Literature DB >> 21633710

Run-on mutation in the PAX6 gene and chorioretinal degeneration in autosomal dominant aniridia.

Shagun Aggarwal1, Worapoj Jinda, Chanin Limwongse, La-ongsri Atchaneeyasakul, Shubha R Phadke.   

Abstract

PURPOSE: To identify the causative paired box 6 (PAX6) mutation in a family with autosomal dominant aniridia.
METHODS: A family with autosomal dominant aniridia with three affected individuals in two generations was investigated for the causative PAX6 mutation by single strand conformation polymorphism (SSCP) followed by sequencing of genomic DNA from peripheral blood.
RESULTS: A novel PAX6 mutation in the donor splice site of intron 12 was identified in all three affected individuals from the family. The automated splice site analysis web interface indicated a disturbance of splicing and it was predicted that this mutation could lead to an elimination of the normal stop codon and an abnormal 3' elongation of the mRNA.
CONCLUSIONS: We report a novel PAX6 mutation in autosomal dominant aniridia that presumably affects splicing. The presence of chorioretinal degeneration in one of the affected individual raises the possibility that run-on mutations are associated with chorioretinal involvement in aniridia.
© 2011 Molecular Vision

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21633710      PMCID: PMC3103739     

Source DB:  PubMed          Journal:  Mol Vis        ISSN: 1090-0535            Impact factor:   2.367


Introduction

Aniridia (OMIM 106210) is a panocular disorder characterized by variable degrees of deficiency of the iris tissue. In 70% cases it presents as a familial disorder with autosomal dominant inheritance. The paired box 6 (PAX6) gene is the only gene in which causative mutations have been identified [1,2]. Mutations leading to complete absence of the PAX6 protein are responsible for aniridia phenotype whereas milder mutations with protein production are associated with other ocular presentations like corectopia, Reiger anomaly, cataract, glaucoma, etc [3-5]. Until date, 718 sequence variants of PAX6 and 321 pathogenic mutations have been recorded [6]. In the present paper we report the finding of a novel PAX6 mutation in an Indian family with aniridia. We also attempt to correlate the rare occurrence of chorioretinal degeneration in one of the affected individual with the type of mutation.

Methods

Case description

A family with an affected father and his two affected sons had attended the genetics department of a tertiary care hospital in North India. The family hailed from the local population and had no other similarly affected family member in the previous generations. The proband was the elder son, who was 21 years at the time of workup. He had complete absence of iris tissue, microcornea, anterior polar cataract, glaucoma, and immature cortical cataract in both eyes. In addition he had chorioretinal degeneration and multiple vitreous opacities in the right eye and retinal pigment epithelium depigmentation changes in the left eye. However his vision was relatively well conserved and he could carry out his daily chores with the aid of corrective glasses. He had undergone corrective surgery for glaucoma in both eyes 4 years ago. His intra-ocular pressure which was 43 mm-45 mm in both eyes was reduced to 14 mm after the surgery. His younger brother who was 18 years old was legally blind since the age of 8 years. He also had complete absence of iris tissue in both eyes. In addition, he also had bilateral microcornea and opacification of both corneas more on the left side. He had glaucoma in the right eye (Intra-ocular pressure 28 mmHg) and cataract in the left eye. The left eye was diagnosed as having developed phthisis bulbi. These asymmetric eye findings in this patient could be attributed to previous injury to the left eye at the age of 14. The father was 45 years old and was legally blind. He had progressive visual loss since age of 25 years. On examination, he also had absence of iris tissue in both eyes. He had bilateral corneal opacities and marked thinning of the cornea. He also had optic nerve atrophy in bilateral eyes, probably due to long standing glaucoma but no prior medical records were available. The pedigree is depicted in Figure 1.
Figure 1

The family pedigree with salient phenotypic features of the three affected members.

The family pedigree with salient phenotypic features of the three affected members.

Mutation analysis

Mutation analysis was done at the Department of Research and Development, Faculty of Medicine, Siriraj Hospital Mahidol University, Bangkok. Mutation screening in 14 exons of PAX6 was performed using single strand conformation polymorphism (SSCP) followed by direct DNA sequencing. The primers used are as mentioned by Atchaneeyasakul et al. [7] and shown in Table 1.
Table 1

Depicting the primers used in the present study for amplification of PAX6.

Exon5'→3'merTa (°C)PCR product size (bp)
1F
GTTTGAAAAGGGAACCGTGG
20
61
243
1R
CGGCTGGAGAGTGAGAGATA
20
 
 
2F
GCATAGGTGTGCTGGCTGCAG
21
62
350
2R
GGAGACCTGTCTGAATATTGC
21
 
 
3F
TCAGAGAGCCCATGGACGTA
20
61
193
3R
CTGTTTGTGGGTTTTGAGCC
20
 
 
4F
CCAGGTCCACCTCGGTTGGGA
21
67
208
4R
TGTGTCCTCCCCTGACCCTC
20
 
 
5F
CCTCTTCACTCTGCTCTCTT
20
60
288
5R
CATAATTAGCATCGTTTACAGTAA
24
 
 
5AF
TGAAAGTATCATCATATTTGTAG
23
57
236
5AR
GGGAAGTGGACAGAAAACCACA
22
 
 
6F
GTGGTTTTCTGTCCACTTCC
20
60
299
6R
AGGAGAGAGCATTGGGCTTA
20
 
 
7F
CAGGAGACACTACCATTTGG
20
60
252
7R
ATGCACATATGGAGAGCTGC
20
 
 
8F
GGGAATGTTTTGGTGAGGCT
20
60
371
8R
CAAAGGGCCCTGGCTAAATT
20
 
 
9F
ACAGTTTGGTCAACATATTTTG
22
60
217
9R
CAAGCACCTCTGTCTCTAGG
20
 
 
10F
GTAGACACAGTGCTAACCTG
20
60
243
10R
CCCGGAGCAAACAGGTTTAA
20
 
 
11F
TTAAACCTGTTTGCTCCGGG
20
63
240
11R
CCCTGAGCCACTCCTCAC
18
 
 
12F
GCTGTGTGATGTGTTCCTCA
20
63
228
12R
TGCAGCCTGCAGAAAGCAGTG
21
 
 
13F
CATGTCTGTTTCTCAAAGGGA
21
61
228
13RTCCTGAAAGCTCAACTGTTGTG22  

PCR conditions: 95 °C×7 min, 95 °C×30 s, Ta °C×30 s, 72 °C×30 s (45 cycles of step 2,3,4), 72 °C×10 min. MgCl2 concentration (mM) for PCR reaction of each exon: mM MgCl2: exon 2; 1.5 mM MgCl2: exon 1, 3, 4, 5FR, 6, 7, 8, 9, 10, 11, 12, 13; 2.0 mM MgCl2: exon 5AFAR.

PCR conditions: 95 °C×7 min, 95 °C×30 s, Ta °C×30 s, 72 °C×30 s (45 cycles of step 2,3,4), 72 °C×10 min. MgCl2 concentration (mM) for PCR reaction of each exon: mM MgCl2: exon 2; 1.5 mM MgCl2: exon 1, 3, 4, 5FR, 6, 7, 8, 9, 10, 11, 12, 13; 2.0 mM MgCl2: exon 5AFAR.

Results

A heterozygous nucleotide substitution at the splice donor site of intron 12 (IVS12+2T>C) of PAX6 was identified in the DNA samples from all three affected individuals. Screening for IVS12+2T>C in 200 normal chromosomes using SSCP analysis revealed absence of this variant. The results of SSCP analysis in the shifted fragment (exon 12) and DNA sequence segment containing IVS12+2T>C are shown in Figure 2 and Figure 3, respectively. This variant has been submitted to the Human PAX6 Allelic Variant database (DB-ID PAX6_00580) [6].
Figure 2

Results of SSCP analysis showing the aberrant migration of the amplification product of the mutant exon 12 in the three affected members (Lane 2, 3, and 4).

Figure 3

Sequencing results of Exon 12 in affected individuals showing the T→C change at donor splice site of intron 12 (IVS12+2 T>C mutation).

Results of SSCP analysis showing the aberrant migration of the amplification product of the mutant exon 12 in the three affected members (Lane 2, 3, and 4). Sequencing results of Exon 12 in affected individuals showing the T→C change at donor splice site of intron 12 (IVS12+2 T>C mutation).

Discussion

Aniridia is an autosomal dominant disorder resulting almost exclusively from mutations in the PAX6 gene. It is familial in 70% cases and sporadic in others. Besides absence of iris tissue it encompasses several ocular abnormalities like glaucoma, corneal opacification, Reiger anomaly, optic nerve defects, CNS abnormalities, etc [1,2,5]. PAX6 is an evolutionary conserved transcriptional regulator with expression in the iris tissue as well as other ocular tissues derived from neural crest cells. Its mutations are responsible for a variety of ocular phenotypes of varying severity [5,8]. Mutations resulting in introduction of premature termination codons (PTCs) account for 77% aniridia patients, these arising by nonsense mutations, splice site mutations or insertion/deletions. The remaining mutations are missense or run-on mutations [5,9]. The aniridia phenotype results from haploinsufficiency, which has been shown to arise in majority of cases by nonsense mediated decay of premRNA with premature termination codons (PTCs) [5,9]. Mutations leading to milder phenotypes are usually missense with production of aberrant but functional protein [5,9]. The mutation found in the family reported here is a novel substitution in donor splice site of Intron 12. The 10–13 exons of PAX6 code for the PST domain, a region rich in proline, serine and threonine which functions as a transactivating domain that regulates the PAX6 protein homeodomain interaction with DNA [5,8]. The RNA surveillance mechanism cannot detect PTC in the exon13 and last 50 bp of exon 12 [5,10]. All mutations found in this region as well as splice site mutations in intron 12 are run-on mutations leading to haploinsufficiency of PAX6 by production of a protein with an elongated PST domain that interferes with homeodomain binding to DNA. Until date 6 variants in intron 12 have been found, 2 being non pathogenic and 4 associated with aniridia phenotype. One of these variants has been demonstrated to be associated with abnormally extended 3′ end of the protein, the other three not being characterized at the RNA level [6]. The splice site mutation found in this family is likely to be pathogenic by leading to aberrant splicing, but its effect on the RNA has not been established. We used the automated splice site analysis web interface to ascertain the effect of this mutation. The analyses predicted that the mutation would cause decrease in binding affinity of spliceosome proteins to this donor splice site, leading possibly to aberrant splicing [11]. This would probably lead to abolishing of the normal stop codon and abnormal 3′ elongation of the mRNA, which is the most common mechanism of pathogenicity of mutations in region distal to the 1,495th base pair of exon 12. Thus this is likely to be a pathogenic mutation in this family. The phenotype of this family is similar to the aniridia cases where haploinsufficiency of PAX6 is the causative mechanism. However, an interesting finding is the presence of diffuse chorioretinal degeneration changes and vitreous involvement in the proband in this family. Hingorani et al. have reported the finding of Coats’ disease like exudative vascular retinopathy in two of their patients who also had run-on mutations leading to an elongated PST domain. These two patients had frameshifting mutations in the exon 13 [12]. This raises the possibility that run-on mutations leading to an abnormal carboxy terminal extension of the PST domain may be associated with chorioretinal involvement in patients with aniridia. To conclude, we report a novel splice site mutation in PAX6 in a family with autosomal dominant aniridia. The finding of chorioretinal degeneration in association with this probable run-on mutation indicates the possibility of a genotype-phenotype correlation.
  10 in total

Review 1.  Killing the messenger: new insights into nonsense-mediated mRNA decay.

Authors:  Peter H Byers
Journal:  J Clin Invest       Date:  2002-01       Impact factor: 14.808

2.  Novel and de-novo truncating PAX6 mutations and ocular phenotypes in Thai aniridia patients.

Authors:  La-Ongsri Atchaneeyasakul; Adisak Trinavarat; Dhaivadee Dulayajinda; Kornphet Kumpornsin; Wanna Thongnoppakhun; Pa-thai Yenchitsomanus; Chanin Limwongse
Journal:  Ophthalmic Genet       Date:  2006-03       Impact factor: 1.803

3.  Detailed ophthalmologic evaluation of 43 individuals with PAX6 mutations.

Authors:  Melanie Hingorani; Kathleen A Williamson; Anthony T Moore; Veronica van Heyningen
Journal:  Invest Ophthalmol Vis Sci       Date:  2009-02-14       Impact factor: 4.799

4.  Missense mutations in the most ancient residues of the PAX6 paired domain underlie a spectrum of human congenital eye malformations.

Authors:  I Hanson; A Churchill; J Love; R Axton; T Moore; M Clarke; F Meire; V van Heyningen
Journal:  Hum Mol Genet       Date:  1999-02       Impact factor: 6.150

5.  Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene.

Authors:  T Glaser; D S Walton; R L Maas
Journal:  Nat Genet       Date:  1992-11       Impact factor: 38.330

6.  Screening for PAX6 gene mutations is consistent with haploinsufficiency as the main mechanism leading to various ocular defects.

Authors:  Marie-Claire Vincent; Anne-Laure Pujo; David Olivier; Patrick Calvas
Journal:  Eur J Hum Genet       Date:  2003-02       Impact factor: 4.246

Review 7.  PAX6 in sensory development.

Authors:  Veronica van Heyningen; Kathleen A Williamson
Journal:  Hum Mol Genet       Date:  2002-05-15       Impact factor: 6.150

8.  Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters' anomaly.

Authors:  I M Hanson; J M Fletcher; T Jordan; A Brown; D Taylor; R J Adams; H H Punnett; V van Heyningen
Journal:  Nat Genet       Date:  1994-02       Impact factor: 38.330

9.  PAX6 mutations: genotype-phenotype correlations.

Authors:  Ioanna Tzoulaki; Ian M S White; Isabel M Hanson
Journal:  BMC Genet       Date:  2005-05-26       Impact factor: 2.797

10.  PAX6 mutations in aniridia.

Authors:  I M Hanson; A Seawright; K Hardman; S Hodgson; D Zaletayev; G Fekete; V van Heyningen
Journal:  Hum Mol Genet       Date:  1993-07       Impact factor: 6.150

  10 in total
  14 in total

1.  Implication of non-coding PAX6 mutations in aniridia.

Authors:  Julie Plaisancié; M Tarilonte; P Ramos; C Jeanton-Scaramouche; V Gaston; H Dollfus; D Aguilera; J Kaplan; L Fares-Taie; F Blanco-Kelly; C Villaverde; C Francannet; A Goldenberg; I Arroyo; J M Rozet; C Ayuso; N Chassaing; P Calvas; M Corton
Journal:  Hum Genet       Date:  2018-10-05       Impact factor: 4.132

Review 2.  Aniridia.

Authors:  Melanie Hingorani; Isabel Hanson; Veronica van Heyningen
Journal:  Eur J Hum Genet       Date:  2012-06-13       Impact factor: 4.246

3.  Two sisters with microphthalmia and anterior segment dysgenesis secondary to a PAX6 pathogenic variant with clinically healthy parents: a case of gonadal mosaicism?

Authors:  Anna Wawrocka; Joanna Walczak-Sztulpa; Ewelina Bukowska-Olech; Aleksander Jamsheer; Marcin Jaworski; Piotr Jaworski; Maciej Robert Krawczynski
Journal:  Jpn J Ophthalmol       Date:  2020-02-03       Impact factor: 2.447

4.  Assessment of PAX6 alleles in 66 families with aniridia.

Authors:  A M Bobilev; M E McDougal; W L Taylor; E E Geisert; P A Netland; J D Lauderdale
Journal:  Clin Genet       Date:  2016-01-25       Impact factor: 4.438

5.  Congenital aniridia: etiology, manifestations and management.

Authors:  Monica Samant; Bharesh K Chauhan; Kira L Lathrop; Ken K Nischal
Journal:  Expert Rev Ophthalmol       Date:  2016-03-09

6.  Clinical utility gene card for: Aniridia.

Authors:  Rose Richardson; Melanie Hingorani; Veronica Van Heyningen; Cheryl Gregory-Evans; Mariya Moosajee
Journal:  Eur J Hum Genet       Date:  2016-07-06       Impact factor: 4.246

7.  PAX6 analysis of one family and one sporadic patient from southern China with classic aniridia.

Authors:  Ying Lin; Xialin Liu; Xuanwei Liang; Baoxin Li; Shuhong Jiang; Shaobi Ye; Huiqin Yang; Bingsheng Lou; Yizhi Liu
Journal:  Mol Vis       Date:  2011-11-26       Impact factor: 2.367

8.  Interaction between Pax6 and its novel mutant in Bufo raddei Strauch.

Authors:  Furong Ju; Yongqing Zhao; Yuanlin Zhao; Ying Wang; Fan Wen; Lin Ye; Lan Gao
Journal:  Mol Vis       Date:  2011-10-18       Impact factor: 2.367

9.  A splice site mutation in the PAX6 gene which induces exon skipping causes autosomal dominant inherited aniridia.

Authors:  Nicole Weisschuh; Bernd Wissinger; Eugen Gramer
Journal:  Mol Vis       Date:  2012-03-29       Impact factor: 2.367

Review 10.  Interpretation of mRNA splicing mutations in genetic disease: review of the literature and guidelines for information-theoretical analysis.

Authors:  Natasha Caminsky; Eliseos J Mucaki; Peter K Rogan
Journal:  F1000Res       Date:  2014-11-18
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.