| Literature DB >> 21637507 |
Mehmet A Sözen1, Jacqueline T Hecht, Richard A Spritz.
Abstract
Orofacial clefts (OFC; MIM 119530) are among the most common major birth defects. Here, we carried out mutation screening of the PVR and PVRL2 genes, which are both located at an OFC linkage region at 19q13 (OFC3) and are closely related to PVRL1, which has been associated with both syndromic and non-syndromic cleft lip and palate (nsCLP). We screened a total of 73 nsCLP patients and 105 non-cleft controls from the USA for variants in PVR and PVRL2, including all exons and encompassing all isoforms. We identified four variants in PVR and five in PVRL2. One non-synonymous PVR variant, A67T, was more frequent among nsCLP patients than among normal controls, but this difference did not achieve statistical significance.Entities:
Keywords: PVR; PVRL2; SSCP; cleft lip and palate; mutation
Year: 2009 PMID: 21637507 PMCID: PMC3036061 DOI: 10.1590/S1415-47572009000300007
Source DB: PubMed Journal: Genet Mol Biol ISSN: 1415-4757 Impact factor: 1.771
Oligonucleotide primers for PCR amplification of the exons of PVR and PVRL2.
| Amplicon | Primer sequences | Amplicon size (bp) |
| Exon 1 | 5' AGAGCGACGGGCGCCGGGAA 3' | 165 |
| Exon 2 | 5' TTCTCTTCGGTTCTCCGCAG 3' | 388 |
| Exon 3 | 5' GCTTTTGTTCCTCTTCCCAG 3' | 337 |
| Exon 4 | 5' TCTGTATCCATTTCCTGCAG 3' | 158 |
| Exon 5 | 5' CACCTTTCTGTCTCTCTCCCAG 3' | 189 |
| Exon 6 | 5' CCTGTTTCCTTCTCTTTCAG 3' | 216 |
| Exon 7 | 5' TTCCCCTCCTATTTCCCCAG 3' | 72 |
| Exon 8 | 5' ATTTGAAAACCCTCTTCTAG 3' | 158 |
| Exon 1 | 5' CTACTAAACCGCCCAGCCGA 3' | 169 |
| Exon 2 | 5' GTGGCCCTGCCTGGAGGTGT 3' | 530 |
| Exon 3 | 5' CTCCTCTGCTGAGTGTTTGT 3' | 437 |
| Exon 4 | 5' CTATCTGCTAACTTGTCCAC 3' | 258 |
| Exon 5 | 5' TCTTTAGGGATGAGGCCTGTG 3' | 290 |
| Exon 6 | 5' CCCAGAGCGATCCTCGTGAT 3' | 550 |
| Exon 7 | 5' GATGGTCGCTTGGAATAAGG 3' | 295 |
| Exon 8 | 5' GTGCCATAACCCCGGAGTCA 3' | 205 |
| Exon 9 | 5' GGCCTGGCAGGGAGAAGCTG 3' | 228 |
| Exon 10 | 5' AAGAGCAGATTGGTAATCTG 3' | 411 |
PVR and PVRL2 variants observed in USA CEU nsCLP patients and controls.
| Variants* | Allele frequency
| Genotype frequency***
| ||||||||||
| Cases | Controls | p-value** | Cases
| Controls
| p-value*** | |||||||
| 11 | 12 | 22 | 11 | 12 | 22 | |||||||
| rs11540085 | 1/146 (0.007) | 1/210 (0.005) | 0.653 | 72 | 1 | 0 | 102 | 3 | 0 | 0.645 | ||
| rs1058402 | 8/202 (0.039) | 3/210 (0.014) | 0.098 | 94 | 6 | 1 | 102 | 3 | 0 | 0.245 | ||
| rs203710 | 4/146 (0.027) | 3/206 (0.015) | 0.317 | 69 | 4 | 0 | 100 | 3 | 0 | 0.451 | ||
| 19:49856876G > A | 0/146 | 1/178 (0.006) | 0.549 | 73 | 0 | 0 | 88 | 1 | 0 | 1.000 | ||
| 19:50077328G > A | 1/144 (0.007) | 0/144 | 0.500 | 71 | 1 | 0 | 72 | 0 | 0 | 1.000 | ||
| rs283814 | 3/144 (0.068) | 1/144 (0.007) | 0.311 | 69 | 3 | 0 | 71 | 1 | 0 | 0.620 | ||
| 19:50081289T > C | 2/144 (0.027) | 0/202 | 0.173 | 70 | 2 | 0 | 101 | 0 | 0 | 0.172 | ||
| 19:50073660_50073661insAGG (R461-462ins) | 0/146 | 2/206 (0.001) | 0.342 | 73 | 0 | 0 | 101 | 2 | 0 | 0.512 | ||
| rs41290128 | 2/144 (0.027) | 2/202 (0.001) | 0.553 | 70 | 2 | 0 | 99 | 2 | 0 | 1.000 | ||
*Nucleotide positions are referent to NCBI Build 36 (November, 2005), release 38 (April, 2006).
**2X2 Fisher's exact test, 1-tailed assuming that the minor allele tags a potential risk variant.
***For each SNP, the major allele was designated 1 and the minor allele was designated 2; 2X3 Freeman-Halston extension of Fisher's exact test, 2-tailed.
p-values are given without Bonferroni correction.