1 is frequently associated with eae-positive strains and the eae gene is more frequently found in STEC from calves compared to STEC from adult cattle (Mainil et al., 1993, Sandhu et al., 1996). NTEC was the most prevalent pathovar (20.9%) among diarrhoeic water buffalo calves. All the NTEC strains could produce CNF; in particular 36 isolates were CNF2-positive, eight were CNF1-positive and two isolates were positive to both CNF1 and CNF2 (Table 3). Among CNF2-positive NTEC, 35 isolates had the cdt-III gene, and six isolates produced the F17c fimbria, one of the F17-related fimbriae (Table 3). CNF-producing E. coli have already been detected in association with both diarrhoeic and healthy bovine calves (Blanco et al., 1993, Burns et al., 1996, Orden et al., 1999, Orden et al., 2002, Van Bost et al., 2001), and our report shows high similarities between NTEC from bovine and water buffalo species. In fact, water buffalo NTEC frequency appeared comparable to those exhibited by NTEC recovered from both diarrhoeic (ranging from 8% to 23.3%) and healthy bovine calves (from 9.9% to 35.3%). All the collected water buffalo NTEC isolates also exhibited the production of α-haemolysin (HlyA), as elsewhere described for most NTEC of animal and human origin (Caprioli et al., 1989). Moreover, as for bovine NTEC, most NTEC from diarrhoeic water buffalo calves were CNF2-positive, and exhibited a strong association between the virulence factors CNF2 and F17 (Mainil et al., 1999, Orden et al., 1999, Van Bost et al., 2001), in this case F17c. Water buffalo NTEC also showed a strong association between CNF2 and CDT-III. The large presence of NTEC in diarrhoeic water buffalo calves, and the number of expressed virulence factors, highlight the pathogenic potential of this pathovar, which is stronger considering the possibility of exchanges between water buffalo and cattle. In fact, although most farms in the Campania region breed single species, either bovine or water buffalo, and animals are not grazed, there is still a high chance of contagion as many farms still lack biosecurity requirements necessary to control the entry and the spread of diseases on the herd. All the E. coli isolates were tested for susceptibility to 11 antimicrobials among those most commonly used in veterinary medicine. They were all characterized by multi-drug resistance profiles, exhibiting resistance to at least four unrelated molecules variably combined, and nine isolates were found to be resistant to all the antimicrobials included in the study. High rates of resistance were observed for Amp (81.8%) and Ot (74%), while the lowest resistance rates were exhibited for Ub, Cn and Enr with resistance percentages of 31.9%, 31.2% and 30.6%, respectively (Table 2). Multi-drug resistant E. coli have been isolated from many different species, including bovine, pigs and sheep (Enne et al., 2008, Lee, 2009). Resistance rates exhibited by the E. coli strains isolated from Mediterranean water buffalo calves included in this study appear alarmingly high, above all those observed for the newer molecules. The use of quinolones and fluoroquinolones in human medicine urged the European Commission to start a referral procedure for all veterinary medical products containing these classes of antimicrobials, aiming to promote their careful use in veterinary treatments (Directive, 2001, SANCO/6876, 2009). Prophylaxis is essential to prevent the occurrence of infectious diseases; in general, the upgraded health and welfare status, and the availability of specific vaccines, especially autogenous bacterins (custom bacterins), could result in a reduction of the use of antibiotics, and might, consequently, limit the emergence of antimicrobial resistances. In conclusion, the results show that the most prevalent strains in diarrhoeic water buffalo calves were NTEC followed by eae-positive STEC and ETEC. The virulence factors associated with the NTEC strains were mostly CNF2 and haemolysin, with CNF2 exhibiting a strong association with CDT-III and with F17c. These results might therefore be useful for the development of effective prophylaxis and therapy protocols for the control of E. coli infections in water buffalo farms.

Conflict of interest statement

None of the authors of this paper have a financial or personal relationship with other people or organisations that could inappropriately influence or bias the content of the article.
  31 in total

1.  Isolation of verocytotoxin-producing Escherichia coli O157 from water buffaloes (Bubalus bubalis) in southern Italy.

Authors:  G Galiero; G Conedera; D Alfano; A Caprioli
Journal:  Vet Rec       Date:  2005-03-19       Impact factor: 2.695

2.  Improved minca medium for the detection of K99 antigen in calf enterotoxigenic strains of Escherichia coli.

Authors:  P A Guinée; J Veldkamp; W H Jansen
Journal:  Infect Immun       Date:  1977-02       Impact factor: 3.441

3.  Characteristics of necrotoxigenic Escherichia coli isolated from septicemic and diarrheic calves between 1958 and 1970.

Authors:  S Van Bost; M H Bâbe; E Jacquemin; J Mainil
Journal:  Vet Microbiol       Date:  2001-10-01       Impact factor: 3.293

4.  Rapid and specific detection of F17-related pilin and adhesin genes in diarrheic and septicemic Escherichia coli strains by multiplex PCR.

Authors:  Y Bertin; C Martin; E Oswald; J P Girardeau
Journal:  J Clin Microbiol       Date:  1996-12       Impact factor: 5.948

Review 5.  Molecular mechanisms of Escherichia coli pathogenicity.

Authors:  Matthew A Croxen; B Brett Finlay
Journal:  Nat Rev Microbiol       Date:  2010-01       Impact factor: 60.633

6.  Close association of verotoxin (Shiga-like toxin) production with enterohemolysin production in strains of Escherichia coli.

Authors:  L Beutin; M A Montenegro; I Orskov; F Orskov; J Prada; S Zimmermann; R Stephan
Journal:  J Clin Microbiol       Date:  1989-11       Impact factor: 5.948

7.  Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (Type IV).

Authors:  István Tóth; Fréderique Hérault; Lothar Beutin; Eric Oswald
Journal:  J Clin Microbiol       Date:  2003-09       Impact factor: 5.948

8.  A high prevalence of antimicrobial resistant Escherichia coli isolated from pigs and a low prevalence of antimicrobial resistant E. coli from cattle and sheep in Great Britain at slaughter.

Authors:  Virve I Enne; Claire Cassar; Katherine Sprigings; Martin J Woodward; Peter M Bennett
Journal:  FEMS Microbiol Lett       Date:  2007-12-05       Impact factor: 2.742

9.  Relationship between cytotoxic necrotizing factor production and serotype in hemolytic Escherichia coli.

Authors:  A Caprioli; V Falbo; F M Ruggeri; F Minelli; I Orskov; G Donelli
Journal:  J Clin Microbiol       Date:  1989-04       Impact factor: 5.948

Review 10.  Enterotoxigenic Escherichia coli infections in newborn calves: a review.

Authors:  S D Acres
Journal:  J Dairy Sci       Date:  1985-01       Impact factor: 4.034

View more
  16 in total

1.  Molecular detection of Shiga toxin-producing and antibiotic-resistant Escherichia coli isolates from buffaloes in southwest of Iran.

Authors:  Sanaz Dehdashti; Reza Ghanbarpour; Mohammad Rahim Haji Hajikolaei
Journal:  Trop Anim Health Prod       Date:  2019-03-26       Impact factor: 1.559

2.  Molecular Characteristics, Ecology, and Zoonotic Potential of Escherichia coli Strains That Cause Hemorrhagic Pneumonia in Animals.

Authors:  Meghan E G Moore; Geisa Paulin-Curlee; Brian D Johnston; Connie Clabots; Chitrita DebRoy; Timothy J Johnson; Bonnie Weber; Stephen Porter; Aníbal G Armién; James R Johnson
Journal:  Appl Environ Microbiol       Date:  2021-09-22       Impact factor: 4.792

3.  Prevalence and antimicrobial resistance pattern of Shiga toxigenic Escherichia coli in diarrheic buffalo calves.

Authors:  M Srivani; Y Narasimha Reddy; K V Subramanyam; M Ramakoti Reddy; T Srinivasa Rao
Journal:  Vet World       Date:  2017-07-13

4.  Serotyping, antibiotic susceptibility, and virulence genes screening of Escherichia coli isolates obtained from diarrheic buffalo calves in Egyptian farms.

Authors:  Ashraf S Hakim; Shimaa T Omara; Sohier M Syame; Ehab A Fouad
Journal:  Vet World       Date:  2017-07-11

5.  Dolphin Morbillivirus in a Cuvier's Beaked Whale (Ziphius cavirostris), Italy.

Authors:  Cinzia Centelleghe; Giorgia Beffagna; Giuseppe Palmisano; Giovanni Franzo; Cristina Casalone; Alessandra Pautasso; Federica Giorda; Fabio Di Nocera; Doriana Iaccarino; Mario Santoro; Giovanni Di Guardo; Sandro Mazzariol
Journal:  Front Microbiol       Date:  2017-01-31       Impact factor: 5.640

6.  Diversity of Salmonella spp. serovars isolated from the intestines of water buffalo calves with gastroenteritis.

Authors:  Giorgia Borriello; Maria G Lucibelli; Michele Pesciaroli; Maria R Carullo; Caterina Graziani; Serena Ammendola; Andrea Battistoni; Danilo Ercolini; Paolo Pasquali; Giorgio Galiero
Journal:  BMC Vet Res       Date:  2012-10-25       Impact factor: 2.741

7.  Effectiveness of the Thermal Treatments Used for Curd Stretching in the Inactivation of Shiga Toxin-Producing O157 and O26 Escherichia coli.

Authors:  M Trevisani; A Valero; R Mancusi
Journal:  Biomed Res Int       Date:  2017-08-22       Impact factor: 3.411

8.  Isolation and Characterization of N-acyl Homoserine Lactone-Producing Bacteria From Cattle Rumen and Swine Intestines.

Authors:  Yang Yang; Mingxu Zhou; Philip R Hardwidge; Hengmi Cui; Guoqiang Zhu
Journal:  Front Cell Infect Microbiol       Date:  2018-05-09       Impact factor: 5.293

9.  Virulence factors and antibiograms of Escherichia coli isolated from diarrheic calves of Egyptian cattle and water buffaloes.

Authors:  Nader M Sobhy; Sarah G A Yousef; Hamada A Aboubakr; Muhammad Nisar; Kakambi V Nagaraja; Sunil K Mor; Robert J Valeris-Chacin; Sagar M Goyal
Journal:  PLoS One       Date:  2020-05-11       Impact factor: 3.240

10.  Genes Encoding the Virulence and the Antimicrobial Resistance in Enterotoxigenic and Shiga-Toxigenic E. coli Isolated from Diarrheic Calves.

Authors:  Abdelazeem M Algammal; Ali W El-Kholy; Emad M Riad; Hossam E Mohamed; Mahmoud M Elhaig; Sulaiman A Al Yousef; Wael N Hozzein; Madeha O I Ghobashy
Journal:  Toxins (Basel)       Date:  2020-06-10       Impact factor: 4.546

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.