Literature DB >> 21573107

Sequencing-based approaches reveal low ambient temperature-responsive and tissue-specific microRNAs in phalaenopsis orchid.

Feng-Ming An1, Shuan-Rung Hsiao, Ming-Tsair Chan.   

Abstract

Plant small RNAs (smRNAs) are short, non-coding RNA molecules that mediate RNA silencing and regulate a group of genes involved in plant development and responses to environmental stimuli. Low temperature is necessary to initiate stalk development in the orchid Phalaenopsis aphrodite subsp. formosana. To identify smRNAs in Phalaenopsis responding to low temperatures, a smRNA profiling analysis using high-throughput sequencing technology was performed. Subsequent bioinformatic analysis was applied to categorize the miRNAs identified. A total of 37,533,509 smRNA reads yielded 11,129 independent orchid miRNA sequences, representing 329 known miRNA families identified in other plant species. Because the genomic resources available for Phalaenopsis are limited, a transcriptomic database was established using deep sequencing data sets to identify miRNAs precursors and their target transcripts. Comparing small RNAs and the transcriptomic database, 14 putative miRNA precursors of 10 miRNA families were identified, as were hundreds of putative targets. Comparing sequencing data and smRNA northern hybridization results identified miR156, miR162, miR528 and miR535 as low temperature-induced miRNAs. In addition, tissue-specific expression of these miRNAs was investigated. It was concluded that miR156 and miR172 may be components of a regulatory pathway mediating transition from the vegetative to the reproductive phase in Phalaenopsis. The smRNA and transcriptomic databases could be the foundations for further research aimed at elucidating the control of the flowering time in orchids.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21573107      PMCID: PMC3089612          DOI: 10.1371/journal.pone.0018937

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Small non-protein-coding RNAs (smRNAs) present in plants are 20–24 nucleotides (nt) in length and carry out diverse functions during plant development in response to environmental stimuli, in terms of anti-viral defense and involvement in epigenetic modifications [1]. Endogenous smRNAs regulate transcriptional and post-transcriptional gene silencing through DNA methylation, chromatin modification, mRNA cleavage/degradation and translational inhibition [2]. On the basis of precursor structures and biosynthetic pathways, plant smRNAs are broadly classified as small interfering RNA (siRNA) or microRNA (miRNA). The microRNA (MIR) pathway produces microRNA (miRNA), the trans-acting siRNA (TAS) pathway produces trans-acting small interfering RNA (ta-siRNA), the post-transcriptional gene silencing (PTGS) pathway produces virus-induced (VI-PTGS) and repeat associated siRNA (rasiRNA), and the natural antisense transcripts (NATs) pathway produces naturally occurring siRNAs (nat-siRNA) [3]. Transcripts transcribed from MIR genes, usually located between coding genes, are termed “pri-miRNAs”. Pri-miRNAs are processed by DICER-LIKE1 (DCL1) proteins to generate stem–loop precursor miRNAs, termed “pre-miRNAs”. Final processing of these precursors is carried out by a macromolecular protein complex formed by DCL1, HYPONASTIC LEAVES1 (HYL1) and SERRATE (SE), and they are exported to the cytoplasm through the action of the plant exportin 5 ortholog HASTY. Ultimately, the guide miRNA strand is incorporated into ARGONAUTE (AGO) proteins to initiate the downstream gene silencing process [4]. Phalaenopsis orchids are appreciated for their beauty and represent a commercialized species with high economic value. Phalaenopsis aphrodite subsp. formosana, a native species of Phalaenopsis in Taiwan, has been widely used for breeding hybrids with various colors, shapes and sizes of floral organs. Industries often use high temperatures (>28°C) to inhibit spike initiation and low temperatures (24°C/18°C, day/night) to synchronize the flowering date in certain Phalaenopsis species. Without prolonged exposure to low ambient temperatures, spike initiation would be inhibited. Several studies have demonstrated that low temperatures during the day or at night are necessary for Phalaenopsis orchids to flower [5], [6]. Phalaenopsis orchids are classified biologically as crassulacean acid metabolism (CAM) plants. Metabolic analysis based on the characteristics of CAM plants elucidated the relationship between the metabolic pool and low temperature conditions for spike induction in Phalaenopsis aphrodite subsp. formosana [6]. Some studies have demonstrated the importance of low ambient temperature requirements for the reproductive phase transition in Phalaenopsis aphrodite subsp. formosana, but the regulatory mechanism(s) underlying this transition have yet to be elucidated. Several studies have demonstrated that miRNAs are involved in abiotic and biotic stresses such as oxidative stress [7], cold [8], [9], salt, nutrient deficiency [10], [11], [12] and pathogen infection. miRNA398 is a repressor of Cu-Zn superoxide dismutase genes (At1g08830, CSD1; At2g28190, CSD2), which act as ROS scavengers [7]. In response to oxidative stress miR398 is down-regulated, resulting in an immediate increase in the level of CSDs, which remove ROS. miR395 and miR399 regulate gene expression to maintain sulfur and phosphate homeostasis during nutrient-deficient conditions. ATP sulfurylases (At3g22890, ASP1; At4g14680, ASP3; and At5g43780, ASP4) and sulfate transporters (At5g10180, AtSULTR2;1), which are involved in sulfur assimilation and translocation, specifically, are targeted by miR395 [11], [12]. miR399 is up-regulated during phosphate starvation, causing repression of its target gene, PHO2 (also named UBC24); as a result, Pi uptake is increased [10]. Several studies have analyzed the expression patterns of miRNAs under conditions of various stresses using deep sequencing and/or miRNA microarray. These studies identified the putative miRNA targets, but require validation, and the overall pathways have yet to be determined. Temperature-responsive smRNAs were identified predominantly under temperature stress conditions. In response to cold stress, miR156/157, miR159/319, miR165/166, miR169, miR172, miR393, miR394, miR396, miR397 and miR398 were up-regulated [9]. Low ambient temperature conditions are less stressful than extreme cold. Two miRNA families, miR156 and miR169, were up-regulated at low ambient temperatures; validation was achieved by comparing northern hybridization results with those obtained using microarray analyses [13]. However, the regulatory roles of smRNAs that exhibit a change in their expression profiles during low ambient temperature conditions in other species remains unclear. To investigate which functional miRNAs potentially affect the development and flowering of Phalaenopsis aphrodite subsp. formosana during low ambient temperature conditions, candidate miRNA species were identified using deep sequencing. After aligning these candidates with known miRNAs found in other plant species, it was evident that some miRNA families were highly represented including miR156, miR166, miR167, miR168, miR172, miR528 and miR535. By mining the sequencing data, several abundant miRNAs were shown to be induced by low temperature treatment; the expression profiles of these miRNAs were confirmed using northern hybridization. The results demonstrated that the four major miRNA families were induced by low temperatures and that their expression was tissue specific. To identify target transcripts of miRNAs, referenced genomic or EST (expressed sequence tag) sequences should be available. Phalaenopsis has few sequence resources. Therefore, the usability of a transcriptomic database established by 454 pyrosequencing was investigated as a possible reference. Several target transcripts were annotated to known miRNA-mediated target genes in other plant species, revealing conservation of miRNA regulatory pathways. Furthermore, some of these target transcripts were highly associated with phase transition and flower development, suggesting the possibility of regulatory pathways for low temperature-responsive miRNAs. Previous studies have demonstrated that specific miRNAs are involved in the regulation of development and flowering in plants. For example, the sequential action of ath-miR156 (ath-, Arabidopsis thaliana) and ath-miR172, which leads to repression of SMZ, SNZ, TOE1 and TOE2, regulates flowering in Arabidopsis [14], [15]. Therefore, miR156, miR172 and their target transcripts were selected as candidates to validate the entire approach, suitable for investigating miRNA-mediated regulatory pathways. In this study, two comprehensive smRNA and transcriptomic databases have been developed, which not only contribute to the understanding of low-temperature regulation but may also prove useful tools for future research projects. The results presented herein provide an insight into the regulatory role of miRNAs in Phalaenopsis aphrodite subsp. formosana in response to low ambient temperatures and provide valuable information in relation to the control of flowering time.

Results

The microRNA biosynthesis pathway in Phalaenopsis aphrodite subsp. formosana is similar to that of Arabidopsis

To identify the existing miRNA biosynthesis pathways in Phalaenopsis aphrodite subsp. formosana, Blast searches against the deep sequencing-based Phalaenopsis transcriptomic database were performed using 29 known Arabidopsis genes [3] involved in miRNA biosynthesis. With the exception of AGO7 and SUVH4, miRNA biosynthesis components of Arabidopsis were identified in the native orchid. This reveals a high degree of conservation of these pathways between Arabidopsis and Phalaenopsis (Table S1).

Small RNA sequencing using Illumina

Leaves of Phalaenopsis aphrodite subsp. Formosana, with or without low temperature treatment, were harvested for smRNAs expression analysis, and stalks and flower buds were harvested for investigating tissue-specific expression of smRNAs. Four pools of smRNAs were generated and subjected to next-generation sequencing using Illumina technology (see Methods). After excluding polyA sequences, short reads with lengths below 18-nt and contaminants of adapter and null sequences, 28,932,901 from a total of 37,533,509 reads contained correct adapter sequences (Table 1). Data analysis revealed that the four batches contained a similar size distribution of smRNAs, with sequences of 24-nt representing the most abundant class in each batch. Although the number of total reads was similar for each batch, the number of clean reads was reduced in the batch containing flower buds. There were more reads corresponding to 21-nt-long smRNAs in low ambient temperature-treated leaves and flower buds than in reads of untreated leaves and stalks (Figure 1). The number of sequences with a length of 24-nt was lower in the group of flower buds (∼2.8 million) than in all other batches (approximately four million, on average). After removal of rRNA, tRNA, snRNA, snoRNA and repeat sequences characterized in Rfam [16] and Genbank [17], a total of 3.8–5.3 million unique sequences in the range of 18–25 nt remained in the four batches and these were used for further analyses (Table 1).
Table 1

Summary of small RNA sequencing.

NLCLSFB
Number of sequence reads9,012,4319,621,2089,891,2449,008,626
high quality7,655,7808,188,0348,557,6837,816,982
adapter3 null6,0116,20711,6685,478
insert null1,4121,4831,90258,600
adapter5 contaminants32,88939,12149,41761,064
smaller than 18 nt413,178741,172478,8131,373,976
polyA6651,020809693
clean reads7,201,6257,399,0318,015,0746,317,171
No. of unique sequences4,633,0374,386,2955,330,9043,853,304
miRNA4,2074,9813,2884,831
rRNA32,28037,93829,95927,394
repeat7429299111,137
snRNA456463570628
snoRNA354357416463
tRNA6,4467,6004,7844,901
unann4,577,0574,323,2655,275,9513,803,023
Figure 1

Size distribution of small RNA sequences in the separated tissues of native Phalaenopsis.

NL: leaves from untreated plants, CL: leaves after low ambient temperature treatment, S: stalks, FB: flower buds.

Size distribution of small RNA sequences in the separated tissues of native Phalaenopsis.

NL: leaves from untreated plants, CL: leaves after low ambient temperature treatment, S: stalks, FB: flower buds.

Alignment to known miRNAs

The unique sequences of the four batches were used for aligning to known miRNA sequences from miRBase v15; between 3,300 and 5,000 sequences were obtained from various samples (Table 1). The size distribution of match-to-known miRNA sequence reads in Phalaenopsis orchid demonstrated a maximum at miRNAs 21-nt in length (Figure 2), consistent with data obtained previously in another plant species using a similar approach [18]. Alignment of miRNA sequences of the four samples revealed the presence of 11,129 unique sequences belonging to 329 miRNA families. Within these 329 miRNA families, the main components in Phalaenopsis orchid were miR156, miR159, miR164, miR166, miR167, miR168, miR172, miR528, miR535 and miR894 (Figure 3A). The more abundant miRNA families contained hundreds of unique sequences (Figure 3B). A low number of sequence reads may be insufficient to represent the expression pattern of a single sequence. Therefore, sequences with a high number of reads were used to study the roles of low temperature-responsive miRNAs in the orchid Phalaenopsis.
Figure 2

Characterization of conserved miRNAs in various tissues of Phalaenopsis orchid.

Size distribution of mature miRNAs in each tissue as a function of the sum of reads (A) and the number of unique sequences (B) NL: leaves from untreated plants, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds.

Figure 3

Characterization of conserved miRNA families.

miRNA families pertaining to the number of unique sequences (A) and to the sum of reads in an individual miRNA family (B). NL: leaves from untreated plants, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds.

Characterization of conserved miRNAs in various tissues of Phalaenopsis orchid.

Size distribution of mature miRNAs in each tissue as a function of the sum of reads (A) and the number of unique sequences (B) NL: leaves from untreated plants, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds.

Characterization of conserved miRNA families.

miRNA families pertaining to the number of unique sequences (A) and to the sum of reads in an individual miRNA family (B). NL: leaves from untreated plants, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds.

Sequencing-based analysis of low ambient temperature-responsive miRNAs in Phalaenopsis aphrodite subsp. formosana

For the analysis of low temperature responsive smRNAs in the orchid Phalaenopsis, smRNA sequences with a number of reads over 100 were considered highly abundant. By comparing abundant smRNAs in the group of untreated leaves with that of low temperature-treated leaves, 1,282 unique sequences present in both groups were identified (Figure 4A). Among these sequences, 65 were miRNAs (5.1%), 107 were tRNAs (8.3%), 93 were rRNA (7.3%) and 1,008 were unknown sequences (78.6%) (Figure 4B). A calculation of fold change of reads (fold = reads of treated group/untreated group) for these sequences revealed that 416 smRNA sequences in the low temperature-treated group had a >1.5 fold increase in reads, whereas 137 smRNA sequences had a decreased ratio (Figure 4C). Further analysis indicated that miR156, miR159, miR162, miR168, miR396, miR528, miR535 and miR894 were induced in leaves during low ambient temperature treatment; miR172 demonstrated a repressed pattern in leaves during the same treatment. miR164, miR166, miR167 and miR390 were expressed at similar levels under low temperature-treated or untreated conditions (Table 2).
Figure 4

Summary of low temperature-responsive miRNA selection.

Abundant smRNAs from untreated and low temperature-treated leaves (A); Characterization of abundant smRNAs (B); Fold change of small RNA unique sequences by comparing the dataset of the low temperature treated group to the untreated group (C). NL: leaves from untreated plants, CL: leaves from low ambient temperature treatment.

Table 2

List of predicted precursors.

MIRNA locimiRNA seqlengthpredicted precursor* MFE (kcal/mol)
miR156 UGAGAGAGAAAGAGAGAGAGCAU 23con_contig16056−302.42
miR164 UGGAGAAGCAGUGCACGUGUU 21con_contig07032, chi_contig01076−42.5, −44.9
miR171 AUGAGCCGAACACGAACACACU 22con_contig03214−24.9
UUGAGCCGAACACGAACACACC 22
miR396 UCCCACAGCUUUCUUGAACUG 21con_contig08933−52.6
UCCCACAGCUUUCUUGAACUC 21
miR418 AAUGAUGAUGAUGAUGAUGACG 22bud_contig04831−23.5
miR535 UGACAACGAGAAAGAGCACCC 21bud_contig03834−55.4
UGACAACGAGAAAGAGCACGC 21
UGACAACGAGAAAGAGCACUC 21
UGACUACGAGAGAGAGCACGC 21
GACAACGAGAGAGAGCACGCUA 22
UGACAACGAGAGAGAGCACGCUA 23
miR854 GAUGAGGAGGAGGAGGAGGAGGAG 24con_contig03976−167.3
miR900 AUGUGUUAUUGUAUCCUGGGAA 22chi_contig14717−21.5
UCCCAGGAUACAAUAACACAUGA 23chi_contig14717, bud_contig15809−21.5, −86.9
miR1023 AGAGGAAGUGAGAGAGAGUGAU 22con_contig20221−80
miR1063 CAUCAUUGGAGUACUGAUGCAU 22con_contig15919, chi_contig02825−56.5, −41.5

*Contig IDs are used in the transcriptomic database. These IDs will be well-linked for searching despite further definitions being made.

Summary of low temperature-responsive miRNA selection.

Abundant smRNAs from untreated and low temperature-treated leaves (A); Characterization of abundant smRNAs (B); Fold change of small RNA unique sequences by comparing the dataset of the low temperature treated group to the untreated group (C). NL: leaves from untreated plants, CL: leaves from low ambient temperature treatment. *Contig IDs are used in the transcriptomic database. These IDs will be well-linked for searching despite further definitions being made.

Precursor prediction of miRNA with transcriptomic database and secondary stem-loop structural simulation

Pre-miRNAs have an important feature that distinguishes them from other small RNAs: they form a secondary hairpin structure. This characteristic offers a powerful approach for predicting the existence of new miRNA orthologs or homologs in other species [19]. To predict miRNA precursors, putative miRNA sequences were searched against a transcriptomic contig database (see Methods). Twenty-five of 11,129 identified miRNA sequences matched 33 transcript contigs that are thought to be primary miRNAs (pri-miRNAs). The secondary structure of these contigs were analyzed using the RNAfold web server [20]. Only 13 contigs belonging to 10 miRNA families had a putative secondary structure (Table 3). MFE (minimal folding free energy) was used to evaluate the stability of simulated RNA secondary structures. Generally, the lower the MFE, the more stable the formed RNA secondary structure. Stem-loop hairpin structures including mature miRNA sequences on both strands were used to calculate MFE. The average length of the hairpin structures was approximately 100 nucleotides. Because the input sequences differed in length, the range obtained for the MFE of these structures was −21.5 to −302.42 kcal/mol. Owing to their well-formed secondary structures, two pri-miRNA sequences belonging to miR396 and miR535 were considered potential candidates for further study (Figure 5).
Table 3

Abundant miRNAs present in Phalaenopsis aphrodite subsp. formosana.

miRNA familySequenceLengthReads/clean reads (million)* Relative change**
NLCLSFB
miR156/157 CUGACAGAAGAUAGAGAGCAC 21113130261007202.68
UGACAGAAGAGAGUGAGCAC 2049012422725572.54
miR159 UUUGGAUUGAAGGGAGCUCUA 2162106632011.71
UUUGCAUAACUCAGGAGCUGG 21631482933732.37
miR162 UCGAUAAACCUCUGCAUCCGG 21477032931.48
miR164 UGGAGAAGCAGGGCACGUGUU 2194132181.41
UGGAGAAGCAGGGCACGUGCA 214965891326921.19
UGGAGAAGCAGGGCACAUGUU 2136512131.41
miR166 UUCGGACCAGGCUUCAUUCCC 2141449471.07
UCGGACCAGGCUUCCUUCCCC 2123991811130.38
UCGGACCAGGCUUCAUUCCCC 2144094305142840760.98
GGAAUGUUGUCUGGCUCGAGG 21206272773.07
CGGACCAGGCUUCAUUCCCC 2083106321131.28
miR167 UGAAGCUGCCCGCAUGAUCUGA 221919010.99
UGAAGCUGCCAGCAUGAUCUGUUC 241145135841821.19
UGAAGCUGCCAGCAUGAUCUGAA 2343144749644011.10
UGAAGCUGCCAGCAUGAUCUA 223103654474061.18
miR168 UCGCUUGGUGCAGGUCGGGAU 214619772323522.12
UCGCUUGGUGCAGGUCGGGAC 2120614600273029702.23
UCGCUUGGUGCAGGUCGGGAAU 2224363032157314981.24
miR172 CGAAUCUUGAUGAUGCUGCAU 2114016522601690.47
AGAAUCUUGAUGAUGCUGCAU 213146184010781.51
AGAAUCAUGAUGAUGCUGCAA 21277123593320.44
miR390 AAGCUCAGGAGGGAUAGCGCC 21413824260.93
miR396 GUUCAAUAAAGCUGUGGGAAA 2135574141.63
GUUCAAGACAGCUGUGGGAAA 215710946831.91
miR528 UGGAAGGGGCAUGCAGAGGCG 2114382322.71
UGGAAGGGGCAUGCAGAGGAGA 226019205831077164623.42
GGAAGGGGCAUGCAGAGGAG 20177684325283.87
miR535 UUGACAAAGAGAGAGAGCACGC 222019361662855781.79
UGACAAAGAGAGAGAGCACGC 212051958210.95
miR894 GUUUCACGUCGGGUUCACCA 203003691932641.23

*Reads of each group is normalized with clean reads in million unit.

**Relative change = reads of low temperature-treated leaves (CL)/untreated group (NL). NL: leaves from untreated plants, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds.

Figure 5

Secondary structure simulation of predicted miRNA precursors.

pha: abbreviation for Phalaenopsis aphrodite subsp. formosana.

Secondary structure simulation of predicted miRNA precursors.

pha: abbreviation for Phalaenopsis aphrodite subsp. formosana. *Reads of each group is normalized with clean reads in million unit. **Relative change = reads of low temperature-treated leaves (CL)/untreated group (NL). NL: leaves from untreated plants, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds.

Combination analyses reveal the major classes of miRNA families in response to low temperature in Phalaenopsis aphrodite subsp. formosana

To elucidate the physiological roles of the abundant miRNAs and to validate these with the sequencing results, small RNA northern hybridization was performed for 11 miRNA families with samples from leaves, stalks and flower buds, or low temperature-treated leaves. The results indicated that miR156, miR162, miR167, miR528 and miR535 were induced in leaves under low ambient temperature treatment, while the expression levels of miR159, miR164, miR166, miR172 and miR396 remained unchanged, and that of miR169 was decreased (Figure 6). By comparing the results of direct sequencing and smRNA northern hybridization, four low temperature-responsive miRNA families were identified: miR156, miR162, miR528 and miR535.
Figure 6

Analysis of miRNA expression levels in Phalaenopsis aphrodite subsp. formosana using northern hybridization.

NL: leaves from untreated condition, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds.

Analysis of miRNA expression levels in Phalaenopsis aphrodite subsp. formosana using northern hybridization.

NL: leaves from untreated condition, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds. Several miRNAs had different expression patterns in the leaf and inflorescent tissue. miR159, miR164 and miR166 accumulated in stalks, while miR172 accumulated in stalks and flower buds. miR156, miR167 and miR396 were expressed predominantly in leaves, whereas miR169 was expressed only in inflorescence tissue, particularly flower buds. Expression of miR167 and miR528 could not be detected in flower buds but were detected in other tissues (Figure 6). The results indicate the tissue specificity of expression and low ambient temperature-dependent response of miRNAs in Phalaenopsis aphrodite subsp. formosana. The number of sequence reads is thought to represent a quantitative measure of the expression of certain genes, as a result of the large amount of data generated from deep sequencing. In fact, the dynamic expression patterns obtained by small RNA blot analysis reflected the digital northern results from deep sequencing (Table 3, Figure 6).

Identification and characterization of miRNAs potential targets in Phalaenopsis aphrodite subsp. formosana

To investigate the regulatory function of miRNA in Phalaenopsis aphrodite subsp. formosana, miRNA orthologs identified in Phalaenopsis orchid were compared against a deep sequencing-based transcriptomic database to identify target transcripts (see Methods). Through this bioinformatics analysis, hundreds of putative target transcripts were identified, and the number of target transcripts was lowered using abundant low temperature-responsive and tissue-specific miRNA sequences. BLASTX was performed with the selected target transcripts to identify the best homolog in Arabidopsis as molecular functions in this species are better understood. Several identified target transcripts are well-known miRNA target genes in Arabidopsis including the squamosa promoter-binding-like (SPL) genes of miR156, the MYB domain containing gene of miR159, the NAC-domain containing gene of miR164, PHABULOSA (PHB) of miR166, auxin responsive factors (ARFs) of miR167, ARGONAUTE 1 (AGO1) of miR168, scarecrow-like transcription factor of miR171, growth-regulating factors (GRF) of miR396 and laccase of miR397 (Table S2). The listed target transcripts from low temperature-responsive or tissue-specific miRNAs were further categorized according to molecular function and biological processes using gene ontology (GO) analysis. This analysis revealed that the majority of target transcripts were highly correlated with plant development and metabolic processes. Several of the well-annotated target transcripts such as MYB65, NAC1, PHB and ARFs had putative functions involved in floral organ formation (Table S2). The miRNAs of these genes accumulated in stalk but not in flower bud, with the exception of miR167, which may contribute specifically to floral transition or the differentiation of meristem (Figure 6). For target genes of low temperature-responsive miRNAs, floral homeotic protein HUA1 is one newly predicted target gene of miR528. miR528 is almost absent in flower buds, suggesting the regulatory role concerns floral organ identity. In addition, miR156 and miR535 matched the same target transcripts and had similar expression patterns (Table S2, Figure 6). Using alignment, few gaps and no more than one mismatch were identified in the nucleotide sequences between miR156 and miR535, suggesting they may be somewhat functionally redundant in Phalaenopsis. Previous reports have determined that miR156 and miR172 play key roles in the transition from the vegetative to the reproductive phase, and they were determined to be low temperature-responsive in previous studies and in the present study. In order to validate that the suitability of the entire approach for investigating miRNA-mediated regulatory pathways, miR156- and miR172-mediated cleavage was confirmed by modified 5′-end RLM-RACE (RNA ligase mediated-rapid amplification of cDNA end) (Figure 7A and B) and the 5′-end cleavage products were successfully amplified. Furthermore, the expression patterns of PaSPL and PaAP2 were analyzed. The expression of PaSPL was complementary to the expression of miR156, whereas PaAP2 demonstrated inconsistent expression patterns (Figure 7C). A possible explanation of the fact that expression of PaAP2 was not complementary to the expression of miR172 may be that miR172 contributes to its function via translational repression rather than by RNA cleavage [21].
Figure 7

Identification of cleavage sites and expression patterns of PaSPL and PaAP2 in Phalaenopsis aphrodite subsp. formosana.

The arrows indicate the 5′ cleavage sites (A) that were sequenced from 5′-end cleavage products (B). The expressions of PaSPL and PaAP2 were analyzed using Q-PCR. The 18S rRNA expression level was used as a quantitative control. NL: leaves from untreated condition, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds.

Identification of cleavage sites and expression patterns of PaSPL and PaAP2 in Phalaenopsis aphrodite subsp. formosana.

The arrows indicate the 5′ cleavage sites (A) that were sequenced from 5′-end cleavage products (B). The expressions of PaSPL and PaAP2 were analyzed using Q-PCR. The 18S rRNA expression level was used as a quantitative control. NL: leaves from untreated condition, CL: leaves from low ambient temperature treatment, S: stalks, FB: flower buds.

Discussion

This study is the first to identify small regulatory RNAs comprehensively in Phalaenopsis aphrodite subsp. formosana. Furthermore, it is the first to report that low ambient temperature-responsive miRNAs belong to four miRNA families and to identify their putative target transcripts. In addition, it showed that numerous sequences of miRNAs are conserved between Phalaenopsis aphrodite subsp. formosana and other plant species. Sixty-four, 58, 57 and 71 sequences were identified in untreated leaves, low temperature-treated leaves, stalks and flower buds, respectively, with perfect matches to known miRNAs present in other plant species (Table S3). Among them, the more abundant miRNA sequences were highly correlated with Vitis vinifera, in particular miR528, which has recently been characterized as a monocot-specific miRNA [22] originally discovered in Oryza sativa [23] and recently identified in another two Poaceae plants, Zea mays and Sorghum bicolor [24]. More than one thousand smRNA sequences were categorized as being in the miR528 family. The major sequence is 5′-UGGAAGGGGCAUGCAGAGGAG-3′, but there are more divergences in Phalaenopsis than in any other plant species (data not shown). miR535 is an unique miRNA first reported in moss (Physcomitrella patens) [25] and later identified in Oryza sativa and Vitis vinifera [26]. The miR528 and miR535 sequences identified were used in other species to search for target transcripts, but no similar target transcripts could be identified. miR528 was assumed to be a regulator of development because its expression increased during low ambient temperature treatment. Putative target homologs of miR528 have been reported to participate in nucleosome assembly, glycosylation, and ubiquitination and cell fate determination in other plant species [27], [28], [29]. Among these, HUA1 interacted with HEN4 and acted as a regulator of stamen and carpel identities by binding AGAMOUS pre-mRNA during RNA processing [27]. Another target transcript, histone H2A, was previously reported to participate in flower development via regulation of the expression of FLOWERING LOCUS C (FLC) in Arabidopsis [28]. Several studies have focused on the regulatory role of stress-responsive miRNAs. miR168, miR171 and miR396 were shown to be responsive to all stresses in Arabidopsis [8]. Many platforms have been employed for identifying low temperature-responsive miRNAs. However, for several miRNAs, the results of expression patterns were inconsistent among plant species (Table S4). Treatment at 16°C resulted in an increase in the expression of ath-miR156, ath-miR161.a2, ath-miR166 and ath-miR169, but decreased expression of ath-miR163, ath-miR172, ath-miR396∼399 and ath-miR830 [13]. Comparable results were generated in this study (Table S4). Lower temperature treatment (4°C) led to different miRNA expression patterns; in particular, the patterns of ath-miR156 and ath-miR172 were reversed, suggesting distinct regulatory roles for the two miRNAs in the response to ambient temperature and vernalization (near-freezing temperature) [8], [13]. Previous studies have demonstrated that miR156 is highly expressed during the juvenile phase and that expression gradually decreases in later developmental stages. SPL genes are negatively regulated by miR156 and function as positive regulators of MIR172 genes. Accumulation of miR172 contributes to complete flowering through negative regulation of certain AP-2-like transcriptional factors such as SMZ, SNZ, TOE1 and TOE2 [30], but was not identified in the transcriptomic database in this study. Homologs of SPL genes were identified and reversed expression patterns were observed by Q-PCR analysis (Figure 7C). 3′- and 5′-RACE (rapid amplification of cDNA end) was performed and one AP-2 like transcript with a predicted miR172 target site was successfully obtained; however, the expression pattern was not completely reversed as would have been expected (Figure 7C). Previous studies have demonstrated that miR172 contributes its function via translational repression rather than by RNA cleavage [21], [31]. However, evidence from recent studies and herein suggests that miR172 also functions to degrade its target mRNAs [32], [33]. These results indicate that miR156- and miR172-mediated regulatory pathways in Arabidopsis and Phalaenopsis are similar, but more research is required to identify the downstream miR172-targeted genes that function in a similar manner to the known genes. In this study, other small RNAs that may potentially function in regulating flowering time under low temperature treatment were not excluded (Figure 4B), and approximately 80% of abundant smRNAs consisted of currently unknown sequences. These sequences were grouped according to an increased or decreased ratio compared with low temperature-treated leaves and untreated leaves. The results revealed 74 smRNA sequences that could be classified into 28 groups. These smRNA sequences were searched against the transcriptomic database to identify novel miRNA precursors but none were identified. To understand the functional role of these undefined smRNAs, their putative target transcripts were investigated. Several smRNAs were completely complementary to their target transcripts including digalactosyldiacylglycerol synthase and alliin lysase, which may be siRNAs. However, no target transcripts that could be involved in flowering were identified. Most were involved in biosynthetic and metabolic processes (Table S5). Individual miRNAs of one miRNA family had a distinct expression pattern (Table 2), suggesting that each individual miRNA may target specific transcripts to achieve unique functional inhibition. However, verifying the effects of the changes in sequences of miRNAs is technically challenging. smRNA hybridization may result in annealing of the probe to sequences containing 1 to 4 mismatches [34], [35]. Therefore, the results of smRNA hybridization led to combined expression patterns for each miRNA family. To increase sensitivity and specificity, it is suggested that future research should deploy smRNA sequence-based elongated primers designed for real-time quantitative PCR, particularly in the case of low-abundant smRNAs [35]. Few miRNA precursors could be identified in our transcriptomic database, possibly due to the loss of short RNA fragments isolated from total RNA using LiCl precipitation. Using LiCl precipitation would have avoided contamination with polysaccharides, polyphenol and other insoluble materials [36]. Furthermore, genomic or transcriptomic resources from dicer-mutated plants would be more efficient for identifying miRNA primary transcripts. Alternatively, the strategy of designing amiRNAs (artificial miRNA) rather than using native precursors for advanced studies concerning functional miRNAs is feasible [37], [38]. There are few EST sequences and one GSS (genome sequence survey) of Phalaenopsis orchids available in the public resources [39]. Among them, the information associated with miRNA is limited after analysis. Sequences of Phalaenopsis for bioinformatics analyses are more limited than for other model plants. High-throughput sequencing provides a more powerful way to establish a transcriptomic database than generating EST or genomic libraries. This study provides useful information for elucidating the regulatory mechanism underlying thermosensing and flowering time regulation.

Materials and Methods

Plants growth conditions

Seedlings of Phalaenopsis aphrodite subsp. formosana (M1624) were purchased from Chain Port Orchid Co., Ltd (Chengde Village, Taiwan) and grown in 2.5 in. diameter plastic pots filled with sphagnum moss in an environment-controlled greenhouse, at a constant temperature of 28°C for 7–8 months. Plants comprising the untreated group were subsequently grown at 32°C/27°C (light/dark) to inhibit phase transition. Low ambient temperature treatment was carried out at 24°C/18°C (light/dark) for two months to complete phase transition. Leaves with or without low temperature treatment were collected at 0.5 month intervals from zero to two months. Stalks and flower buds were only present in the low temperature treatment group. Stalks were collected at 1.5 and 2 months, while flower buds were collected at 3.5 months. The materials were harvested more than ten independent lines in each time point per batch and stored them separately for all the experiments in this study. We randomly picked out the individual plant materials and extracted the RNAs freshly before performing the experiments. We performed the biological replications for all of the experiments in this study.

Small RNA library preparation and sequencing

Tissues frozen in liquid nitrogen were ground to fine powder using a mortar and pestle. Total RNA extraction was freshly prepared using Trizol (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. Small RNAs were size fractionized on a 15% denaturing polyacrylamide gel. Subsequently, gel bands corresponding to fragments in the size range of 20–25 nt were excised and eluted into 0.3 M NaCl. The eluted smRNAs were sequentially ligated to 5′- and 3′-adaptors and converted to DNA using RT-PCR. Products of RT-PCR were directly sequenced using an Illumina 1G Genome Analyzer according to the manufacturer's protocols (Beijing Genomics Institute, China) [40].

Production of small RNA sequences

Raw data were processed by removing the adaptor/acceptor sequences, contaminants and low quality reads. To identify degradation tags of rRNA, tRNA, snRNA and snoRNA, sequences were aligned using Rfam 10.0 (http://rfam.sanger.ac.uk/) [16] and the Genbank database (http://www.ncbi.nlm.nih.gov/) [17]. The final dataset containing reads of orchid smRNA sequences were used for this study.

Identification of conserved miRNA orthologs

Known miRNAs were downloaded from the miRBase15.0 database (http://www.mirbase.org/ftp.shtml) [41]. Alignment of fully complementary sequences, those with one mismatch or two mismatches, was performed using the BLAST algorithm to identify conserved miRNA orthologs. The number of aligned sequences was restricted by limiting the mismatch plus gap to fewer than 5 residues. The analyzed results were deposited in Gene Expression Omnibus (GEO) on NCBI website. The accession number is GSE27585. A comparison of Phalaenopsis miRNA sequences and miRNAs of other plant species is presented in the Supplemental Data.

Establishment of a Phalaenopsis transcriptomic database

Freshly extracted total RNA was subjected to LiCl precipitation to reduce the effects from polysaccharides, polyphenols and other contaminants. Messenger RNAs were further isolated by binding to a polyA column. Following a subsequent ligation with adapters, samples were sequenced on a 454 pyrosequencing system. The results were incorporated into a sequence database that allowed stand-alone BLAST searches to be conducted.

Precursor prediction and secondary structure analysis

Based on the feature of the stem-loop structure, a command line BLAST was performed to align each unique miRNA sequence with the sequences of the transcriptomic database, aligning forward and reverse strands separately by setting the parameter –S (1 for forward, 2 for reverse alignment). The conjunct contigs were selected from a combination of the aligned contigs of forward and reverse alignment results. Contigs that contained a coding sequence or more than 5 mismatches in the miRNA were excluded: miRNA* duplex. The selected contig sequences were filtered by secondary structure analysis. Sequences were submitted to the RNAfold web server (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi) [20]. Contigs with correct stem-loop structure able to form a miRNA: miRNA* duplex were selected as putative miRNA precursors. The minimum free energy (MFE) was calculated using the stem-loop sequence producing the mature miRNA.

Prediction of miRNA targets in Phalaenopsis aphrodite subsp. Formosana

Most plant miRNAs bind perfectly or nearly perfectly to complementary sites on their target genes. Several bioinformatic programs have been designed on the basis of this characteristic. To identify potential miRNA target genes in Phalaenopsis aphrodite subsp. formosana, the custom sequencing data were submitted to the psRNATarget web server (http://bioinfo3.noble.org/psRNATarget/) [42]. psRNATarget uses an iterative parallel Smith-Waterman-based algorithm. Default settings were used as analytic parameters, i.e. 3 as the threshold of maximum expectation, 2 as the number of the multiplicity of target sites, and 9 to 11 nt as the range of the central mismatched region. Outputs were generated into a MySQL database for web-based searching (provided as web source). smRNA biosynthesis pathway components were identified using the known protein sequences from Arabidopsis to perform tBlastn against the Phalaenopsis transcriptomic database (Table S1).

Expression analysis of miRNA families

For detecting the expression of miRNA, 30 µg of total RNA was separated by 15% PAGE and transferred to a Hybond Nx membrane (GE Healthcare). The RNA was cross-linked to the membrane using carbodiimide [34]. End-labeled antisense DNA probes were prepared by adding biotin-dUTP to the 3′ ends of specific probes with TdT transferase (Genemark). A chemiluminescent nucleic acid detection module (Pierce) was used for visualization.

Mapping of target gene cleavage sites and expression analysis of target genes expression by quantitative polymerase chain reaction (Q-PCR)

To map the cleavage sites in PaSPL and PaAP2 mRNA, total RNAs were extracted from leaves, flower buds and flowers. The 5′-end of the cleavage product was determined by a modified 5′-RACE [43] using the RLM-RACE GeneRacer™ kit (Invitrogen, Carlsbad, CA, USA). The amplification conditions accorded with the manufacturer's instructions. The 5′-end of cDNA specific to the cleaved PaSPL and PaAP2 mRNA was amplified with the GeneRacer™ 5′ Primer, gene specific primers PaSPL 5′ RACE (5′-TCAGGCCTTGAACCCCAGAAAGTGCCCA-3′), PaAP2 5′ I (5′-CACCCTCCCCACCTTAGAACAGAATGTTTGC-3′), and PaAP2 5′ II (5′-CTGAGAGGATAGAGGCGCTGTCATTTCTCT-3′). Quantitative RT-PCR was performed using the SYBR green method and the ABI 7300HT real-time PCR system (Applied Biosystems). PaSPL-specific primers, 5′-GCACCACTGCTGAGGTCCTTAATCA-3′ (forward) and 5′-GGCGATGATCATATGGCTCTGTCC-3′ (reverse), PaAP2-specific primers, 5′-CATCTGTCATTGGGGATCGACGG-3′ (forward) and 5′-CCCCTTCTCTTTTGCAGCCAATTG-3′ (reverse), and 18s rRNA-specific primers 5′-CAGGCCCGGGTAATCTTGGG-3′ (forward) and 5′-CTTCACCGGACCATTCAATCGG-3′ (reverse). All primers of miRNA target genes were designed on the basis of the sequence of contigs. The 18S rRNA expression level was used as a quantitative control. List of smRNA biosynthesis pathway components identified in Phalaenopsis orchid. (DOC) Click here for additional data file. Summary table of target genes with contigs and functional categorization. (XLS) Click here for additional data file. Comparison of conserved miRNA families in plant species. (XLS) Click here for additional data file. Low temperature-responsive miRNA families in various plant species. (DOC) Click here for additional data file. Characteristics of undefined low ambient temperature-responsive small RNAs. (XLS) Click here for additional data file.
  43 in total

1.  Specific effects of microRNAs on the plant transcriptome.

Authors:  Rebecca Schwab; Javier F Palatnik; Markus Riester; Carla Schommer; Markus Schmid; Detlef Weigel
Journal:  Dev Cell       Date:  2005-04       Impact factor: 12.270

2.  Conservation and divergence of plant microRNA genes.

Authors:  Baohong Zhang; Xiaoping Pan; Charles H Cannon; George P Cobb; Todd A Anderson
Journal:  Plant J       Date:  2006-04       Impact factor: 6.417

3.  Temperature during the day, but not during the night, controls flowering of Phalaenopsis orchids.

Authors:  Matthew G Blanchard; Erik S Runkle
Journal:  J Exp Bot       Date:  2006-10-30       Impact factor: 6.992

4.  Repression of flowering in Arabidopsis requires activation of FLOWERING LOCUS C expression by the histone variant H2A.Z.

Authors:  Roger B Deal; Christopher N Topp; Elizabeth C McKinney; Richard B Meagher
Journal:  Plant Cell       Date:  2007-01-12       Impact factor: 11.277

5.  The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla.

Authors:  Olivier Jaillon; Jean-Marc Aury; Benjamin Noel; Alberto Policriti; Christian Clepet; Alberto Casagrande; Nathalie Choisne; Sébastien Aubourg; Nicola Vitulo; Claire Jubin; Alessandro Vezzi; Fabrice Legeai; Philippe Hugueney; Corinne Dasilva; David Horner; Erica Mica; Delphine Jublot; Julie Poulain; Clémence Bruyère; Alain Billault; Béatrice Segurens; Michel Gouyvenoux; Edgardo Ugarte; Federica Cattonaro; Véronique Anthouard; Virginie Vico; Cristian Del Fabbro; Michaël Alaux; Gabriele Di Gaspero; Vincent Dumas; Nicoletta Felice; Sophie Paillard; Irena Juman; Marco Moroldo; Simone Scalabrin; Aurélie Canaguier; Isabelle Le Clainche; Giorgio Malacrida; Eléonore Durand; Graziano Pesole; Valérie Laucou; Philippe Chatelet; Didier Merdinoglu; Massimo Delledonne; Mario Pezzotti; Alain Lecharny; Claude Scarpelli; François Artiguenave; M Enrico Pè; Giorgio Valle; Michele Morgante; Michel Caboche; Anne-Françoise Adam-Blondon; Jean Weissenbach; Francis Quétier; Patrick Wincker
Journal:  Nature       Date:  2007-08-26       Impact factor: 49.962

6.  Identification of cold-inducible microRNAs in plants by transcriptome analysis.

Authors:  Xuefeng Zhou; Guandong Wang; Keita Sutoh; Jian-Kang Zhu; Weixiong Zhang
Journal:  Biochim Biophys Acta       Date:  2008-04-18

7.  Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice.

Authors:  Bin Liu; Pingchuan Li; Xin Li; Chunyan Liu; Shouyun Cao; Chengcai Chu; Xiaofeng Cao
Journal:  Plant Physiol       Date:  2005-08-26       Impact factor: 8.340

8.  Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance.

Authors:  Ramanjulu Sunkar; Avnish Kapoor; Jian-Kang Zhu
Journal:  Plant Cell       Date:  2006-07-21       Impact factor: 11.277

9.  Regulation of phosphate homeostasis by MicroRNA in Arabidopsis.

Authors:  Tzyy-Jen Chiou; Kyaw Aung; Shu-I Lin; Chia-Chune Wu; Su-Fen Chiang; Chun-Lin Su
Journal:  Plant Cell       Date:  2005-12-30       Impact factor: 11.277

10.  GenBank.

Authors:  Dennis A Benson; Ilene Karsch-Mizrachi; David J Lipman; James Ostell; David L Wheeler
Journal:  Nucleic Acids Res       Date:  2007-01       Impact factor: 16.971

View more
  34 in total

1.  New wheat microRNA using whole-genome sequence.

Authors:  Kuaybe Yucebilgili Kurtoglu; Melda Kantar; Hikmet Budak
Journal:  Funct Integr Genomics       Date:  2014-01-07       Impact factor: 3.410

2.  Uncovering small RNA-mediated responses to cold stress in a wheat thermosensitive genic male-sterile line by deep sequencing.

Authors:  Zhonghui Tang; Liping Zhang; Chenguang Xu; Shaohua Yuan; Fengting Zhang; Yonglian Zheng; Changping Zhao
Journal:  Plant Physiol       Date:  2012-04-16       Impact factor: 8.340

3.  Genetic Architecture of Natural Variation in Thermal Responses of Arabidopsis.

Authors:  Eduardo Sanchez-Bermejo; Wangsheng Zhu; Celine Tasset; Hannes Eimer; Sridevi Sureshkumar; Rupali Singh; Vignesh Sundaramoorthi; Luana Colling; Sureshkumar Balasubramanian
Journal:  Plant Physiol       Date:  2015-07-20       Impact factor: 8.340

4.  Constitutive Expression of Rice MicroRNA528 Alters Plant Development and Enhances Tolerance to Salinity Stress and Nitrogen Starvation in Creeping Bentgrass.

Authors:  Shuangrong Yuan; Zhigang Li; Dayong Li; Ning Yuan; Qian Hu; Hong Luo
Journal:  Plant Physiol       Date:  2015-07-29       Impact factor: 8.340

5.  Identification and profiling of novel and conserved microRNAs during the flower opening process in Prunus mume via deep sequencing.

Authors:  Tao Wang; Huitang Pan; Jia Wang; Weiru Yang; Tangren Cheng; Qixiang Zhang
Journal:  Mol Genet Genomics       Date:  2013-12-17       Impact factor: 3.291

6.  Catalog of Erycina pusilla miRNA and categorization of reproductive phase-related miRNAs and their target gene families.

Authors:  Choun-Sea Lin; Jeremy J W Chen; Yao-Ting Huang; Chen-Tran Hsu; Hsiang-Chia Lu; Ming-Lun Chou; Li-Chi Chen; Chia-I Ou; Der-Chih Liao; Ysuan-Yu Yeh; Song-Bing Chang; Su-Chen Shen; Fu-Huei Wu; Ming-Che Shih; Ming-Tsair Chan
Journal:  Plant Mol Biol       Date:  2013-04-11       Impact factor: 4.076

Review 7.  Flowering time runs hot and cold.

Authors:  Jill C Preston; Siri Fjellheim
Journal:  Plant Physiol       Date:  2022-08-29       Impact factor: 8.005

8.  High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot.

Authors:  Zhihong Gao; Ting Shi; Xiaoyan Luo; Zhen Zhang; Weibing Zhuang; Liangju Wang
Journal:  BMC Genomics       Date:  2012-08-03       Impact factor: 3.969

9.  PASmiR: a literature-curated database for miRNA molecular regulation in plant response to abiotic stress.

Authors:  Shihua Zhang; Yi Yue; Liang Sheng; Yunzhi Wu; Guohua Fan; Ao Li; Xiaoyi Hu; Mingzhu Shangguan; Chaoling Wei
Journal:  BMC Plant Biol       Date:  2013-03-01       Impact factor: 4.215

10.  Genome-wide identification of miRNAs responsive to drought in peach (Prunus persica) by high-throughput deep sequencing.

Authors:  Vahap Eldem; Ufuk Çelikkol Akçay; Esma Ozhuner; Yakup Bakır; Serkan Uranbey; Turgay Unver
Journal:  PLoS One       Date:  2012-12-05       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.