Literature DB >> 21584274

mRNA/microRNA Profile at the Metamorphic Stage of Olive Flounder (Paralichthys olivaceus).

Caixia Xie1, Shanliang Xu, Linlin Yang, Zhonghe Ke, Jubin Xing, Junwei Gai, Xiaoling Gong, Liuxiong Xu, Baolong Bao.   

Abstract

Flatfish is famous for the asymmetric transformation during metamorphosis. The molecular mechanism behind the asymmetric development has been speculated over a century and is still not well understood. To date, none of the metamorphosis-related genes has been identified in flatfish. As the first step to screen metamorphosis-related gene, we constructed a whole-body cDNA library and a whole-body miRNA library in this study and identified 1051 unique ESTs, 23 unique miRNAs, and 4 snoRNAs in premetamorphosing and prometamorphosing Paralichthys olivaceus. 1005 of the ESTs were novel, suggesting that there was a special gene expression profile at metamorphic stage. Four miRNAs (pol-miR-20c, pol-miR-23c, pol-miR-130d, and pol-miR-181e) were novel to P. olivaceus; they were characterized as highly preserved homologies of published miRNAs but with at least one nucleotide differed. Representative 24 mRNAs and 23 miRNAs were quantified during metamorphosis of P. olivaceus by using quantitative RT PCR or stem-loop qRT PCR. Our results showed that 20 of mRNAs might be associated with early metamorphic events, 10 of mRNAs might be related with later metamorphic events, and 16 of miRNAs might be involved in the regulation of metamorphosis. The data provided in this study would be helpful for further identifying metamorphosis-related gene in P. olivaceus.

Entities:  

Year:  2011        PMID: 21584274      PMCID: PMC3092494          DOI: 10.1155/2011/256038

Source DB:  PubMed          Journal:  Comp Funct Genomics        ISSN: 1531-6912


1. Introduction

Flatfish is famous for the asymmetric transformation during metamorphosis, especially one eye migrating to the other side. Other metamorphosis events include cranium deformation, asymmetric pigmentation, and 90-degree rotation in posture with a lifestyle transition from pelagic to benthic. The molecular mechanism of morphologic left/right asymmetry in Olive flounder, Paralichthys olivaceus, was thought to be different from that of interior organ asymmetry in vertebrate [1]. Thyroid hormone (TH) was proposed to regulate metamorphosis in flatfish [2-5]. As the nuclear receptor of TH, thyroid hormone receptor (TR) should be involved in the TH-inducing signal pathway. The spatial expression of the TR genes has been investigated in the metamorphosing Olive flounder [6]; however, it still cannot determine which metamorphosis events were regulated by TR in flatfish. In TH-TR signal pathway, the downstream genes will unavoidably be investigated in the future. To date, very few genes were investigated in metamorphosing flatfish [6-9]. Even though the cDNA libraries of various tissue types in P. olivaceus were constructed, especially immune-related tissues [10], the gene expression profile in metamorphosing P. olivaceus was still unavailable. Expressed sequence tags (ESTs) analysis is an efficient approach to characterize transcriptome. Large-scale EST sequencing project as a part of genome project has been conducted for several teleost species, such as salmonid and catfish [11-13]. Small-scale ESTs analysis has also been carried out for some aquaculture teleosts [10, 14–16]. In this study, we tried to enrich ESTs data and investigated the gene expression profile via cDNA library random sequencing in the premetamorphosing and prometamorphosing P. olivaceus. In addition, Johnston and Hobert reported that one microRNA termed lsy-6 controlled neuronal left/right asymmetric expression of chemosensory receptor in Caenorhabditis elegans [17]. Accordingly, the possible roles of microRNAs in regulating metamorphosis in flatfish should not be neglected. This is the reason that we constructed a microRNA library and analyzed its expression profile in the metamorphosing P. olivaceus in this research as well.

2. Material and Methods

2.1. Fish Maintenance and Sampling

Larvae were obtained from the Central Experiment Station of Chinese Academy of Fisheries Sciences (Beidaihe, Hebei, China) and then transported to the laboratory in Shanghai Ocean University, Shanghai, China. The larvae were reared in the laboratory according to the methods provided in [8]. Larvae were fed live brine shrimp (Artemia) nauplii until the end of metamorphosis. We use the following classifications for the metamorphic stages of P. olivaceus in this study [18, 19]: Premetamorphosis (17 DAH, days after hatching), the stage prior to the start of eye migration; Prometamorphosis (19 DAH), from the start of eye migration until the start of resorption of several elongated dorsal fin rays; Climax (23 DAH), from the start of resorption of the elongated dorsal fin rays until the completion of fin resorption and eye migration; Postclimax (27 DAH), after the completion of fin resorption and eye migration. All samples were frozen using liquid nitrogen and stored at −80°C until proceeding to total RNA isolation.

2.2. cDNA Library Construction and Sequencing

Total RNA was isolated from premetamorphosing or prometamorphosing larvae (17DAH and 19DAH) using TRIzol Reagent (Invitrogen, Carlsbad, Calif, USA) according to the manufacturer's instruction. Equal amounts of total RNA from premetamorphosing or prometamorphosing larvae were pooled. mRNA was purified from total RNA using Oligotex mRNA Kits (QIAGEN, Valencia, Calif, USA) according to the manufacturer's instruction. A directional cDNA library of the whole larvae was constructed using the pBlueScript II SK+ vector (Stratagene, La Jolla, Calif, USA). First strand cDNA was synthesized according to the protocol of superscript II RNase H-reverse transcriptase (Invitrogen). Oligo (dT)18 primer with Xho I digestion site was used for the synthesis of first cDNA strand. Second strand was synthesized using DNA polymerase I (Promega, Madison, Wis, USA). cDNAs 0.5–2 kb size of were inserted into pBluescript II SK+ vector and then were electroporated into competent cells. Over 5000 primary cDNA clones were obtained with an average insert size of >1 kb. Titer of the primary cDNA library was over 1 × 106, and then it was amplified once before colonies were picked for sequencing (Biotecan, Shanghai, China). The vector sequence was trimmed from the EST sequences using Vector NTI suite 8.0 (Invitrogen). Trimmed sequences were further screened using the ContigExpress in Vector NTI suite 8.0. High-quality ESTs were then assembled into clusters of contiguous sequences (contigs). Vector NTI suite 8.0 was used for contig assembly using stringent parameters, that is, overlap length cutoff of 100 and overlap percent identity of 90. The consensus sequence of each contig and singletons comprising the unique sequences were sent to the National Center for Biotechnology Information (NCBI) by using online software Blast2go [20] to be compared against the nonredundant protein database using BLASTX. The E-value cutoff was 1e−5. Novel ESTs were also identified by comparison with P. olivaceus EST sequences in dbEST at NCBI using BLASTN. All ESTs that were not identified as orthologs of known genes were designated as unknown EST clones. Sequences with BLASTX hits were mapped and annotated according to gene ontology terms (GO) in AmiGO database (http://amigo.geneontology.org/cgi-bin/amigo/go. cgi). The distribution of genes in each of the main ontology categories was examined, and the percentages of unique sequences in each of the assigned GO terms were calculated. In each of the three main categories of GO, namely, biological process, molecular function, and cellular component [21], 100% was considered as the total number of unique sequences having an assigned GO term. Thus, in each main category, the percentages of 2nd level do not add up to 100% because some deduced proteins have more than one GO category assigned to them [22].

2.3. MicroRNA Library Construction and Sequencing

RNA with size less than 200 nt from premetamorphosing or metamorphosing larvae was isolated using mirVana miRNA Isolation Kit (Ambion, Austin, Tex, USA) following manufacturer's instructions with minor modifications. In brief, equal amounts of the above RNA from premetamorphosing or prometamorphosing larvae were pooled. 2 μg of pooled RNA were polyadenylated at 3′ hydroxyl terminus by using poly(A) polymerase (New England BioLabs, Ipswich, Mass, USA) incubation for 15 min at 37°C. Then, the 5′ DNA/RNA linkers (5′-ACGGAAuuccucacuaaa-3′) were ligated to the 5′ end by T4 RNA ligase incubation for 1 h at 37°C. This mixture was then reverse transcribed by MMLV reverse transcriptase (Promega, Madison, Wis, USA) using primer complementary to the 3′ linker sequence (5′-CTAGCTTGGTGCCTGGAATTCGCGGTTTTTTTTTTTTTTTTTTTTTTTTTT) at 42°C for 1 h, and PCR was amplified using forward primer (5′-CCAACCGGCACCACGGAATTCCTCACTAAA) and reverse primer (5′-CTAGCTTGGTGCCTGGAATTCGCGGTTTTT) on both linkers. The reactions were completed with the following thermoprofiles: 95°C for 15 min for one cycle, then the samples were amplified for 35 cycles at 94°C for 1 min, 58°C for 30 s, and 72°C for 30 s. Upon the completion of PCR, the reaction was incubated at 72°C for additional 10 min. PCR products were analyzed by electrophoresis on a 12% nondenaturing polyacrylamide gel electrophoresis (PAGE). The bands from 235 bp to 245 bp were excised and purified. The purified PCR fragments were then ligated into pGEM-T Easy Vector (Promega) and transformed into the competent DH5 cells. Transformed bacterial cells were plated and grown overnight. Then the colonies were picked and sequenced (Biotecan). Small RNA sequence data were analyzed by BLAST search against the miRBase database (http://www.mirbase.org/). MicroRNAs were identified and named based on sequence homology to published miRNAs according to the universal nomenclature [23].

2.4. Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction

Total RNA from the whole larvae at different metamorphic stages was isolated using TRIzol reagent (Invitrogen) followed by DNase treatment. The abundance of mRNA or miRNA was quantified by qRT-PCR or stem-loop qRT-PCR [24], respectively. 2 μg of DNase-treated RNA was converted to cDNA using MMLV reverse transcriptase (Promega). qRT-PCR primers for each mRNA are listed in Table 1 and for miRNA in Table 2. The relative expression of mRNA and miRNA was normalized using β-actin mRNA and U6 snRNA as control, respectively. For qRT-PCR or stem-loop qRT-PCR, the thermocycler was set at 95°C for 15 s and 55°C for 60 s per cycle for a total of 40 cycles, followed by 95°C for 1 min and 55°C for 1 min. Relative changes in mRNA or miRNA abundances were quantified by using the C method; β-actin mRNA and U6 RNA were used as reference amplicons for data normalization [25, 26].
Table 1

Primers of mRNAs for qRT-PCR.

Clone nameGene namePrimer namePrimer (5′-3′)
SFU-PO-DEV 00045-cytosolic ii (nt5c2)CY2FCGACCTACCTGCCAACATG
CY2RGTGCCAGACAACTGGTCC
SFU-PO-DEV 0125cog1782: metal-dependent consists of a metallo-beta-lactamase domain and an rna-binding kh domain (me)MEFCTGACCAAACTGATCCGGC
MERCTGATCCAACATCGAGGTCG
SFU-PO-DEV 0133Creatine kinase 1 mRNA (ck1)CKFGAGACTCGTGACTCTGCTCAC
CKRCAGCCTAGTGGAGGCTGATC
SFU-PO-DEV 0137Cuticle protein (cp)CP2FGTGGCTACAACGCCGATG
CPRCAGGTGCTTTGTATGCAGGAG
SFU-PO-DEV 0159Cytochrome c subunit va (cox5a)CSFGCAGCACTGAGAGCTTGTC
CSRGCTGCAGCTCTTGGATCAG
SFU-PO-DEV 0170Deoxycytidine kinase (dck)DK2FGACTCCAAGCCCGGAACC
DK2RAGCTGAAGGCACAGCTAGTG
SFU-PO-DEV 0182Elastase 2a (ela2a)EL2FGACCTGGCCAGTTGCAATG
EL2RGTAGTTGCAGCCCATGCTTG
SFU-PO-DEV 0200Eukaryotic translation initiation factor 5A-2 (eif5a2)ETFCCATCGGCATCAAAGCCTTG
ETRGAGTAGCATTGACGAGGCAATG
SFU-PO-DEV 0213Fatty acid binding protein intestinal (fabpi)FAPFCTATCAGGCTCGTGGACCATG
FAPRCTTTGCGTCCACACCTTCG
SFU-PO-DEV 0260Heat shock protein 70 (hsp71)HSPFGCTACCTCCTGAGAAAGTGCTC
HSPRGTGACTCACTGCTCACTGAGTC
SFU-PO-DEV 0283 Danio rerio hypothetical LOC562892 (hy)HYFGCTGAGCTGCACTGATCAAG
HYRTGCTGCATGTGCACACTTG
SFU-PO-DEV 0295Kiaa1872 protein (atcay)KP2FCGTCTTCCAGGCGACAG
KP2RGTACGGCCTGATGACCTG
SFU-PO-DEV 0297l-3-hydroxyacyl-coenzyme ashort chain (hadh)HCFCAGAGTGAGCTGCTGAACAAG
HCRTGAAGTTCGGACTTGTCCCTC
SFU-PO-DEV 0298Larval and non-ifm isoform (myl)LIFGCATGGATCCTGAAGATGACG
LI2RCAGGGTAAGGTCCAGCAATG
SFU-PO-DEV 0305Lin-52 homolog (lin52)LHFGTTCTTCAAGTGGCGGGAC
LHRGCTGCAGTTCACTGTCTGAG
SFU-PO-DEV 0341Middle subunit (ferritin m) (hfe)FMFGATTGAGCCTGAAGGGACGAG
FMRCGACACCAACACAACAGCTC
SFU-PO-DEV 0766Nadh dehydrogenase subunit 4l (mt-nd4l)NDFCTCAGCCAACTTCTCAGCTTC
NDRGCTTTGAAGTCGGTCGGTAC
SFU-PO-DEV 0788Nonmetastatic cells protein expressed in isoform a (nme1)NMC-2FGACTCCAAGCCCGGAACA
NMC-2RCAGTGGTCTCCGACCAGG
SFU-PO-DEV 0803Ornithine decarboxylase antizyme small isoform (oaz)ODAFCGGGATCGCAATCTTTCAGC
ODARGAGCAAGAAGCGCACTCTG
SFU-PO-DEV 0834Putative cytochrome P450 like protein precursor (cyp1a1)PCPFGTCAAGCTCAACAGGCTCTTC
PCPRTGACGCGCATGAATGGATG
SFU-PO-DEV 0914Ribosomal protein s27 (rps27)RPFCGGTTGATATCAGCGCCTTG
RPRCGATCTGTCAACGCGAACAG
SFU-PO-DEV 0945s-adenosylhomocysteine hydrolase (ahcyl)SAHFGTACCTGGGTCTGCCCAG
SAHRCCAAACGCCAAACCCTTCTAG
SFU-PO-DEV 1002Translocase of inner mitochondrial membrane 8 homolog a (timm8a)TIMMFTCCGAGGGCATGATGGAC
TIMMRGGACAGTTCTGCAACACTCAG
SFU-PO-DEV 1017Troponin c type 2 (tnnc2)TNNCFCTACTGACCCCACTGTACCAC
TNNCRCCGTCTGTTGAGGATGTCAATG
Table 2

Primers of miRNAs for stem-loop qRT-PCR.

microRNAPrimer namePrimer (5′-3′)
Universal revise primer5-GTGCAGGGTCCGAGGT
U6 snRNAU6RT5-GTCAGGCAGCGTGCAGGGTCCGAGGTATTCGCACGCTGCCTGACAAAAAT
U6F5-CGCAAGGATGACACGCAAATT
miR-11RT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACATAC
1F5-CGGCGGTGGAATGTAAAG
let-7a7aRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTAT
7aF5-CGGCGGTGAGGTAGTAGGTT
let-7e & miR-7f7efRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTAT
7efF5-CGGCGGTGAGGTAGTAGATT
let-7j7jRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTGT
7jF5-CGGCGGTGAGGTAGTTGTTT
miR-9*9aRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTTTC
9aF5-CGGCGGTAAAGCTAGATAA
miR-10b10bRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAAAT
10bF5-CGGCGGTACCCTGTAGAACC
miR-20c20aRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATACCT
20aF5-CGGCGGTAAAGTGCTTATAGT
miR-2121RT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCAACA
21F5-CGGCGGTAGCTTATCAGACT
miR-23a23aRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGAAA
23aF5-CGGCGGATCACATTGCCAGG
miR-23c23bRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGGTA
23bF5-CGGCGGATCACATTGCCAGGG
miR-26a26aRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCCTA
26aF5-CGGCGGTTCAAGTAATCCAG
miR-125b125bRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAG
125bF5-CGGCGGTCCCTGAGACCCT
miR-128128RT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAGAG
128F5-CGGCGGTCACAGTGAACCG
miR-130d130cRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCTTT
130cF5-CGGCGGCAGTGCAATAT
miR-145145RT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGATT
145F5-CGGCGGGTCCAGTTTTCCCA
miR-181a181aRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTCAC
181aF5-CGGCGGAACATTCAACGCTGT
miR-181e181a-1RT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTCA
181a-1F5-CGGCGGAACATTCAACGCTGTC
miR-181f181fRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCCC
181fF5-CGGCGGAACATTCATTGCTGT
miR-200a200aRT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACATCG
200aF5-CGGCGGTAACACTGTCTGGT
miR-221221RT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAAACC
221F5-CGGCGGAGCTACATTGTCTGC
miR-429429RT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACGGCA
429F5-CGGCGGTAATACTGTCTGGT
miR-724724RT5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACAGT
724F5-CGGCGGTTAAAGGGAATTTG

3. Results and Discussions

3.1. mRNA Profile in Premetamorphosing and Prometamorphosing P. olivaceus

2235 clones were picked randomly from premetamorphosis and prometamorphosis cDNA library and sequenced. With exception of 42 empty clones, 2,193 cDNA clones were used to produce expressed sequence tags (ESTs) and represented 1,051 unique genes. Of 1,051 unique genes (GenBank Accession nos. GW882510-GW883514, GT229367-GT229408, and EU090804.1), only 46 unique genes (4.4%) were identified as homologous to the previously reported P. olivaceus genes, whereas 1005 (95.6%) unique genes were found to be novel P. olivaceus ESTs. Therefore, this EST collection represented a significant addition to the existing P. olivaceus EST resources. Of the new 1005 unique genes, 395 (39.3%) remained unknown in terms of their gene identity and others had the high number of BLASTX hits to fishes, including flatfish other than P. olivaceus (6.5%) and fishes other than flatfish (35.0%) (Figure 1).
Figure 1

Summary of the EST distribution in various groups and the number of genes they represent. Solid bars are number of ESTs, and sketched bars are number of clones.

Gene ontology (GO) categories were assigned to 656 unique ESTs using AmiGO database. The percentage distributions of gene ontology terms (2nd-level GO terms) according to the GO consortium are shown in Figure 2. Cellular Process (87%) was the most dominant 2nd-level term out of the 455 unique sequences which were annotated to the Biological Process GO category. This was followed by Metabolic Process Metabolism at 71%. It is noted that 9% were assigned to the Negative Regulation of Biological Process. Protein Binding (60%) was the most dominant out of 467 ESTs with significant protein hits which were assigned to Molecular Function category at 2nd level. This was followed by Nucleic Acid Binding at 20%. Cell Part (97%) was the most dominant out of 474 ESTs which were annotated to the Cellular Component GO category. Intracellular and intracellular parts occupied 90% and 89%, respectively. ESTs that fell in each of the three main GO categories are given in Figure 2.
Figure 2

Gene Ontology (GO) assignment (2nd-level GO terms) of 1,825 annotated ESTs. The total numbers of ESTs annotated for each main category are 455 for Biological Process, 467 for Molecular Function, and 474 for Cellular Component. Since a gene product could be assigned to more than one GO term, the percentages in each main category do not add up to 100%.

Compared with normalized cDNA library, the nonnormalized cDNA library is much more redundant. 2,193 cDNA clones from the nonnormalized cDNA library in this study only generated 1,051 unique genes. However, the nonnormalized cDNA library can provide raw information on the structure of gene expression level [27]. Among 656 identified distinct known genes in metamorphic P. olivaceus in this study, 413 known genes (63.0%) were sequenced only once, 180 genes (27.4%) were sequenced 2–5 times, and 63 genes (9.6%) were sequenced over 5 times. The vast majority of known genes were sequenced only once; however, a small number of genes accounted for a large proportion of transcripts in premetamorphosing and prometamorphosing P. olivaceus (Figure 3). The most abundantly expressed gene was parvalbumin accounting for 3.88% of the 2,193 clones sequenced (Table 3). The expressed gene beta-actin accounted for only 0.05%. The other most abundant expressed genes included cytochrome c oxidase subunit II (1.28%), ribosomal protein S2 (1.23%), cytochrome c oxidase subunit III (1.00%), creatine kinase 1 (1.00%), myosin light chain 3 (1.00%), 40S ribosomal protein S8 (1.00%), nuclease diphosphate kinase B (0.87%), ribosomal protein L18a (0.87%), and antifreeze protein type IV (0.87%). Altogether, the ten most abundantly expressed genes occupied 19.39% of all clones.
Figure 3

Expression profiles and sequencing redundancy of the known genes from the premetamorphosing and prometamorphosing P. olivaceus.

Table 3

The ten most highly expressed genes in premetamorphosing and prometamorphosing P. olivaceus.

Putative identificationFrequency (%)
Parvalbumin3.88%
Cytochrome c oxidase subunit II1.28%
Ribosomal protein S21.23%
Cytochrome c oxidase subunit III1.00%
Creatine kinase 11.00%
Myosin light chain 31.00%
40S ribosomal protein S81.00%
Nuclease diphosphate kinase B0.87%
Ribosomal protein L18a0.87%
Antifreeze protein type IV0.87%

3.2. miRNA Profile in Premetamorphosing and Prometamorphosing P. olivaceus

MicroRNAs are small 19–23-nucleotide noncoding RNAs that bind to recognition sequences on 3′-untranslated regions (3′-UTRs) of mRNAs and target them for degradation or translational repression. MiRNAs have been found to play important roles in zebrafish development [28, 29]. miRNAs resources were developed only in few teleosts such as zebrafish, puffer fish, and Oncorhynchus mykiss [30-32]. No miRNAs have been identified in flatfish. In this study, total 143 clones picked randomly were sequenced (Table 4). Sequence analysis identified 29 microRNAs that showed the same as at least one published miRNAs in the database (http://www.mirbase.org/search.shtml). Representing 19 unique miRNAs are shown in Table 5. Four sequences had not been found to have the same sequences, but they showed significant similarities with published miRNAs in miRBase. In addition, there are four sequences identified as snoRNA by searching NCBI database. Overall, 23.08% of small RNAs in the library might be microRNAs and 2.80% were snoRNAs (Table 4). Names of the P. olivaceus miRNA were assigned based on the homologies between the cloned sequence and published miRNA sequences (Table 5). 19 unique miRNAs are conserved across several species and affiliated to 15 subfamilies, of which 9 unique miRNA (pol-let-7a, pol-miR-7f, pol-miR-26a, pol-miR-125b, pol-miR-128, pol-miR-181a, pol-miR-200a, pol-miR-221, and pol-miR-429) are conserved higher across ten or more species. The pol-miR-125b is conserved across 43 species. While mirRNAs, pol-let-7j, pol-miR-21a, pol-miR-181f, and pol-miR-724, are conserved across only one species (Table 5). Four miRNAs (pol-miR-20c, pol-miR-23c, pol-miR-130d, and pol-miR-181e) are novel to P. olivaceus characterized as having high homologies with published miRNAs but differed by at least one nucleotide. These 4 miRNAs only observed in P. olivaceus are of special interest because of their unique sequences and possibly unique targeting mechanisms (Figure 4). Pol-miR-20c has a U to G mismatch with miR-20 of Fugu rubripes, Tetraodon nigroviridis, and Monodelphis domestica or miR-20a of Danio rerio, Xenopus tropicalis, Gallus gallus, Equus caballus, Canis familiaris, and Homo sapiens (Figure 4(a)). Pol-miR-23c has a U to C mismatch at positions 23 with miR-23b of Bos taurus, Pongo pygmaeus, Pan paniscus, and Pan troglodytes. However, the position 23 is absent between P. olivaceus and other fishes. In the miR-23b of E. caballus and H. sapiens, the positions 23 and 22 are both absent (Figure 4(b)). Pol-miR-130d has an A to G mismatch at position 10 as compared with E. caballus and H. sapiens, whereas there is no mismatch at the position as compared with nonmammals. Compared with miR-130 of other species, the positions 20, 21, and 22 of P. olivaceus are absent (Figure 4(c)). Compared with other species, pol-miR-181e has a G to U mismatch at the position 19. It is interesting that there is a one base absent at position 23 in other fishes and Xenopus laevis, whereas the position of U is conserved in P. olivaceus and higher vertebrates (Figure 4(d)).
Table 4

Classification of cloned small RNAs from P. olivaceus.

RNA speciesNumber present% of Total clones
miRNAs shown in Table 5 a 2920.28%
Novel miRNAs shown in Figure 4 b 42.80%
rRNA2114.68%
snoRNA42.80%
Unidentifiedc 4531.47%
Low quality or short sequencesd 4027.97%

Total143100%

aOnly miRNA candidates that match 100% to one of miRNAs in the miRBase database.

bMiRNA candidates without 100% match to any miRNAs in the miRBase database, but with significant similarity

cSequences do not match any known miRNAs or any other small RNAs or mRNAs.

dLow-quality sequences and sequences less than 17 nucleotides were not analyzed further.

Table 5

Sequence and characteristics of conserved miRNAs in P. olivaceus.

miRNA familymiRNA nameNo. of clonesSequence (5′-3′)Length (bp)Conserved in other animals
pol-miR-1pol-miR-1a1UGGAAUGUAAAGAAGUAUGUA21ssc, cfa, mmu-miR-1-2-as, mdo, xtr, ppa, gga, cbr, cel
pol-let-7pol-let-7a3UGAGGUAGUAGGUUGUAUAGUU22eca, bfl-let-7-1-as, sko, lgi, bfl, ptr, cfa, mml, mdo, bta, xtr, tni, fru, dre, gga, rno, mmu, cbr, hsa, cel
pol-let-7e2UGAGGUAGUAGAUUGAAUAGUU22oan, tni, fru, dre, gga
pol-miR-7f1UGAGGUAGUAGAUUGUAUAGUU22eca, ptr, cfa, mml, oan, mdo, xtr, bta, ssc, dre, gga, rno, mmu,
pol-let-7j1UGAGGUAGUUGUUUGUACAGUU22dre
pol-miR-9*pol-miR-9*3UAAAGCUAGAUAACCGAAAGU21mdo, xtr, dre
pol-miR-10pol-miR-10b1UACCCUGUAGAACCGAAUUUGU22oan, xtr, ppa, mne, ggo, gga, omy
pol-miR-21pol-miR-21a1UAGCUUAUCAGACUGGUGUUGG22omy
pol-miR-23pol-miR-23a3AUCACAUUGCCAGGGAUUUCCA22oan, bta, tni, fru, dre
pol-miR-26pol-miR-26a1UUCAAGUAAUCCAGGAUAGGCU22eca, cfa, bta, oan, tni, fru, ppa, mml, mne, lla, ppy, ggo, ptr, ssc, dre, rno, mmu, hsa, omy
pol-miR-125pol-miR-125b1UCCCUGAGACCCUAACUUGUGA22eca, bfl, spu, sko, cap, bfl, dya, dwi, dvi, dsi, dse, dpe, dmo, dgr, der, dan, tca, cfa, oan, mdo, xtr, bta, tni, fru, lca, mne, lla, sla, mml, ptr, ppy, ppa, age, ggo, ssc, dre, aga, dps, gga, rno, hsa, dme, mmu
pol-miR-128pol-miR-1282UCACAGUGAACCGGUCUCUUU21eca, cfa, mml, oan, mdo, bta, ptr, gga, rno, hsa, ppa, mmu, omy
pol-miR-145pol-miR-1451GUCCAGUUUUCCCAGGAAUCCC22dre, omy
pol-miR-181pol-miR-181a1AACAUUCAACGCUGUCGGUGAGU23eca, oan, mdo, xtr, tni, fru, lla, ppy, mne, sla, mml, ptr, ppa, ggo, dre, gga, rno, hsa, mmu,omy
pol-miR-181f1AACAUUCAACGCUGUCGGUGAGUU24bta
pol-miR-200pol-miR-200a1UAACACUGUCUGGUAACGAUGU22eca, ptr, mml, mdo, xtr, tni, fru, dre, gga, rno, hsa, mmu
pol-miR-221pol-miR-2211AGCUACAUUGUCUGCUGGGUUUC23eca, ptr, mdo, xtr, tni, fru, ppa, ppy, ggo, mml, dre, gga, rno, mmu, hsa
pol-miR-429pol-miR-4293UAAUACUGUCUGGUAAUGCCGU22bta, oan, xtr, gga, tni, fru, dre, cfa, rno, mmu
pol-miR-724pol-miR-7241UUAAAGGGAAUUUGCGACUGUU22dre
Figure 4

Alignment of the novel P. olivaceus miRNAs with highly preserved homologous miRNAs from other species.

3.3. The Expression Pattern of Representative Genes in Metamorphosing P. Olivaceus

Among miRNAs-targeted sequences in silico predicted by RNA22 miRNA target detection software [33], expression 24 genes of was confirmed in premetamorphosing or metamorphosing flounders by qRT-PCR. Only gene atcay was expressed stably at different metamorphic stages, indicating that it should not be associated with metamorphic events (Figure 5(a)). With exception for four genes atcay, oaz, ahcyl, and ela2a expression stably from premetamorphosis (17 DAH) to Stage E (19 DAH) (Figures 5(a)–5(d)), one gene cyp1a1 expression decreased (Figure 5(e)) and other genes tested in this study had significantly increased expression level (Figures 5(f)– 5(x)), indicating that these genes might participate in early metamorphic events. After metamorphosis initiated (since 19 DAH), oaz expression level decreased (Figure 5(b)), and the expression level of genes ahcyl, ela2a, cyp1a1, elf5a2, nt5c2, cp, timm8a, and tnnc2 or ck1 fluctuated during metamorphosing stage (Figures 5(c)–5(k)), suggesting that these genes might be associated with later metamorphic events, whereas the expression level of gene cox5a, hy, me, dck, mt-nd4l, hfe, hsp71, hadh, rps27, fabpi, lin52, nme1, or myl during metamorphosing stage dropped down to the level at premetamorphosis stage (Figures 5(l)–5(x)), indicating that these genes might be unimportant for later metamorphic events.
Figure 5

The abundance variety of mRNAs during metamorphic stage of P. olivaceus. The abundance of mRNAs was quantified by qRT-PCR. β-actin mRNA served as control for data normalization. Values are means ± SD, n = 3. Means without a common letter differ, P < .05.

To understand the role of miRNAs in the metamorphosing P. olivaceus, we quantified 23 miRNAs using stem-loop qRT-PCR. Since the sequence of pol-miR-7e is very similar to pol-miR-7f, the same pair of primers was used to amplify (Table 2). All 23 miRNAs were expressed in premetamorphosing or metamorphosing flounders. MicroRNAs pol-miR-1, pol-miR-7a, pol-miR-7j, pol-miR-7e/7f, pol-miR-9*, pol-miR-21a, pol-miR-20c, pol-miR-23c, pol-miR-125b, pol-miR-128, pol-miR-181a, pol-miR-181e, or pol-miR-181f were expressed highly just before metamorphosis starting (17 DAH), while their expression decreased after metamorphosis (from 19 DAH to 27 DAH), indicating that these microRNAs might not be associated with early metamorphic events (Figures 6(a)–6(m)). The expression level of miRNAs pol-miR-10b, pol-miR-23a, pol-miR-26a, pol-miR-130d, pol-miR-145, pol-miR-200a, pol-miR-429, pol-miR-221, or pol-miR-724 fluctuated during metamorphosing stage, suggesting that they might be associated with metamorphosis (Figures 6(n)–6(v)). MicroRNAs pol-miR-10b, pol-miR-23a, pol-miR-26a, pol-miR-130d, pol-miR-145, pol-miR-200a, and pol-miR-429 were expressed at the highest level at 23 DAH and then decreased quickly (Figures 6(n)–6(t)), indicating that they might play roles in regulating metamorphosis at this stage. These results are consistent with the findings of previous studies demonstrating the importance of miRNAs in differentiation and development [28, 30].
Figure 6

The abundance variety of miRNAs during metamorphic stage of P. olivaceus. The abundance of miRNAs was quantified by stem-loop qRT-PCR. U6 snRNA served as control for data normalization. Values are means ± SD, n = 3. Means without a common letter differ, P < .05.

4. Conclusion

In summary, we generated a collection of 1,051 unique ESTs, 23 unique miRNAs, and 4 unique snoRNAs in premetamorphosing and prometamorphosing P. olivaceus. Even though so far there were 3143 nucleotides and 13869 ESTs available in NCBI database, 1005 novel ESTs were identified successfully in this study, suggesting that special gene expression profile existed in metamorphic stage. Representative 24 mRNAs of 1051 unique ESTs were quantified during the metamorphosis of P. olivaceus using quantitative RT PCR, and the results showed that 20 genes might be associated with early metamorphic events and 10 genes might be related with later metamorphic events. In addition, the abundances of 23 miRNAs were quantified using stem-loop qRT PCR. 9 miRNAs might be associated with metamorphosis, and 7 miRNAs might play roles at metamorphic climax. The data provided in this research would be helpful for further identifying of metamorphosis-related genes in P. olivaceus.
  32 in total

1.  Gene ontology: tool for the unification of biology. The Gene Ontology Consortium.

Authors:  M Ashburner; C A Ball; J A Blake; D Botstein; H Butler; J M Cherry; A P Davis; K Dolinski; S S Dwight; J T Eppig; M A Harris; D P Hill; L Issel-Tarver; A Kasarskis; S Lewis; J C Matese; J E Richardson; M Ringwald; G M Rubin; G Sherlock
Journal:  Nat Genet       Date:  2000-05       Impact factor: 38.330

2.  A microRNA controlling left/right neuronal asymmetry in Caenorhabditis elegans.

Authors:  Robert J Johnston; Oliver Hobert
Journal:  Nature       Date:  2003-12-14       Impact factor: 49.962

Review 3.  Growth hormone (GH), GH receptor, and signal transduction.

Authors:  J J Kopchick; J M Andry
Journal:  Mol Genet Metab       Date:  2000 Sep-Oct       Impact factor: 4.797

4.  Thyroxine surge in metamorphosing flounder larvae.

Authors:  S Miwa; M Tagawa; Y Inui; T Hirano
Journal:  Gen Comp Endocrinol       Date:  1988-04       Impact factor: 2.822

5.  A microRNA repertoire for functional genome research in rainbow trout (Oncorhynchus mykiss).

Authors:  Mohamed Salem; Caide Xiao; Jonah Womack; Caird E Rexroad; Jianbo Yao
Journal:  Mar Biotechnol (NY)       Date:  2009-10-09       Impact factor: 3.619

6.  Metamorphosis in the summer flounder (Paralichthys dentatus): stage-specific developmental response to altered thyroid status.

Authors:  A M Schreiber; J L Specker
Journal:  Gen Comp Endocrinol       Date:  1998-08       Impact factor: 2.822

7.  Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.

Authors:  Ana Conesa; Stefan Götz; Juan Miguel García-Gómez; Javier Terol; Manuel Talón; Montserrat Robles
Journal:  Bioinformatics       Date:  2005-08-04       Impact factor: 6.937

8.  Insights into a dinoflagellate genome through expressed sequence tag analysis.

Authors:  Jeremiah D Hackett; Todd E Scheetz; Hwan Su Yoon; Marcelo B Soares; Maria F Bonaldo; Thomas L Casavant; Debashish Bhattacharya
Journal:  BMC Genomics       Date:  2005-05-29       Impact factor: 3.969

9.  Generation, annotation and analysis of ESTs from Trichoderma harzianum CECT 2413.

Authors:  Juan Antonio Vizcaíno; Francisco Javier González; M Belén Suárez; José Redondo; Julian Heinrich; Jesús Delgado-Jarana; Rosa Hermosa; Santiago Gutiérrez; Enrique Monte; Antonio Llobell; Manuel Rey
Journal:  BMC Genomics       Date:  2006-07-27       Impact factor: 3.969

10.  Towards the ictalurid catfish transcriptome: generation and analysis of 31,215 catfish ESTs.

Authors:  Ping Li; Eric Peatman; Shaolin Wang; Jinian Feng; Chongbo He; Puttharat Baoprasertkul; Peng Xu; Huseyin Kucuktas; Samiran Nandi; Benjaporn Somridhivej; Jerry Serapion; Micah Simmons; Cemal Turan; Lei Liu; William Muir; Rex Dunham; Yolanda Brady; John Grizzle; Zhanjiang Liu
Journal:  BMC Genomics       Date:  2007-06-18       Impact factor: 3.969

View more
  4 in total

1.  Bioinformatic identification and validation of conservative microRNAs in Ictalurus punctatus.

Authors:  Zhiqiang Xu; Qin Qin; Jiachun Ge; Jianlin Pan; Xiaofeng Xu
Journal:  Mol Biol Rep       Date:  2012-10-09       Impact factor: 2.316

2.  Identification and differential expression of microRNAs during metamorphosis of the Japanese flounder (Paralichthys olivaceus).

Authors:  Yuanshuai Fu; Zhiyi Shi; Minglin Wu; Junling Zhang; Liang Jia; Xiaowu Chen
Journal:  PLoS One       Date:  2011-07-27       Impact factor: 3.240

3.  The integrated analysis of RNA-seq and microRNA-seq depicts miRNA-mRNA networks involved in Japanese flounder (Paralichthys olivaceus) albinism.

Authors:  Na Wang; Ruoqing Wang; Renkai Wang; Yongsheng Tian; Changwei Shao; Xiaodong Jia; Songlin Chen
Journal:  PLoS One       Date:  2017-08-04       Impact factor: 3.240

4.  Thermal plasticity of the miRNA transcriptome during Senegalese sole development.

Authors:  Catarina Campos; Arvind Y M Sundaram; Luisa M P Valente; Luis E C Conceição; Sofia Engrola; Jorge M O Fernandes
Journal:  BMC Genomics       Date:  2014-06-25       Impact factor: 3.969

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.