Literature DB >> 21629728

Tissue and stage-specific distribution of Wolbachia in Brugia malayi.

Kerstin Fischer1, Wandy L Beatty, Daojun Jiang, Gary J Weil, Peter U Fischer.   

Abstract

BACKGROUND: Most filarial parasite species contain Wolbachia, obligatory bacterial endosymbionts that are crucial for filarial development and reproduction. They are targets for alternative chemotherapy, but their role in the biology of filarial nematodes is not well understood. Light microscopy provides important information on morphology, localization and potential function of these bacteria. Surprisingly, immunohistology and in situ hybridization techniques have not been widely used to monitor Wolbachia distribution during the filarial life cycle. METHODS/PRINCIPAL
FINDINGS: A monoclonal antibody directed against Wolbachia surface protein and in situ hybridization targeting Wolbachia 16S rRNA were used to monitor Wolbachia during the life cycle of B. malayi. In microfilariae and vector stage larvae only a few cells contain Wolbachia. In contrast, large numbers of Wolbachia were detected in the lateral chords of L4 larvae, but no endobacteria were detected in the genital primordium. In young adult worms (5 weeks p.i.), a massive expansion of Wolbachia was observed in the lateral chords adjacent to ovaries or testis, but no endobacteria were detected in the growth zone of the ovaries, uterus, the growth zone of the testis or the vas deferens. Confocal laser scanning and transmission electron microscopy showed that numerous Wolbachia are aligned towards the developing ovaries and single endobacteria were detected in the germline. In inseminated females (8 weeks p.i.) Wolbachia were observed in the ovaries, embryos and in decreasing numbers in the lateral chords. In young males Wolbachia were found in distinct zones of the testis and in large numbers in the lateral chords in the vicinity of testicular tissue but never in mature spermatids or spermatozoa.
CONCLUSIONS: Immunohistology and in situ hybridization show distinct tissue and stage specific distribution patterns for Wolbachia in B. malayi. Extensive multiplication of Wolbachia occurs in the lateral chords of L4 and young adults adjacent to germline cells.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21629728      PMCID: PMC3101188          DOI: 10.1371/journal.pntd.0001174

Source DB:  PubMed          Journal:  PLoS Negl Trop Dis        ISSN: 1935-2727


Introduction

Filarial parasites infect more than 150 million people in tropical and subtropical countries and are responsible for important tropical diseases such as lymphatic filariasis (elephantiasis) and onchocerciasis (river blindness). Other filarial species are important veterinary pathogens (e.g. Dirofilaria immitis, the dog heartworm). Treatment of filarial infections in humans and animals is suboptimal, because available drugs do not efficiently kill adult worms. Most filarial species live in obligatory symbiosis with intracellular Wolbachia α-proteobacteria. Wolbachia are also present in many insect species, and they are among the most widely distributed bacteria that infect invertebrates. Wolbachia endosymbionts are necessary for development and reproduction of filarial nematodes, and they have been validated as a target for chemotherapy [1]. Tetracycline class antibiotics are active against Wolbachia, and depletion of endobacteria blocks reproduction and eventually kills adult worms in some filarial species [2], [3]. While Wolbachia DNA can be detected and quantified by PCR, microscopy provides important information on morphology and localization of bacteria in parasite tissues. Immunohistochemistry has been used for years to visualize Wolbachia in filarial worms, particularly in Onchocerca volvulus [2]. Brugia malayi is the only human filarial parasite that can be maintained in laboratory animals and for which all life cycle stages are relatively easily accessible. The population dynamics of Wolbachia during the development of B. malayi has been studied by quantitative PCR; for example, the number of Wolbachia exponentially increases soon after infection of the vertebrate host [4]. Recent studies have shown that Wolbachia are unevenly distributed in intrauterine embryos and that the bacteria are not always detected in germline precursor cells [5]. However, data on the histological distribution of Wolbachia during later development of B. malayi are scarce. While it is known that Wolbachia are present in developing embryos, the mechanism of this vertical transmission is poorly understood. In situ hybridization has been used to study gene expression in filarial parasites such as B. malayi [6] and to detect Wolbachia in insects [7], [8], but it has not been used before to detect Wolbachia in filarial worms. In this paper, we have used optimized immunohistology, in situ hybridization, and transmission electron microscopy to systematically describe the distribution, the relative number and morphology of Wolbachia in different life stages and tissues of B. malayi. This work led to an interesting new hypothesis on the localization and migration of Wolbachia during development of filarial worms.

Materials and Methods

Parasite material

B. malayi worms were recovered from intraperitonial ( i.p.) infected jirds, 2, 5, 8 and 12 wks post infection (p.i.) as previously described [9]. Aedes aegypti mosquitoes containing different larval stages of B. malayi were available from a previous study. Parasite material was fixed either in 80% ethanol for immunohistology or in 4% buffered formalin for immunohistology or in situ hybridization. At least five blocks with four or more B. malayi worms each were examined for each time point. An extensive overview about the studied material and the methods performed is provided in a supplementary table (Table S1). Up to twenty serial sections of the same block were used for comparative studies of different staining procedures. For some blocks (especially those containing young adult worms) more than 60 sections (5 µm) were cut, but only a selection of sections was examined. For the ultrastructural analysis, 18 worms (39 and 56 days p.i., Table S1) were fixed in 2% paraformaldehyde/2.5% glutaraldehyde (Polysciences Inc., Warrington, PA, USA) in 100 mM phosphate buffer, pH 7.2 for 1 hr at room temperature.

Antibodies

A monoclonal antibody directed against the B. malayi Wolbachia surface protein (mab Bm WSP) was purified from culture supernatants kindly provided by Dr. Patrick J. Lammie, Atlanta [10]. Briefly, hybridoma supernatant was incubated overnight at 4°C with ammonium sulfate, pelleted, resuspended in water and dialyzed extensively against phosphate buffered saline. The antibody solution was concentrated to 5% of the original volume using Centricon Plus-20 columns (Millipore, Billerica, MA, USA) and the protein content was determined. A stock mab solution of 10 mg protein per ml was used to test dilution series of 1∶10 up to 1∶500. The best signal to background relationship was observed at a dilution of 1∶100, and this dilution was used for all further experiments.

Immunohistology

The alkaline phosphatase anti-alkaline phosphatase (APAAP) technique was applied for immunostaining according to the recommendations of the manufacturer (Dako, Carpinteria, CA, USA) and as described earlier [11]. TBS with 1% albumin was used as negative control. Rabbit-anti mouse IgG (1∶25; Dako) was applied as secondary antibody and was bound to the APAAP complex. As substrate for alkaline phosphatase the chromogen Fast red TR salt (Sigma) was used and hematoxylin (Merck, Darmstadt, Germany) served as the counter-stain. Sections were examined using an Olympus-BX40 microscope (Olympus, Tokyo, Japan) and photographed with an Olympus DP70 microscope digital camera. For some fluorescent analysis wheat germ agglutinin (WGA 633, Invitrogen, Carlsbad, CA, USA) was used as membrane stain at 200 µg/ml for 10 minutes prior to mounting. FITC conjugated anti-mouse IgG (1∶300; Sigma) was used as a secondary antibody for confocal laser scanning microscopy (LSM). Sections were examined with a Zeiss LSM 510 META (Zeiss, Jena, Germany) confocal laser scanning microcope equipped with a plan-apochromat 63× oil objective with an argon or helium/neon laser for excitation at 488 nm or 633 nm, respectively. Confocal Z slices of 0.8 µm were obtained using Zeiss LSM software. The Velocity program version 5.4.2 (Improvision, Lexington, MA, USA) was used for high resolution interactive 3D rendering. Sections were also examined using a wide field fluorescence microscope (WFFM, Zeiss Axioskop 2 MOT Plus) with plan-apochromat 100× oil, 63× or 40× objectives. Wide field fluorescence microscopy and LSM were performed at the Washington University Molecular Microbiology Imaging Facility (http://micro.imaging.wustl.edu/).

rRNA probe in situ hybridization

A 424 bp fragment of the 16S rRNA gene of Wolbachia of B. malayi was amplified (forward primer 5′CAGCTCGTGTCGTGAGATGT, reverse primer 5′ CCCAGTCATGATCCCACTT) and cloned into a dual promoter PCRII plasmid (Invitrogen). After linearization of the plasmid, probes (anti-sense) and negative controls (sense) were prepared with Megascript T7 and Sp6 high yield transcription kits according to the manufacturer's suggested protocol (Ambion, Invitrogen). For labeling of the probe a biotin-16 dUTP mix (Roche, Indianapolis, IN, USA) was used during in vitro transcription. The plasmid template was then removed by DNase digestion (Roche). The probes were concentrated by ethanol precipitation, re-suspended in DEPC-treated water, and stored at −20°C until use. For staining, 5 µm thin paraffin sections were deparaffinized and partially digested with pepsin HCl for approximately 7 minutes. Sections were hybridized at 60°C overnight in a humid chamber with 1 µg of rRNA probe in hybridization buffer (50% formamide, 5XSSC, 0.3 mg/ml yeast tRNA, 100 µg/ml heparin, 1× Denhart's Solution, 0.1% CHAPS and 5 mM EDTA). A stringency wash was performed at 60°C for 30 min, and detection was performed using the ‘In situ Hybridization Detection System’ (K0601, Dako) which uses alkaline phosphatase conjugated streptavidin to localize biotinylated rRNA probes. Sections were incubated for 20 min with streptavidin-AP conjugate at room temperature. BCIP/NBT substrate solution was added for 10 to 30 min to localize binding of the probes.

DNA oligonucleotide probe fluorescence-based in situ hybridization (FISH)

Sections were deparaffinized and partially digested as described above and hybridized at 37°C overnight in a dark humid chamber using 200 ng of a custom made, labeled 30-mer antisense probe targeting the 16S rRNA of Wolbachia (wBm16S as, 5′Alexa 488-CAGTTTATCACTAGCAGT TTCCTTAAAGTC, Invitrogen). The complementary sense sequence was used as a negative control probe. One stringency wash was performed at 37°C for 30 minutes. Hybridization and stringency buffers were the same as described above. Finally sections were rinsed briefly in PBS and covered with a cover slip with ProLong Gold antifade reagent that contains DAPI (Invitrogen). This embedding reagent enables simultaneous fluorescence-based detection of condensed DNA in eukaryotic and prokaryotic organisms. Sections were examined using an Olympus-BX40 microscope equipped with the Olympus fluorescence filter 41001 (excitation 460–500 nm, emission 510–550 nm) for Alexa fluor or UN31000V2 (excitation 325–375 nm, emission 435–485 nm) for DAPI.

Transmission electron microscopy

For ultrastructural analysis fixed samples were washed in phosphate buffer, embedded in agarose, and postfixed in 1% osmium tetroxide (Polysciences Inc.) for 1 hr as described previously [12]. Samples were then rinsed extensively in dH20 prior to en bloc staining with 1% aqueous uranyl acetate (Ted Pella Inc., Redding, CA, USA) for 1 hr. Following several rinses in dH20, samples were dehydrated in a graded series of ethanol and embedded in Eponate 12 resin (Ted Pella Inc.). Sections of 95 nm were cut with a Leica Ultracut UCT ultramicrotome (Leica Microsystems Inc., Bannockburn, IL,USA), stained with uranyl acetate and lead citrate, and viewed on a JEOL 1200 EX transmission electron microscope (JEOL USA Inc., Peabody, MA, USA).

Results

Localization of Wolbachia in larval B. malayi

Different developmental stages were stained with mab Bm WSP (Fig. 1A, C–K). Results were confirmed by in situ hybridization or DAPI chromatin staining. Clusters of Wolbachia were detected in relatively few cells in microfilariae (Fig. 1A). The same staining pattern was observed by rRNA in situ hybridization with a probe for Wolbachia 16S rRNA (Fig. 1B). Wolbachia were sometimes detected in single cells of microfilariae within the midgut of mosquito vectors (Fig. 1C) or in sausage stage larvae and 2nd stage larvae in the mosquito thorax (Fig. 1D, E), but most of the cells in these larval stages were free of the endobacteria. Even in infective 3rd stage larvae the vast majority of cells were devoid of Wolbachia (Fig. 1F); Wolbachia in L3 were mainly present in the cells of the lateral chord, but not in internal organs (Fig. 1G).
Figure 1

Detection of Wolbachia in larval B. malayi by immunohistology or by in situ hybridization.

A Clusters of Wolbachia (arrow) in single cells of a stretched intrauterine microfilaria labeled by immunohistology using mab Bm WSP. B Consecutive section to A, but Wolbachia (arrow) were detected by in situ hybridization. C Wolbachia (arrow) in single cells of a microfilaria within the midgut of A. aegypti 2 h after the blood meal. D Clustered Wolbachia in a cell of a fragment of an L2 larva in the thorax of A. aegypti 3 d.p.i. E Cross-section of L2 larvae in the thorax of A. aegypti showing a cluster of Wolbachia (arrow) in the hypodermis (7 d.p.i.) F Cross section of isolated infective L3 larvae showing only a single Wolbachia cluster (arrow) in the cells of lateral chord (14 d.p.i). G Several clusters of Wolbachia (arrows) in the lateral chord in a longitudinal section of an infective L3 larva migrating through the abdomen of A. aegypti 14 d.p.i. H Cross-section of the anterior end of a 4th stage larva (14 d.p.i. of a jird). No Wolbachia were detected. I Cross-section of the midbody region of a 4th stage larva showing many Wolbachia (arrow) in one lateral chord. J Cross-section of the midbody region of another 4th stage larva (wide field fluorescence microscopy) showing highly condensed DNA (blue DAPI stain) in the genital primordium and numerous Wolbachia (arrow) in the lateral chord similar to I. K Longitudinal section of the midbody region of a 4th stage larva with many Wolbachia in the lateral chords (arrows). Cells in the pseudocoelomic cavity were free of Wolbachia. Ph, pharynx; gp, genital primordium; I, intestine; m, muscle. Scale bar 10 µm.

Detection of Wolbachia in larval B. malayi by immunohistology or by in situ hybridization.

A Clusters of Wolbachia (arrow) in single cells of a stretched intrauterine microfilaria labeled by immunohistology using mab Bm WSP. B Consecutive section to A, but Wolbachia (arrow) were detected by in situ hybridization. C Wolbachia (arrow) in single cells of a microfilaria within the midgut of A. aegypti 2 h after the blood meal. D Clustered Wolbachia in a cell of a fragment of an L2 larva in the thorax of A. aegypti 3 d.p.i. E Cross-section of L2 larvae in the thorax of A. aegypti showing a cluster of Wolbachia (arrow) in the hypodermis (7 d.p.i.) F Cross section of isolated infective L3 larvae showing only a single Wolbachia cluster (arrow) in the cells of lateral chord (14 d.p.i). G Several clusters of Wolbachia (arrows) in the lateral chord in a longitudinal section of an infective L3 larva migrating through the abdomen of A. aegypti 14 d.p.i. H Cross-section of the anterior end of a 4th stage larva (14 d.p.i. of a jird). No Wolbachia were detected. I Cross-section of the midbody region of a 4th stage larva showing many Wolbachia (arrow) in one lateral chord. J Cross-section of the midbody region of another 4th stage larva (wide field fluorescence microscopy) showing highly condensed DNA (blue DAPI stain) in the genital primordium and numerous Wolbachia (arrow) in the lateral chord similar to I. K Longitudinal section of the midbody region of a 4th stage larva with many Wolbachia in the lateral chords (arrows). Cells in the pseudocoelomic cavity were free of Wolbachia. Ph, pharynx; gp, genital primordium; I, intestine; m, muscle. Scale bar 10 µm. The Wolbachia density at the anterior end of 4th stage larvae was low at 2 weeks p.i. in the vertebrate host (3–5 days after the molt), and no endobacteria were detected in the tissue around the pharynx (Fig. 1H). In contrast, large numbers of Wolbachia were detected in the developing lateral chords of the L4 midbody region (Fig. 1I–K).

Detection of Wolbachia during the development of adult female B. malayi

In order to understand the distribution of Wolbachia in adult worms it is crucial to recall the anatomy and development of reproductive organs of filarial worms [13], [14]. The genital opening (vulva) lies close to the anterior end of the female worm, approximately at the level of the esophagus (Fig. 2A, B). The vagina leads into the bifurcated uterus which ends in the seminal receptacles. Theses organs are linked by oviducts with two ovaries that have an anterior growth zone, a maturation zone in the middle, and a posterior germinative zone. At 5 weeks p.i. in the vertebrate host, young adult female B. malayi worms are approximately 1.8 cm long and still growing. At that time point a massive accumulation of Wolbachia was observed, mainly in the lateral chords. Increased numbers of Wolbachia were observed in the lateral chords in the posterior end of the female which was still free of ovaries (Fig. 3A). Sections of the posterior part of the ovaries showed large numbers of Wolbachia in the adjacent lateral chords, but the ovaries themselves were free of Wolbachia (Fig. 3B, C, 4A). In the oocyte maturation and growth zones of the ovaries, Wolbachia were oriented within the lateral chords towards the pseudocoelomic cavity (Fig. 3D–G), and some sections showed Wolbachia in the periphery of the ovary (Fig. 3H, 4B, D, F). Two distribution patterns of Wolbachia were found in the lateral chords. Scattered Wolbachia were present in the apical part of the chords, and numerous clusters of Wolbachia were present basal border of the hypodermal chords adjacent to the ovaries (Fig. 3I). A similar staining pattern for Wolbachia was observed in the lateral chords in the midbody region of 5 week old females, but their empty uterus branches were always free of Wolbachia (Fig. 3J). In 8 week old female worms, less Wolbachia were detected in the lateral chords, but the mature ovaries in the posterior part of the worms were heavily infected with Wolbachia (Fig. 5A). These worms contained developing microfilariae, and the ovaries showed strong staining of nuclear chromatin (as determined by DAPI). Morula stage embryos were observed in the uterus with many Wolbachia, while in this region the number of endobacteria in the lateral chords was lower than in the distal parts of the lateral chords.
Figure 2

Schematic drawing the anatomy of adult stage B. malayi and distribution of Wolbachia.

Hypodermis, muscles, median chords as well as nerve and secretory-excretory system are not shown. Proportions are estimates. Tissues and organ systems are simplified and the midbody region is interrupted for clarity. The lateral chords are shown dorsally and ventrally instead of laterally. A Adult microfilaria producing female (12 weeks p.i.). The body length is about 4 cm. Wolbachia (red dots) are localized mainly in the lateral chords, ovary and developing embryos. The lateral chords in the head (up to the vulva) of the worm rarely contain Wolbachia. B Adult stage, immature female (5 weeks p.i.) a few days after the 4th molt. The body length is approximately 1.8 cm. Wolbachia are mainly localized in the lateral chords. Occasionally Wolbachia are attached to the ovaries or single endobacteria can be found within the ovary. C Adult spermatozoa producing male worm (12 weeks p.i.) with a total body length of about 2.5 cm. Spiculae are not shown. Wolbachia are localized in the lateral chords; Wolbachia remnants can be detected in parts of the vas deferens but not within spermatids or spermatozoa.

Figure 3

Detection of Wolbachia in immature female B. malayi at 5 weeks p.i.

A–D, H–J immunohistology using mab Bm WSP. A Cross-section in the posterior part of the female showing massive accumulation of Wolbachia (arrow) in the lateral chord. B Longitudinal section of the distal tip showing Wolbachia-free growing ovaries and numerous clusters of Wolbachia (arrow) in the lateral chord. C Cross-section showing asymmetric distribution of large amounts of Wolbachia (arrow) in the lateral chord and Wolbachia-free ovaries. D Large numbers of Wolbachia (arrow) in close proximity to one ovary branch. Ovaries are still not infected. E–G Consecutive sections to D. E 16S rRNA in situ hybridization. F 16S oligonucleotide FISH. G DAPI stain showing highly condensed chromatin in the ovary and in Wolbachia in the lateral chord (arrow). H Cross-section showing not only Wolbachia clusters in the lateral chords (arrow) but also at the edge of one ovary (arrow head). I Sagital section through lateral chord and ovary showing large numbers of Wolbachia clusters (arrows) in the lateral chords aligned at the ovary and some Wolbachia clusters in the middle of the chord (arrow head). J Cross-section of the midbody region showing large numbers of Wolbachia in the lateral chord (arrow) and empty uterus branches. i, intestine; u, uterus; ov, ovary. Scale bar 25 µm.

Figure 4

Detection of Wolbachia in female B. malayi at 5 weeks p.i. by advanced microscopy techniques.

Confocal laser scanning microcopy (LSM) and wide field fluorescence microscopy (WFFM) were used together with mab Bm WSP (green) to label Wolbachia and a WGA 633 stain (red) to visualize membranes. WFFM contained also a filter for DAPI to detected concentrated DNA. A Cross-section showing large amounts of Wolbachia in the lateral chords close to the ovaries (arrow). Some Wolbachia were also detected in the hypodermis. For full scans of LSM images and 360° rotation see suppl. material (LSM). B Another cross-section showing a more advanced stage of infection with endobacteria attached to the ovary membrane (arrow head) and already in the ovaries (arrow) (LSM). C Longitudinal section showing Wolbachia lining up in the lateral chords in the vicinity of the ovary (arrow) or within one ovary branch (arrow head)(LSM). D WFFM showing Wolbachia approaching ovaries with highly condensed chromatin (blue DAPI stain). E Another cross-section showing Wolbachia (arrows) attached to the ovaries (blue DAPI stain). One ovary branch is already Wolbachia (arrow head) infected while the other is still free (WFFM). F Close-up of a longitunial section showing Wolbachia (arrow) directly at the ovary membrane (red) (WFFM). G Another close-up showing Wolbachia in the lateral chords close to the ovary (arrow) or already in the somatic cells of the ovary (arrow head) (WFFM). Staining for WSP provides a characteristic donut shaped pattern of a Wolbachia surface protein. Ov, ovary; i, intestine. Scale bar 30 µm.

Figure 5

Detection of Wolbachia in adult female B. malayi at 8 and 12 weeks p.i.

In A, B, E, F and H Wolbachia were labeled by mab Bm WSP. A Cross-section of a distal end of a worm 8 weeks p.i. showing Wolbachia infected ovaries and some Wolbachia clusters in the lateral chord. B–H B. malayi 12 weeks p.i. B Several cross-sections of the ovaries showing massive Wolbachia staining (arrow), but only weak labeling in the adjacent lateral chord (arrow head). C Consecutive section to B, but in situ 16S rRNA detection confirmed the large number of Wolbachia in the ovaries with much stronger labeling in the adjacent lateral chord (arrow head). D Cross-section of the midbody region shows both uterus branches full of morula stage embryos and Wolbachia (arrow, 16S rRNA). E Longitudinal section in the region of the transition of the ovaries to the tubular oviduct. Large numbers of Wolbachia are visible in the growth zone of the ovaries (arrow heads) and the adjacent lateral chords (arrow) but not in the oviduct. F Cross-section showing one uterus branch with Wolbachia positive (arrow) morula stage embryos and numerous spermatozoa in the seminal receptacle surrounding a few egg cells. Thin lateral chords show only scattered Wolbachia. G Consecutive section to F stained with polyclonal Brugia pahangi WSP antisera [39] shows Wolbachia in the egg cells (arrowhead). H Cross-section of the region close to the female genital opening. Some Wolbachia are visible in the lateral chord (arrow) and in the stretched microfilariae (arrowhead) in the vagina uterine, but the muscular vagina vera is free of microfilariae and Wolbachia. Ov, ovary; u, uterus; od, oviduct; sp, spermatozoa; vv, vagina vera; vu, vagina uterina. Scale bar 25 µm.

Schematic drawing the anatomy of adult stage B. malayi and distribution of Wolbachia.

Hypodermis, muscles, median chords as well as nerve and secretory-excretory system are not shown. Proportions are estimates. Tissues and organ systems are simplified and the midbody region is interrupted for clarity. The lateral chords are shown dorsally and ventrally instead of laterally. A Adult microfilaria producing female (12 weeks p.i.). The body length is about 4 cm. Wolbachia (red dots) are localized mainly in the lateral chords, ovary and developing embryos. The lateral chords in the head (up to the vulva) of the worm rarely contain Wolbachia. B Adult stage, immature female (5 weeks p.i.) a few days after the 4th molt. The body length is approximately 1.8 cm. Wolbachia are mainly localized in the lateral chords. Occasionally Wolbachia are attached to the ovaries or single endobacteria can be found within the ovary. C Adult spermatozoa producing male worm (12 weeks p.i.) with a total body length of about 2.5 cm. Spiculae are not shown. Wolbachia are localized in the lateral chords; Wolbachia remnants can be detected in parts of the vas deferens but not within spermatids or spermatozoa.

Detection of Wolbachia in immature female B. malayi at 5 weeks p.i.

A–D, H–J immunohistology using mab Bm WSP. A Cross-section in the posterior part of the female showing massive accumulation of Wolbachia (arrow) in the lateral chord. B Longitudinal section of the distal tip showing Wolbachia-free growing ovaries and numerous clusters of Wolbachia (arrow) in the lateral chord. C Cross-section showing asymmetric distribution of large amounts of Wolbachia (arrow) in the lateral chord and Wolbachia-free ovaries. D Large numbers of Wolbachia (arrow) in close proximity to one ovary branch. Ovaries are still not infected. E–G Consecutive sections to D. E 16S rRNA in situ hybridization. F 16S oligonucleotide FISH. G DAPI stain showing highly condensed chromatin in the ovary and in Wolbachia in the lateral chord (arrow). H Cross-section showing not only Wolbachia clusters in the lateral chords (arrow) but also at the edge of one ovary (arrow head). I Sagital section through lateral chord and ovary showing large numbers of Wolbachia clusters (arrows) in the lateral chords aligned at the ovary and some Wolbachia clusters in the middle of the chord (arrow head). J Cross-section of the midbody region showing large numbers of Wolbachia in the lateral chord (arrow) and empty uterus branches. i, intestine; u, uterus; ov, ovary. Scale bar 25 µm.

Detection of Wolbachia in female B. malayi at 5 weeks p.i. by advanced microscopy techniques.

Confocal laser scanning microcopy (LSM) and wide field fluorescence microscopy (WFFM) were used together with mab Bm WSP (green) to label Wolbachia and a WGA 633 stain (red) to visualize membranes. WFFM contained also a filter for DAPI to detected concentrated DNA. A Cross-section showing large amounts of Wolbachia in the lateral chords close to the ovaries (arrow). Some Wolbachia were also detected in the hypodermis. For full scans of LSM images and 360° rotation see suppl. material (LSM). B Another cross-section showing a more advanced stage of infection with endobacteria attached to the ovary membrane (arrow head) and already in the ovaries (arrow) (LSM). C Longitudinal section showing Wolbachia lining up in the lateral chords in the vicinity of the ovary (arrow) or within one ovary branch (arrow head)(LSM). D WFFM showing Wolbachia approaching ovaries with highly condensed chromatin (blue DAPI stain). E Another cross-section showing Wolbachia (arrows) attached to the ovaries (blue DAPI stain). One ovary branch is already Wolbachia (arrow head) infected while the other is still free (WFFM). F Close-up of a longitunial section showing Wolbachia (arrow) directly at the ovary membrane (red) (WFFM). G Another close-up showing Wolbachia in the lateral chords close to the ovary (arrow) or already in the somatic cells of the ovary (arrow head) (WFFM). Staining for WSP provides a characteristic donut shaped pattern of a Wolbachia surface protein. Ov, ovary; i, intestine. Scale bar 30 µm.

Detection of Wolbachia in adult female B. malayi at 8 and 12 weeks p.i.

In A, B, E, F and H Wolbachia were labeled by mab Bm WSP. A Cross-section of a distal end of a worm 8 weeks p.i. showing Wolbachia infected ovaries and some Wolbachia clusters in the lateral chord. B–H B. malayi 12 weeks p.i. B Several cross-sections of the ovaries showing massive Wolbachia staining (arrow), but only weak labeling in the adjacent lateral chord (arrow head). C Consecutive section to B, but in situ 16S rRNA detection confirmed the large number of Wolbachia in the ovaries with much stronger labeling in the adjacent lateral chord (arrow head). D Cross-section of the midbody region shows both uterus branches full of morula stage embryos and Wolbachia (arrow, 16S rRNA). E Longitudinal section in the region of the transition of the ovaries to the tubular oviduct. Large numbers of Wolbachia are visible in the growth zone of the ovaries (arrow heads) and the adjacent lateral chords (arrow) but not in the oviduct. F Cross-section showing one uterus branch with Wolbachia positive (arrow) morula stage embryos and numerous spermatozoa in the seminal receptacle surrounding a few egg cells. Thin lateral chords show only scattered Wolbachia. G Consecutive section to F stained with polyclonal Brugia pahangi WSP antisera [39] shows Wolbachia in the egg cells (arrowhead). H Cross-section of the region close to the female genital opening. Some Wolbachia are visible in the lateral chord (arrow) and in the stretched microfilariae (arrowhead) in the vagina uterine, but the muscular vagina vera is free of microfilariae and Wolbachia. Ov, ovary; u, uterus; od, oviduct; sp, spermatozoa; vv, vagina vera; vu, vagina uterina. Scale bar 25 µm. In 12 week old females numerous Wolbachia were observed in the lateral chords and the posterior parts of the ovaries, but bacteria densities in these areas were lower than in the lateral chords adjacent to the anterior ovary and oviduct (Fig. 5B,C,E, H). Numerous Wolbachia were detected in morula stage embryos in the uterus, but only a few were detected in the lateral chords of females at that level (Fig. 5D, F, G). Intrauterine spermatozoa surrounding degenerated oocytes in the seminal receptacle were free of Wolbachia, but serial sections showed some Wolbachia in the oocytes in this area (Fig. 5F,G). Stretched microfilariae in the vagina uterina contained Wolbachia in some cells, but the numbers were low compared to those in morula stage embryos. This suggests that Wolbachia may be necessary for rapid cell division which occurs in developing embryos but not in stretched microfilariae. The distribution of Wolbachia in the lateral chords was often asymmetrical, and this depended on the proximity to the reproductive system, body region and on the age of the worm.

Detection of Wolbachia during the development of adult male B. malayi

The genital opening of the male worm lies at the posterior end and forms with the anus a cloaca (Fig. 2C). This is in stark contrast to the anatomy of females. A single vas deferens leads into a seminal vesicle that is connected to the testis; this can be subdivided into a growth zone, a maturation zone, and a germinative zone. In parallel to the distribution of Wolbachia in females, large numbers of endobacteria were observed in the lateral chords of 5 week old males, while the growing sections of the testes in the midbody region were free of Wolbachia (Fig. 6A). However, Wolbachia were present in 5 week males near the testes (Fig. 6B–E) and in the middle part of the testis itself (Fig. 6 F–J). No Wolbachia were detected within the vas deferens by immunohistology (Fig. 7A, D). In contrast, Wolbachia 16S rRNA was detected by in situ hybridization in the testis tissue surrounding the spermatocytes and in the periphery of the vas deferens that contained spermatids (Fig. 7B, C, E). Wolbachia were never observed in the spermatids or the spermatozoa.
Figure 6

Detection of Wolbachia in immature male B. malayi at 5 weeks p.i.

In A and C Wolbachia were labeled by mab Bm WSP). A This cross-section of the midbody region shows primary spermatogonia in the testis and numerous Wolbachia (arrow) in the lateral chords. B LSM of a consecutive section of A. Individual clusters of Wolbachia (arrow) can be identified. C Two cross-sections more distal compared to A with Wolbachia in the lateral chords (arrow) and in tissue attached to the testis (arrow head). D Consecutive section to C examined by LSM. E Consecutive section to C stained by in situ rRNA hybridization confirming the staining pattern. F–J Serial cross-sections showing many Wolbachia in the lateral chords (arrowheads) and in the spermatogonia (arrows). F mab Bm WSP. G Also mab Bm WSP but LSM H Same staining as G but WFFM with DAPI stain of testis. I 16S in situ rRNA hybridization. J 16S oligonucleotide FISH. te, testis. Scale bar 25 µm.

Figure 7

Detection of Wolbachia in male B. malayi at 12 weeks p.i.

In A and D Wolbachia were labeled by mab Bm WSP). A Two cross-sections demonstrating Wolbachia in the lateral chords (arrows). One section is in the midbody region showing developed spermatogonia and numerous Wolbachia in the lateral chord, while the other section is in the more muscular distal end of the worm showing spherical spermatids in the vas deferens and fewer Wolbachia in the lateral chord. B Consecutive section to A, but stained with 16S rRNA in situ hybridization. In contrast to A some staining for Wolbachia rRNA is also detected in the testis (arrowheads) and at the border of the vas deferens (arrow heads). C Cross-section of the distal part of another male worm showing Wolbachia 16S rRNA labeling at the epithelium of the vas deferens (arrow heads) and in the lateral chord (arrow). Spermatozoa were never labeled. D–G Consecutive cross-section through the terminal end showing the vas deferens containing fully developed spermatids in transition to spermatozoa. Wolbachia are detected in the lateral chord (arrow), but not in the spermatids. D mab Bm WSP. E 16S rRNA in situ hybridization. Similarly to B, staining is also observed at the border of the vas deferens (arrowheads). F 16S oligonucleotide FISH. Although Wolbachia can be easily identified in the lateral chord, granular staining at the membrane of the vas deferens is difficult to recognize. G DAPI stain, again Wolbachia can be easily identified in the lateral chord, but granular staining at the membrane of the vas deferens is hard to differentiate. Sp, spermatozoa; te, testis; vd, vas deferens. Scale bar 25 µm.

Detection of Wolbachia in immature male B. malayi at 5 weeks p.i.

In A and C Wolbachia were labeled by mab Bm WSP). A This cross-section of the midbody region shows primary spermatogonia in the testis and numerous Wolbachia (arrow) in the lateral chords. B LSM of a consecutive section of A. Individual clusters of Wolbachia (arrow) can be identified. C Two cross-sections more distal compared to A with Wolbachia in the lateral chords (arrow) and in tissue attached to the testis (arrow head). D Consecutive section to C examined by LSM. E Consecutive section to C stained by in situ rRNA hybridization confirming the staining pattern. F–J Serial cross-sections showing many Wolbachia in the lateral chords (arrowheads) and in the spermatogonia (arrows). F mab Bm WSP. G Also mab Bm WSP but LSM H Same staining as G but WFFM with DAPI stain of testis. I 16S in situ rRNA hybridization. J 16S oligonucleotide FISH. te, testis. Scale bar 25 µm.

Detection of Wolbachia in male B. malayi at 12 weeks p.i.

In A and D Wolbachia were labeled by mab Bm WSP). A Two cross-sections demonstrating Wolbachia in the lateral chords (arrows). One section is in the midbody region showing developed spermatogonia and numerous Wolbachia in the lateral chord, while the other section is in the more muscular distal end of the worm showing spherical spermatids in the vas deferens and fewer Wolbachia in the lateral chord. B Consecutive section to A, but stained with 16S rRNA in situ hybridization. In contrast to A some staining for Wolbachia rRNA is also detected in the testis (arrowheads) and at the border of the vas deferens (arrow heads). C Cross-section of the distal part of another male worm showing Wolbachia 16S rRNA labeling at the epithelium of the vas deferens (arrow heads) and in the lateral chord (arrow). Spermatozoa were never labeled. D–G Consecutive cross-section through the terminal end showing the vas deferens containing fully developed spermatids in transition to spermatozoa. Wolbachia are detected in the lateral chord (arrow), but not in the spermatids. D mab Bm WSP. E 16S rRNA in situ hybridization. Similarly to B, staining is also observed at the border of the vas deferens (arrowheads). F 16S oligonucleotide FISH. Although Wolbachia can be easily identified in the lateral chord, granular staining at the membrane of the vas deferens is difficult to recognize. G DAPI stain, again Wolbachia can be easily identified in the lateral chord, but granular staining at the membrane of the vas deferens is hard to differentiate. Sp, spermatozoa; te, testis; vd, vas deferens. Scale bar 25 µm.

Comparison of morphological detection methods

Comparison of four different methods on consecutive sections (Figs. 3 D–G; 6 C–E; 6 F–J; 7A,B; 7D–G) revealed almost identical staining patterns for Wolbachia by immunohistology with mab Bm WSP, by in situ hybridization (using FISH and RNA in situ to detect Bm Wolbachia 16S rRNA), and by DAPI staining. Differences between immunohistology and 16S rRNA in situ detection were occasionally observed (Figs. 5B, C; 7A, B; 7D, E). In these cases in situ hybridization detected a strong Wolbachia 16S rRNA signal, while no or very little Wolbachia surface protein was detectable by immunohistology. This may indicate a small difference of gene expression pattern or of gene product stability of both markers, but was not noticed as confounding factor. In addition, the intestine of B. malayi was sometimes nonspecifically labeled by immunohistology because of endogenous alkaline phosphatase (e.g. Fig. 5A, F–H). This did not occur with in situ staining. The mab Bm WSP immunohistology assay detects a protein on the surface of Wolbachia, and it is possible that this protein is not present on all Wolbachia cells. In contrast, the in situ hybridization assay detects expression of 16S rRNA in the cytoplasm of Wolbachia. Small subunit rRNA is known to be highly expressed during the exponential growth phase of bacteria, and that has been used as marker for viability [15]. Therefore the in situ assay is an excellent marker for Wolbachia growth, and it may be suitable for assessing both the presence and viability of Wolbachia. DAPI staining, which detects A-T rich regions in DNA, is an easy and quick method to detect Wolbachia in the lateral chords, since this syncytial tissue usually does not contain condensed filarial chromosomes (Figs. 3G; 7G). However, it is difficult to identify Wolbachia by DAPI staining in areas with condensed filarial chromosomes such as ovaries or in spermatids within the vas deferens (Figs. 3G; 7G). This problem can be solved by combining the DAPI stain for condensed DNA with immunohistology (Figs. 2J, 4D–G; 6H). This permits visualization of Wolbachia in the vicinity of filarial nuclei.

Confocal laser scanning microscopy

Confocal laser scanning microscopy was used to study the three dimensional distribution of Wolbachia in larvae and in developing reproductive tissue of young adult worms. Although Wolbachia numbers were increasing in the lateral chords in 4th stage larvae, no Wolbachia were observed in developing reproductive organs in L4. The higher resolution of LSM confirmed heavy Wolbachia loads in the lateral chords of young female worms (5 weeks) and relatively few endobacteria in the hypodermis (Fig. 4A). Entire oocytes could be examined for Wolbachia, because the size of oocytes is less than 5 µm and the scanned slices were 0.8 µm thick which is about the size of an endobacteria. The confocal examination of the distal end of the ovaries in 5 week old females confirmed the absence of Wolbachia from primary oocytes (Fig. 4A, D). A full LSM scan and rotation of the section show that Wolbachia were present also in the hypodermal pouches that form longitudinal lines in 5 week old female worms (video S1). A membrane stain helped to demonstrate that some Wolbachia were attached to the external membrane around the proximal ovary while other bacteria were actually in the ovary (Fig. 4B, C, videos S2, S3). The latter Wolbachia were always in the vicinity of large clusters of Wolbachia in the lateral chords adjacent to the ovaries in developing adult female worms (Fig. 4B, C). Wide field fluorescence microscopy using FITC labeled mab Bm WSP with a membrane stain and an overlay of the DAPI nuclear stain showed that Wolbachia are attached to the ovary membranes (Fig. 4D, E, F, G). It is possible that these endobacteria invade the ovaries of young females from the lateral chords. Wolbachia distribution in the developing ovaries was not uniform; in some cases, one branch was infected while the other branch was Wolbachia free (Fig. 4E).

Ultrastructural studies of Wolbachia in developing reproductive tissue

Studies of the midbody region of 5 week old worms by transmission electron microscopy confirmed the presence of Wolbachia in the vicinity of developing reproductive tissues. Numerous rod-shaped and spherical Wolbachia were detected in the lateral chords in females, especially in adult worm tissues that are adjacent to developing ovaries. In some areas the hypodermal chord tissue was loose and vacuolized (Fig. 8A). The epithelial cells surrounding the basal lamina of the ovaries were occasionally also strongly vacuolized indicating tissue degeneration, and small, electron dense Wolbachia were detected in these vacuoles (Fig. 8B). Occasionally extracellular Wolbachia were seen in the pseudocoelomic cavity docking to the edge of the ovaries (Fig. 8C, D) or attached to the outer ovarian tissue (Fig. 8E, F). While most of the Wolbachia in the lateral chords were rod-shaped or spherical and up to 1 µm in length and 0.5 µm in diameter, the endobacteria in the pseudocoelomic cavity were condensed, bacillary in shape and only 0.15 to 0.5 µm in length (Fig. 8G–I). Within the ovaries, these small Wolbachia forms were observed in large vacuoles or in loose ovarian tissue (Fig. 8G, I) either as single bacteria or in groups (Fig. 8H).
Figure 8

Transmission electron microscopy of young adult female B. malayi 5 weeks p.i.

A Numerous Wolbachia (arrow) in the lateral chord in the vicinity of developing ovaries. A number of small, electron dense Wolbachia can be detected in more loosened tissue (arrow heads). B Vacuolized epithelium surrounding the ovary with electron dense Wolbachia (arrow heads) on both sides of the basal lamina. C Numerous Wolbachia in the lateral chord (arrow) and a bacilli-shaped, extracellular Wolbachia in the pseudocoelomic cavity (arrow head). D Magnification of C, showing the Wolbachia cell membrane (arrow head). E Wolbachia (arrow head) docking to the outer ovary epithelium. F Magnification of the endobacterium in E showing loosened cell membrane at the apical end (arrow head) and a dense central inclusion (arrow). G Small electron dense Wolbachia (arrow heads) of the oogonia in the proximal part of the ovary. H Single and clusters of electron dense, extracellular Wolbachia (arrow heads) in the ovary. I Electron dense Wolbachia (arrow heads) in vacuolized ovary tissue. Bl, basal lamina; lc, lateral chord nu, nucleus; ov, ovary; ps, pseudocoelomic cavity. Scale bar 0.5 µm.

Transmission electron microscopy of young adult female B. malayi 5 weeks p.i.

A Numerous Wolbachia (arrow) in the lateral chord in the vicinity of developing ovaries. A number of small, electron dense Wolbachia can be detected in more loosened tissue (arrow heads). B Vacuolized epithelium surrounding the ovary with electron dense Wolbachia (arrow heads) on both sides of the basal lamina. C Numerous Wolbachia in the lateral chord (arrow) and a bacilli-shaped, extracellular Wolbachia in the pseudocoelomic cavity (arrow head). D Magnification of C, showing the Wolbachia cell membrane (arrow head). E Wolbachia (arrow head) docking to the outer ovary epithelium. F Magnification of the endobacterium in E showing loosened cell membrane at the apical end (arrow head) and a dense central inclusion (arrow). G Small electron dense Wolbachia (arrow heads) of the oogonia in the proximal part of the ovary. H Single and clusters of electron dense, extracellular Wolbachia (arrow heads) in the ovary. I Electron dense Wolbachia (arrow heads) in vacuolized ovary tissue. Bl, basal lamina; lc, lateral chord nu, nucleus; ov, ovary; ps, pseudocoelomic cavity. Scale bar 0.5 µm. In 5 week old male worms large clusters of large, rod-shaped or spherical Wolbachia were observed in the lateral chords in the vicinity of the testis (Fig. 9A). Small, bacillary Wolbachia forms were sometimes observed in the testis tissue. At the caudal end of the testis, close to the transition to the vas deferens, Wolbachia were observed in the inner tissue, sometimes in the vicinity of peripheral spermatids (Fig. 9B,C, D). These spermatids can be easily identified and differentiated from mature spermatozoa by their compact membranous organelles and the absence of major sperm protein complexes. Large amounts of membranous material were observed in the lumen between the spermatids and the inner testis epithelium. This material resembles degenerating Wolbachia (Fig. 9B, E–G) as they have been described previously [16]. Wolbachia were unambiguously identified in the reproductive tissue of young male worms, but not in the spermatids or spermatozoa.
Figure 9

Transmission electron microscopy of young adult male B. malayi 5 weeks p.i.

A Numerous Wolbachia (arrows) are observed in the lateral chords close to the testis. Single dark Wolbachia (arrow head) are found in the testis close to the membrane. Mitochondria (asterisk) are found in the periphery of the lateral chord. B Wolbachia (arrow) in the inner testis epithelium in the vicinity of a spermatid. Large amounts of membranous material (arrow heads) can be observed in the testis lumen in the vicinity of the testis epithelium. C Magnification of B showing intracellular Wolbachia (arrow). D Another sample showing Wolbachia (arrows) in the inner testis epithelium. E–G Pleomorphic Wolbachia (arrows) in vacuolized testis tissue. Membranous material (arrow head) can be seen in extracellular spaces. Ps, pseudocoelomic cavity; lc, lateral chord; sp, spermatide; mo, membranous organelle; nu, nucleus; bl, basal, lamina; te, testis. Scale bar 0.5 µm.

Transmission electron microscopy of young adult male B. malayi 5 weeks p.i.

A Numerous Wolbachia (arrows) are observed in the lateral chords close to the testis. Single dark Wolbachia (arrow head) are found in the testis close to the membrane. Mitochondria (asterisk) are found in the periphery of the lateral chord. B Wolbachia (arrow) in the inner testis epithelium in the vicinity of a spermatid. Large amounts of membranous material (arrow heads) can be observed in the testis lumen in the vicinity of the testis epithelium. C Magnification of B showing intracellular Wolbachia (arrow). D Another sample showing Wolbachia (arrows) in the inner testis epithelium. E–G Pleomorphic Wolbachia (arrows) in vacuolized testis tissue. Membranous material (arrow head) can be seen in extracellular spaces. Ps, pseudocoelomic cavity; lc, lateral chord; sp, spermatide; mo, membranous organelle; nu, nucleus; bl, basal, lamina; te, testis. Scale bar 0.5 µm.

Discussion

Immunohistology has been extensively used to study Wolbachia and their clearance following chemotherapy in O. volvulus. Compared to O. volvulus, mature B. malayi have a thinner hypodermis and less pronounced lateral chords, and this can make the detection of Wolbachia more difficult. Our results demonstrate that the distribution and density of Wolbachia vary in different tissues and developmental stages. Our results are consistent with those from a PCR study that reported low amounts of Wolbachia DNA in vector stages and larger amounts in mammalian stages [4]. McGarry and co-workers reported an exponential increase in Wolbachia DNA in transmitted B. malayi L3 larvae as early as 7 days p.i. We detected large amounts of endobacteria by histology in the lateral chords of the midbody region in L4 larvae (14 d.p.i.). More Wolbachia were present in young adult worms at 35 d.p.i. in most parts of the lateral chords and also in an uneven distribution in the hypodermis. Observations on Wolbachia density and tissue localization may lead to hypotheses regarding their potential function in filarial worms. Antibiotic treatment experiments have suggested that Wolbachia may play a crucial role in the molting process of filarial parasites [17], [18], [19], [20]. It appears clear that if Wolbachia have a direct function during molting, this function does not require localization in the vicinity of the filarial cuticle, since our localization results show that Wolbachia are not located near the cuticle during or immediately after molting. The distinct age and tissue specific distribution patterns of Wolbachia suggest also that the bacteria are not likely to be needed for housekeeping functions in all cell types of filarial nematodes. The absence of Wolbachia in the filarial nervous system, muscles, or the digestive systems suggests that Wolbachia are not needed for these functions. In adult worms the majority of mitochondria can be found in the periphery of the lateral chords, while the majority of Wolbachia are localized in or near the reproductive system. The differential distribution of Wolbachia and mitochondria within the lateral chord of filarial parasites has been reported previously [21]. Especially to the female worms the localization of Wolbachia in the lateral chords in vicinity of the reproductive system implies an important role of endobacteria for embryogenesis and intrauterine development. In agreement with this hypothesis tetracycline treatment to deplete Wolbachia in developing filarial worms has been shown to affect mainly females and causes a male-biased sex-ratio [20], [22]. The Wolbachia genome in B. malayi encodes complete pathways for the biosynthesis of nucleotides, riboflavin, flavin adenine dinucleotide and heme, which are missing or incomplete in the filarial genome [23]. A high demand for gene products (which may not be taken up from the mammalian host) from these pathways might be especially necessary during the development of the reproductive system in young adult worms. Furthermore, the phylogenetically old and tight association of filarial nematodes with Wolbachia during reproduction may have led to additional interdependencies that account for their mutualistic relationship. As hypothesized for Wolbachia in insects, it is possible that Wolbachia in filarial nematodes are especially important for pre-meiotic mitosis, meiosis, and meiosis associated processes [24], [25], [26], [27]. A recent study examined the dynamics of Wolbachia during intrauterine embryogenesis of B. malayi using Caenorhabditis elegans embryogenesis as a framework for the analysis [5]. Asymmetric Wolbachia segregation was observed that could explain the concentration of Wolbachia in the hypodermal chords. The early differential distribution of Wolbachia within embryonic cells corresponds well with the strong tissue specific distribution in later development described in our study. However, the authors also hypothesized that the asymmetric segregation pattern may be responsible for the presence of Wolbachia in the female germline [5]. This is in contrast to our results which clearly demonstrate the absence of Wolbachia in male and female reproductive tissue from the third stage larvae to the young adult worms. Since it is difficult or impossible to identify the germline cells or gender of microfilariae, vector stage first stage larvae, and second stage larvae of B. malayi, we cannot be sure when during development Wolbachia are lost in these cells. The terminal ends of Brugia ovaries form the germinative zones which contain the mitotic growing oogonia [28]. Our study showed that these areas were free of Wolbachia in growing, young adult worms. Our results suggest that Wolbachia from adjacent lateral chords may cross tissue zones to infect cells in maturation zone 1 (which mainly contains primary oocytes in the pachytene stage of meiotic prophase I) and in maturation zone 2 (which contains oocytes in the remaining phases of meiosis I). The germinative zones of the ovaries seem to be populated by Wolbachia over a period of approximately three weeks following the L4–L5 molt. Large numbers of Wolbachia were present in the maturation zones of eight week or older female worms, while the attached growth zones which contain the secondary oocytes and the oviducts contained lower numbers of Wolbachia (see Fig. 5E). Fertilization precedes meiosis II in filarial nematodes [28]. Wolbachia were detected in secondary oocytes surrounded by spermatozoa and unfertilized oocytes within the seminal receptacle in mature females (see Fig. 5F, G). The picture was similar in male worms. Wolbachia were not observed in the germinative zone of the testis. It is possible that Wolbachia from the lateral chords infect the primary spermatocytes in maturation zone 1, which are mostly in the pachytene stage of prophase of meiosis I [29]. This report is the first detection of Wolbachia in primary spermatocytes of developing male filarial nematodes. Although mature male worms have been previously examined for Wolbachia, prior studies did not report infection of the testis [30]. This is not contradictory to our findings, since Wolbachia appear to only infect the testis of immature adult stage B. malayi males and such worms were not studied previously. The spermatocytes of the adjacent growth zone and maturation zone 2 are difficult to differentiate morphologically, but larger secondary spermatocytes that have completed meiosis and the spherical spermatids which enter the vas deferens can be distinguished. Wolbachia were never seen in the spermatids or the mature spermatozoa. However, our in situ hybridization results clearly indicated the presence of Wolbachia 16S rRNA in the periphery of the seminal vesicle. This was confirmed by electron microscopy that showed Wolbachia in the inner epithelium of the testis or vas deferens, but not in the spermatids. These data may suggest that high Wolbachia densities are correlated with condensed chromatin and Wolbachia may be involved in chromosome segregation of filarial nematodes. Our ultrastructural studies of young adult B. malayi confirm that Wolbachia are highly pleomorphic. This pleomorphism was recognized shortly after the discovery of endobacteria in filarial nematodes, and it has been suggested that Wolbachia may have a Chlamydia-like life cycle with small dense bodies as potential infectious forms [30], [31]. Chlamydia and filarial Wolbachia both have an obligatory intracellular life style and a small genome size due to the loss of a number of essential biosynthetic pathways. Both bacterial groups lack cell walls but retained a functional lipid II biosynthesis pathway [32]. It is also possible that Wolbachia share the requirement of Chlamydia for host cell sphingolipids supplied by the host cell Golgi apparatus and multivesicular bodies for activation [33]. Clearly, further studies are needed to assign functions to different morphological forms of Wolbachia during the filarial life cycle. Based on our results we hypothesize that the genital primordium in larval B. malayi is devoid of Wolbachia and that reproductive tissues in young adult worms become infected with Wolbachia from adjacent lateral chords which have many Wolbachia. Prior studies have shown that newly introduced Wolbachia can cross several tissue planes and infect the germline in Drosophila [34]. This could be also the case in filarial Wolbachia, and it is possible that similar host signals trigger the germline tropism of Wolbachia in filarial worms and Drosophila. Previous studies have shown that a Wolbachia htrA serine protease can be found outside bacterial cells in filarial parasites. This protease and other secreted bacterial proteins may be involved in tissue invasion [35]. In addition to tissue lysis, motility of Wolbachia may be necessary for the bacteria to cross tissue boundaries. Actin-based motility occurs in Rickettsia and many other intracellular bacteria [36]. Orthologs of genes essential for actin-based motility have been found in the Wolbachia genome. Additional work will be needed to study the localization and timing of expression for these genes [23], [37]. Our ultrastructural results confirmed the presence of large clusters of Wolbachia in the lateral chords in the vicinity of the ovaries and in the outer ovary epithelium as previously described [30], [38]. The new finding reported here, is the detection of extracellular Wolbachia in the pseudocoelomic cavity in young females and the presence of Wolbachia in testis of developing male worms. In summary, this study shows the value of histological techniques such as immunohistology and in situ hybridization to study the tissue distribution of Wolbachia during the life cycle of filarial nematodes. Wolbachia infection was found to be highly cell and tissue specific. No Wolbachia were found in the developing reproductive organs in fourth stage larvae and freshly molted adult worms, which had heavy Wolbachia loads in the lateral chords. Wolbachia were detected in reproductive tissues with the onset of oocyte and sperm development, and infection of oocytes results in transovarial transmission of Wolbachia to the next generation. Summary table for the parasite material used for the present study. Each slide was thoroughly examined and numerous pictures were taken. If a slide contained more than one block section, all sections were analyzed. (RTF) Click here for additional data file. Full rotation of a cross-section of a 5 week old female Wolbachia were detected in the hypodermal lateral chords and the hypodermis. Confocal laser scanning microscopy stained with mab Bm WSP and WGA 633 (red) to visualize membranes. Compare Fig. 6A. (MP4) Click here for additional data file. Similar to are already attached to the membrane of the one ovary branch. Note these attached bacteria can be noticed only from one side of the section. A few additional endobacteria are already in the ovary. The second ovary branch is still devoid of Wolbachia. Compare Fig. 6B. (MP4) Click here for additional data file. Longitudinal section of a 5 week old female Wolbachia are lining up at the lateral chords and some Wolbachia in one ovary branch. Confocal laser scanning microscopy stained with mab Bm WSP and WGA 633 (red) to visualize membranes. Compare Fig. 6C. (MP4) Click here for additional data file.
  39 in total

1.  Germ cells colonized by endosymbiotic bacteria.

Authors:  S J Hadfield; J M Axton
Journal:  Nature       Date:  1999-12-02       Impact factor: 49.962

2.  Developmental stages of Brugia pahangi in the final host.

Authors:  J F SCHACHER
Journal:  J Parasitol       Date:  1962-10       Impact factor: 1.276

3.  Somatic stem cell niche tropism in Wolbachia.

Authors:  Horacio M Frydman; Jennifer M Li; Drew N Robson; Eric Wieschaus
Journal:  Nature       Date:  2006-05-25       Impact factor: 49.962

4.  Localization of gender-regulated gene expression in the filarial nematode Brugia malayi.

Authors:  Daojun Jiang; Ben-Wen Li; Peter U Fischer; Gary J Weil
Journal:  Int J Parasitol       Date:  2007-10-09       Impact factor: 3.981

5.  Ultrastructure of Rickettsia rickettsii actin tails and localization of cytoskeletal proteins.

Authors:  L S Van Kirk; S F Hayes; R A Heinzen
Journal:  Infect Immun       Date:  2000-08       Impact factor: 3.441

6.  Infection of the intermediate mite host with Wolbachia-depleted Litomosoides sigmodontis microfilariae: impaired L1 to L3 development and subsequent sex-ratio distortion in adult worms.

Authors:  Sridhar Arumugam; Kenneth M Pfarr; Achim Hoerauf
Journal:  Int J Parasitol       Date:  2008-01-18       Impact factor: 3.981

7.  Gametogenesis and fertilization in Dirofilaria immitis (Nematoda: Filarioidea).

Authors:  C J Delves; R E Howells; R J Post
Journal:  Parasitology       Date:  1986-02       Impact factor: 3.234

8.  Asymmetric Wolbachia segregation during early Brugia malayi embryogenesis determines its distribution in adult host tissues.

Authors:  Frédéric Landmann; Jeremy M Foster; Barton Slatko; William Sullivan
Journal:  PLoS Negl Trop Dis       Date:  2010-07-27

9.  Brugia malayi gene expression in response to the targeting of the Wolbachia endosymbiont by tetracycline treatment.

Authors:  Elodie Ghedin; Tiruneh Hailemariam; Jay V DePasse; Xu Zhang; Yelena Oksov; Thomas R Unnasch; Sara Lustigman
Journal:  PLoS Negl Trop Dis       Date:  2009-10-06

10.  Obligatory symbiotic Wolbachia endobacteria are absent from Loa loa.

Authors:  Dietrich W Büttner; Samuel Wanji; Chiara Bazzocchi; Odile Bain; Peter Fischer
Journal:  Filaria J       Date:  2003-05-09
View more
  36 in total

1.  Diagnosing Cutaneous leishmaniasis using Fluorescence in Situ Hybridization: the Sri Lankan Perspective.

Authors:  Thilini Dilhara Jayasena Kaluarachchi; Manjula Manoji Weerasekera; Andrew J McBain; Shalindra Ranasinghe; Renu Wickremasinghe; Surangi Yasawardene; Nisal Jayanetti; Rajitha Wickremasinghe
Journal:  Pathog Glob Health       Date:  2019-08-20       Impact factor: 2.894

2.  The Wolbachia Symbiont: Here, There and Everywhere.

Authors:  Emilie Lefoulon; Jeremy M Foster; Alex Truchon; C K S Carlow; Barton E Slatko
Journal:  Results Probl Cell Differ       Date:  2020

3.  Absence of Wolbachia endobacteria in Chandlerella quiscali, an avian filarial parasite.

Authors:  Samantha N McNulty; Kerstin Fischer; Joseph O Mehus; Jefferson A Vaughan; Vasyl V Tkach; Gary J Weil; Peter U Fischer
Journal:  J Parasitol       Date:  2011-10-27       Impact factor: 1.276

4.  Polar cell fate stimulates Wolbachia intracellular growth.

Authors:  Ajit D Kamath; Mark A Deehan; Horacio M Frydman
Journal:  Development       Date:  2018-03-23       Impact factor: 6.868

5.  Native microbiome impedes vertical transmission of Wolbachia in Anopheles mosquitoes.

Authors:  Grant L Hughes; Brittany L Dodson; Rebecca M Johnson; Courtney C Murdock; Hitoshi Tsujimoto; Yasutsugu Suzuki; Alyssa A Patt; Long Cui; Carlos W Nossa; Rhiannon M Barry; Joyce M Sakamoto; Emily A Hornett; Jason L Rasgon
Journal:  Proc Natl Acad Sci U S A       Date:  2014-08-11       Impact factor: 11.205

6.  Brugia malayi galectin 2 is a tandem-repeat type galectin capable of binding mammalian polysaccharides.

Authors:  Marla I Hertz; Philip M Glaessner; Amy Rush; Philip J Budge
Journal:  Mol Biochem Parasitol       Date:  2019-11-15       Impact factor: 1.759

Review 7.  Control of arboviruses vectors using biological control by Wolbachia pipientis: a short review.

Authors:  Nara Juliana Santos Araújo; Márcia Jordana Ferreira Macêdo; Luís Pereira de Morais; Francisco Assis Bezerra da Cunha; Yedda Maria Lobo Soares de Matos; Ray Silva de Almeida; Maria Flaviana Bezerra Morais Braga; Henrique Douglas Melo Coutinho
Journal:  Arch Microbiol       Date:  2022-06-09       Impact factor: 2.552

Review 8.  Parasite-bacteria interrelationship.

Authors:  Dalia S Ashour; Ahmad A Othman
Journal:  Parasitol Res       Date:  2020-08-04       Impact factor: 2.289

Review 9.  Wolbachia: Can we save lives with a great pandemic?

Authors:  Daniel LePage; Seth R Bordenstein
Journal:  Trends Parasitol       Date:  2013-07-08

Review 10.  Lateral gene transfers have polished animal genomes: lessons from nematodes.

Authors:  Etienne G J Danchin; Marie-Noëlle Rosso
Journal:  Front Cell Infect Microbiol       Date:  2012-03-06       Impact factor: 5.293

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.