BACKGROUND: Voltage-gated sodium channel Nav1.7 is preferentially expressed in dorsal root ganglion (DRG) and sympathetic neurons within the peripheral nervous system. Homozygous or compound heterozygous loss-of-function mutations in SCN9A, the gene which encodes Nav1.7, cause congenital insensitivity to pain (CIP) accompanied by anosmia. Global knock-out of Nav1.7 in mice is neonatal lethal reportedly from starvation, suggesting anosmia. These findings led us to hypothesize that Nav1.7 is the main sodium channel in the peripheral olfactory sensory neurons (OSN, also known as olfactory receptor neurons). METHODS: We used multiplex PCR-restriction enzyme polymorphism, in situ hybridization and immunohistochemistry to determine the identity of sodium channels in rodent OSNs. RESULTS: We show here that Nav1.7 is the predominant sodium channel transcript, with low abundance of other sodium channel transcripts, in olfactory epithelium from rat and mouse. Our in situ hybridization data show that Nav1.7 transcripts are present in rat OSNs. Immunostaining of Nav1.7 and Nav1.6 channels in rat shows a complementary accumulation pattern with Nav1.7 in peripheral presynaptic OSN axons, and Nav1.6 primarily in postsynaptic cells and their dendrites in the glomeruli of the olfactory bulb within the central nervous system. CONCLUSIONS: Our data show that Nav1.7 is the dominant sodium channel in rat and mouse OSN, and may explain anosmia in Nav1.7 null mouse and patients with Nav1.7-related CIP.
BACKGROUND:Voltage-gated sodium channelNav1.7 is preferentially expressed in dorsal root ganglion (DRG) and sympathetic neurons within the peripheral nervous system. Homozygous or compound heterozygous loss-of-function mutations in SCN9A, the gene which encodes Nav1.7, cause congenital insensitivity to pain (CIP) accompanied by anosmia. Global knock-out of Nav1.7 in mice is neonatal lethal reportedly from starvation, suggesting anosmia. These findings led us to hypothesize that Nav1.7 is the main sodium channel in the peripheral olfactory sensory neurons (OSN, also known as olfactory receptor neurons). METHODS: We used multiplex PCR-restriction enzyme polymorphism, in situ hybridization and immunohistochemistry to determine the identity of sodium channels in rodent OSNs. RESULTS: We show here that Nav1.7 is the predominant sodium channel transcript, with low abundance of other sodium channel transcripts, in olfactory epithelium from rat and mouse. Our in situ hybridization data show that Nav1.7 transcripts are present in ratOSNs. Immunostaining of Nav1.7 and Nav1.6 channels in rat shows a complementary accumulation pattern with Nav1.7 in peripheral presynaptic OSN axons, and Nav1.6 primarily in postsynaptic cells and their dendrites in the glomeruli of the olfactory bulb within the central nervous system. CONCLUSIONS: Our data show that Nav1.7 is the dominant sodium channel in rat and mouse OSN, and may explain anosmia in Nav1.7 null mouse and patients with Nav1.7-related CIP.
Olfactory sensory neurons (OSN; also referred to as olfactory receptor neurons) are bipolar neurons adapted for peripheral odorant signal transduction and transmission centrally to the olfactory bulb. OSN peripheral terminals house a rich array of odorant receptors and a molecular amplification system which boosts receptor potentials produced by short-lived ligand-receptor binding, triggering action potentials that are transmitted centrally along unmyelinated axons which synapse on dendrites of mitral neurons in the well-organized glomeruli in the olfactory bulb within the CNS [1,2]. The voltage-dependent sodium channels that support the initiation and propagation of action potentials in OSN are known to be tetrodotoxin-sensitive (TTX-S) [3]. However, the molecular identity of the TTX-S channels that are expressed in OSN is not known.Sodium channel Nav1.7 has recently emerged as a major target in pain research [4]. This channel is preferentially expressed in peripheral neurons [5-7], and produces a fast-activating and -inactivating, slow-repriming, TTX-S current [8], with slow closed-state inactivation which permits a substantial inward current in response to small, slow depolarizations (ramp current) [9,10]. Nav1.7 channels are present in most small unmyelinated fibers within the sciatic nerve [11], and within free nerve endings in the skin [12] close to the predicted peripheral trigger zone. Recently, we have shown that ERK1/2 phosphorylation of the channel hyperpolarizes activation and fast-inactivation of Nav1.7 but without changing its current density [13]. The gating properties and subcellular localization suggest that Nav1.7 acts as a pre-synaptic threshold channel for firing action potentials which amplifies weak stimuli, for example generator and receptor potentials [14].Although Nav1.7 is being explored as a therapeutic target for pain, recent data support the involvement of Nav1.7 in olfactory signaling. Human studies have shown that homozygous or compound heterozygous loss-of-function mutations in SCN9A, the gene which encodes Nav1.7, cause congenital insensitivity to pain (CIP) [15-17], which is accompanied by anosmia [17-19]. Additionally, global knock-out of Nav1.7 in mice is neonatal lethal, reportedly due to lack of feeding [20], consistent with inability of newborn mice to smell mother's milk. We hypothesized that Nav1.7 plays a critical role in signal transmission along the olfactory sensory axis from the peripheral olfactory epithelia to the olfactory bulb [4]. We present here molecular and cellular evidence which support the conclusion that Nav1.7 is the dominant sodium channel in rodent OSN. Early results of this study have been presented in an abstract form at the 40th annual meeting of the Society for Neuroscience, 2010, program# 848.18.
Results
Nav1.7 transcripts are predominant in rat and mouse olfactory epithelium
RT-PCR
Multiplex RT-PCR followed by length polymorphism and restriction enzyme analyses [21-23] were used to investigate the expression of the nine members of Nav family of voltage-gated sodium channels [24] in adult rat and mouse olfactory epithelium. Figure 1A (Lane 1) shows amplification products (bands "a", "b" and "c") from rat olfactory epithelium which are consistent with the presence of a potential mixture of Nav1.1 (558 bp), Nav1.2 (561 bp) and Nav1.3 (561 bp) (band a), Nav1.5 (519 bp) (band b), Nav1.6 (507 bp), Nav1.7 (501 bp), Nav1.8 (480 bp), Nav1.9 (468 bp) and Nax (501 bp) (band c). Restriction enzyme analysis of the PCR amplicons (Lanes 2-11) demonstrates that transcripts of Nav1.7 are the predominant subtype, with the presence of low levels of transcripts for Nav1.2, Nav1.3, Nav1.5, Nav1.6, and the non-voltage-dependent atypical sodium channel Nax [25]; transcripts for Nav1.1, Nav1.4, Nav1.8 and Nav1.9 are not detected by the restriction enzyme analysis.
Figure 1
Restriction analysis of multiplex PCR amplicons of sodium channels from adult rat and mouse olfactory epithelium. (A) Lane M shows 100-bp ladder marker, and lane 1 contains amplicon from rat olfactory epithelium. Bands "a", "b" and "c" (best seen in Lane 8) are consistent with the presence of a potential mixture of sodium channels. Band "a": Nav1.1 (558 bp), Nav1.2 (561 bp) and Nav1.3 (561 bp), band "b": Nav1.5 (519 bp); band "c": Nav1.6 (507 bp), Nav1.7 (501 bp), Nav1.8 (480 bp), Nav1.9 (468 bp) and Nax (501 bp). Lanes 2-11 show results of cutting this DNA with EcoRV (Nav1.1), EcoNI (Nav1.2), AvaI (Nav1.3), NaeI (Nav1.4/Nax), AccI (Nav1.5/1.9), SphI (Nav1.6), BamHI (Nav1.7/1.8), AflII (Nav1.8), EcoRI (Nav1.9), and XbaI (Nax). (B) Lane M shows 100-bp ladder marker, and lane 1 contains amplicons from mouse olfactory epithelium. Bands "a" and "b" are consistent with the presence of a potential mixture of sodium channels. Band "a": Nav1.1 (558 bp), Nav1.2 (561 bp) and Nav1.3 (561 bp); band "b": Nav1.6 (510 bp), Nav1.7 (501 bp), Nav1.8 (480 bp), Nav1.9 (471 bp) and Nax (501 bp). Lanes 2-11 show the results of cutting this DNA with EcoRV (Nav1.1), EcoNI (Nav1.2), DraI (Nav1.3), PvuI (Nav1.4), AgeI (Nav1.5), SphI (Nav1.6), ScaI (Nav1.7), AhdI (Nav1.8), EcoRI (, Nav1.9) and AlwNI (Nax).
Restriction analysis of multiplex PCR amplicons of sodium channels from adult rat and mouse olfactory epithelium. (A) Lane M shows 100-bp ladder marker, and lane 1 contains amplicon from rat olfactory epithelium. Bands "a", "b" and "c" (best seen in Lane 8) are consistent with the presence of a potential mixture of sodium channels. Band "a": Nav1.1 (558 bp), Nav1.2 (561 bp) and Nav1.3 (561 bp), band "b": Nav1.5 (519 bp); band "c": Nav1.6 (507 bp), Nav1.7 (501 bp), Nav1.8 (480 bp), Nav1.9 (468 bp) and Nax (501 bp). Lanes 2-11 show results of cutting this DNA with EcoRV (Nav1.1), EcoNI (Nav1.2), AvaI (Nav1.3), NaeI (Nav1.4/Nax), AccI (Nav1.5/1.9), SphI (Nav1.6), BamHI (Nav1.7/1.8), AflII (Nav1.8), EcoRI (Nav1.9), and XbaI (Nax). (B) Lane M shows 100-bp ladder marker, and lane 1 contains amplicons from mouse olfactory epithelium. Bands "a" and "b" are consistent with the presence of a potential mixture of sodium channels. Band "a": Nav1.1 (558 bp), Nav1.2 (561 bp) and Nav1.3 (561 bp); band "b": Nav1.6 (510 bp), Nav1.7 (501 bp), Nav1.8 (480 bp), Nav1.9 (471 bp) and Nax (501 bp). Lanes 2-11 show the results of cutting this DNA with EcoRV (Nav1.1), EcoNI (Nav1.2), DraI (Nav1.3), PvuI (Nav1.4), AgeI (Nav1.5), SphI (Nav1.6), ScaI (Nav1.7), AhdI (Nav1.8), EcoRI (, Nav1.9) and AlwNI (Nax).Figure 1B (Lane 1) shows amplification products (bands "a", and "b") from mouse olfactory epithelium which are consistent with the presence of a potential mixture of Nav1.1 (558 bp), Nav1.2 (561 bp) and Nav1.3 (561 bp) (band a), Nav1.6 (510 bp), Nav1.7 (501 bp), Nav1.8 (480 bp), Nav1.9 (471 bp) and Nax (501 bp) (band b); note small difference in length of amplicons for Nav1.6 and Nav1.9 due to an additional amino acid residue in this region of the mouse channels compared to their rat counterpart. Restriction enzyme analysis of the amplicons demonstrates that transcripts of Nav1.7 are the predominant subtype, similar to rat olfactory epithelium (A), with the presence of low levels of transcripts for Nav1.3, Nav1.6 and Nax; transcripts for Nav1.1, Nav1.2, Nav1.4, Nav1.5, Nav1.8 and Nav1.9 are not detected.We used Nav1.7-specific primers to amplify the cDNA of this channel from mouse olfactory epithelial and DRG templates (Table 1). Amplicons were cloned and the identity of the inserts was determined by sequencing. The sequence of the cDNA amplicons confirmed the presence of identical Nav1.7 species in the OSN and DRG cDNA templates. Sequencing of clones carrying amplicons which span the two independent alternative splicing events [26], show mutual exclusive splicing of exon 5 isoforms, neonatal (E5N) and adult (E5A), and the alternative 3' splice site selection of exon 11 (E11), leading to the long (E11L) and short (E11S) isoforms, in both DRG and OSN templates. The amino acid sequence of the OSN and DRG Nav1.7 cDNAs were identical to previously reported sequences in the GenBank database (accession numbers: BC172147 and BC158048) and match the predicted sequence from the mouseScn9a gene. However, we did not detect the Nav1.7 cDNA with alternative splice sites in exons 6 and 9 (accession number: NM_018852) which changes the identity of 14 and 15 amino acids in these exons, respectively.
Table 1
Nav1.7-specific primers used to amplify cDNA from mouse OSN and DRG templates.
Primer
Coordinates (accession # BC172147)
Sequence
A Forward
203-221
CTTAGGTAAAGATCCGAAG
A reverse
1374-1353
TGCCAGCAGCACGCAGAGTCTG
B Forward
1267-1289
GCTACACAAGCTTTGACACGTTC
B reverse
2748-2727
GCAGGACTGATAATCCTTCCAC
C Forward
2616-2639
ATGGTACTGAAGTTAATAGCCATG
C Reverse
3744-3722
CTTGGCAGCATGGAAATCTCCGC
D Forward
3613-3636
GTTCTTCAGAGTGCAGCACAGTTG
D reverse
4921-4899
CCAGTGAACAGGATGATGAAGAC
E Forward
4759-4780
GATGCATATTTGACTTAGTGAC
E Reverse
5435-5413
TCCACAGTCCCCTTCCACTGAAC
F Forward
5342-5369
GGATGGACTGCTGGCCCCCATCCTCAAC
F reverse
6264-6243
GTCTTATTAACACGAGTGAGTC
Nav1.7-specific primers used to amplify cDNA from mouse OSN and DRG templates.
In situ hybridization
Since RT-PCR analysis indicated that Nav1.7 is the predominant sodium channel isoform within olfactory sensory epithelium, we utilized in situ hybridization to determine the cellular distribution of Nav1.7 transcripts. As shown in Figure 2, in situ hybridization signal was displayed in the region of olfactory epithelium occupied by nuclei of olfactory sensory neurons and not in the area of the nuclei of sustentacular cells. Nav1.7 signal was not detected within sub-epithelial regions and Bowman's glands. At higher magnification (Figure 2 inset), in situ hybridization signal was localized in juxta-nuclear cytoplasm of olfactory sensory neurons (nuclei labeled with DAPI occupy most of the cellular space).
Figure 2
Na1.7 mRNA expression in olfactory epithelium using . In situ hybridization signal is exhibited by olfactory sensory neurons (OSN) in the olfactory epithelium. Sustentacular cells (SC) do not express Nav1.7 mRNA signal above background levels. Inset: Increased magnification demonstrates Nav1.7 in situ hybridization signal in the peri-nuclear cytoplasm of OSN. The cell boundaries of two OSN that exhibit robust Nav1.7 signal are demarcated by dotted lines; the DAPI-labeled nuclei of these cells are indicated by arrows.
Na1.7 mRNA expression in olfactory epithelium using . In situ hybridization signal is exhibited by olfactory sensory neurons (OSN) in the olfactory epithelium. Sustentacular cells (SC) do not express Nav1.7 mRNA signal above background levels. Inset: Increased magnification demonstrates Nav1.7 in situ hybridization signal in the peri-nuclear cytoplasm of OSN. The cell boundaries of two OSN that exhibit robust Nav1.7 signal are demarcated by dotted lines; the DAPI-labeled nuclei of these cells are indicated by arrows.
Nav1.7 protein in rat olfactory receptor neurons
We examined the distribution within olfactory epithelium of sodium channel proteins Nav1.1, Nav1.2, Nav1.6 and Nav1.7 channels which have been detected by the RT-PCR assay and for which robust isoform-specific antibodies are available. As shown in Figure 3, sodium channels Nav1.1, Nav1.2 and Nav1.6 were not detected within OSN or the subjacent nerve within the olfactory epithelium (Figure 3). In contrast, Nav1.7 signal was detected within OSN and branches of the olfactory nerve exhibited robust Nav1.7 immunolabeling (Figure 3). At higher magnification (Figure 3 insets), Nav1.7 immunoreactivity is clearly present within mature OSN which express olfactory mature protein (OMP+) in the olfactory epithelium
Figure 3
Sodium channel protein expression in rat olfactory epithelium. Immunostaining experiments using antibodies specific for sodium channels Nav1.1, Nav1.2 and Nav1.6 show that these channels are not detected within olfactory epithelium or in the subjacent olfactory nerve branches (arrows). In contrast, Nav1.7 immunolabeling is displayed in the olfactory epithelium and is robustly expressed within branches of the olfactory nerve (arrows). Insets: At increased magnification, Nav1.7 immunoreactivity (green) is displayed by OMP-positive OSN.
Sodium channel protein expression in rat olfactory epithelium. Immunostaining experiments using antibodies specific for sodium channels Nav1.1, Nav1.2 and Nav1.6 show that these channels are not detected within olfactory epithelium or in the subjacent olfactory nerve branches (arrows). In contrast, Nav1.7 immunolabeling is displayed in the olfactory epithelium and is robustly expressed within branches of the olfactory nerve (arrows). Insets: At increased magnification, Nav1.7 immunoreactivity (green) is displayed by OMP-positive OSN.
Nav1.7 protein in rat olfactory bulb
The slender (0.1-0.3 mm diameter) axons of OSN traverse from the olfactory epithelium to the surface of the olfactory bulb (olfactory nerve layer) and then penetrate the bulb to synapse with dendrites of mitral cells within glomeruli (see [27]). Sections of olfactory bulb reacted with antibodies specific to Nav1.7 and peripherin, a marker of unmyelinated fibers [28], exhibit robust co-localization of Nav1.7 and peripherin within the olfactory nerve layer (Figure 4). Notably, Nav1.7 immunolabeling is not detected within the mitral cell layer of the olfactory bulb. In contrast to the labeling pattern of Nav1.7, olfactory bulb sections probed with Nav1.6 antibodies exhibit a general paucity of Nav1.6 labeling within the olfactory nerve layer, while there is robust Nav1.6 immunoreactivity within the glomerular layer of the olfactory bulb (Figure 4).
Figure 4
Sodium channels Na1.6 and Na1.7 expression in olfactory nerve layer of rat olfactory bulb. Immunolabeling experiments show that sodium channel Nav1.7 (red) is co-localized (yellow) with peripherin (green) in fibers of the olfactory nerve layer (ONL). In contrast, only limited Nav1.6 immunoreactivity is displayed within the olfactory nerve layer, with robust labeling of the glomeuli (GL).
Sodium channels Na1.6 and Na1.7 expression in olfactory nerve layer of rat olfactory bulb. Immunolabeling experiments show that sodium channel Nav1.7 (red) is co-localized (yellow) with peripherin (green) in fibers of the olfactory nerve layer (ONL). In contrast, only limited Nav1.6 immunoreactivity is displayed within the olfactory nerve layer, with robust labeling of the glomeuli (GL).The differential and complementary pattern of Nav1.7 versus Nav1.6 immunolabeling in the olfactory bulb is readily apparent in sections reacted with sodium channel antibodies and the synaptic marker synaptophysin (Figure 5). Robust Nav1.7 immunolabeling is displayed within the olfactory nerve layer, but limited Nav1.7 immunoreactivity is detected within glomeruli. In contrast, the expression of Nav1.6 is nearly the inverse of that displayed by Nav1.7, with a paucity of Nav1.6 immunolabeling within axons of the olfactory nerve layer and robust immunoreactivity within glomeruli (Figure 5). Imaging the glomeruli at higher magnification (Figure 6), shows that, within the glomeruli, Nav1.7 is present in discrete punctate structures around 1 μm in diameter suggesting the presence in OSN axons. The lack of co-localization with synaptophysin in the glomeruli suggests that the density of Nav1.7 within synaptic boutons is below levels of detection or that this channel is totally absent from these boutons. In contrast, Nav1.6 is present in larger foci, occasionally overlapping with synaptophysin but more commonly not overlapping, consistent with the presence of Nav1.6 in post-synaptic dendrites and/or astrocytic processes where Nav1.6 has been detected [29].
Figure 5
Sodium channels Na1.6 and Na1.7 expression in rat glomerular layer of olfactory bulb. Immunolabeling experiments show that the synaptophysin-positive (green) glomeruli of the olfactory bulb exhibit extremely limited Nav1.7 (red) immunoreactivity. In contrast, Nav1.6 (red) exhibits robust immunoreactivity within the synptophysin-positive (green) glomeruli of the olfactory bulb.
Figure 6
Sodium channels Na1.6 and Na1.7 expression in terminal boutons of rat glomerular layer of olfactory bulb. Nav1.7 (red) immunoreactivity within the olfactory bulb glomerulus is punctate and extremely limited, and only occasional co-localization of Nav1.7 with synaptophysin-positive (green) terminal boutons is observed. In contrast, there is robust Nav1.6 (red) immunoreactivity within the glomerulus, although there is limited co-localization with synaptophysin-positive (green) terminal boutons within the glomerulus of the olfactory bulb.
Sodium channels Na1.6 and Na1.7 expression in rat glomerular layer of olfactory bulb. Immunolabeling experiments show that the synaptophysin-positive (green) glomeruli of the olfactory bulb exhibit extremely limited Nav1.7 (red) immunoreactivity. In contrast, Nav1.6 (red) exhibits robust immunoreactivity within the synptophysin-positive (green) glomeruli of the olfactory bulb.Sodium channels Na1.6 and Na1.7 expression in terminal boutons of rat glomerular layer of olfactory bulb. Nav1.7 (red) immunoreactivity within the olfactory bulb glomerulus is punctate and extremely limited, and only occasional co-localization of Nav1.7 with synaptophysin-positive (green) terminal boutons is observed. In contrast, there is robust Nav1.6 (red) immunoreactivity within the glomerulus, although there is limited co-localization with synaptophysin-positive (green) terminal boutons within the glomerulus of the olfactory bulb.The complementary distribution of Nav1.7 in OSN and mitral neurons within the glomeruli is supported by co-localization studies with MAP2, a marker of dendrites. Figure 7 shows a lack of co-localization of Nav1.7 and MAP2, consistent with the restriction of this channel to pre-synaptic OSN structures. In contrast, Figure 7 shows a significant co-localization of Nav1.6 and MAP2, consistent with its expression in mitral and other post-synaptic neurons in the olfactory bulb.
Figure 7
Sodium channel expression within glomerulus dendrites in rat olfactory bulb. MAP2-positive (blue) dendrites do not exhibit detectable Nav1.7 (green) immunoreactivity. In contrast, Nav1.6 immunolabeling is displayed within most MAP2-positive dendrites (co-localization is cyan).
Sodium channel expression within glomerulus dendrites in rat olfactory bulb. MAP2-positive (blue) dendrites do not exhibit detectable Nav1.7 (green) immunoreactivity. In contrast, Nav1.6 immunolabeling is displayed within most MAP2-positive dendrites (co-localization is cyan).
Activation and steady-state fast-inactivation of sodium currents in mouse OSNs
RatOSNs have been reported to express TTX-sensitive sodium currents [3]. We recorded inward sodium currents in adult mouseOSNs (8-13 μm diameter) using the whole-cell voltage-clamp method (Figure 8). To characterize the activation kinetics, sodium currents in acutely isolated OSNs (average peak amplitude of 1.7 ± 0. 2 nA, n = 17) were elicited by 100 ms depolarizing pulses from -90 mV to +50 mV in 5 mV increments from a holding potential of -100 mV (Figure 8A). As shown in the normalized current-voltage relationship (Figure 8B), sodium currents in OSN were activated at potentials positive to -70 mV and reached a peak near -25 mV, with a reversal potential of 63.1 ± 1.1 mV (n = 17). The rapidly inactivating inward sodium current was evoked by a step voltage to -20 mV from a holding potential of -100 mV and was completely blocked by 300 nM TTX (Figure 8C). The voltage midpoint (V1/2 = -40.9 ± 1.2 mV, n = 17) and slope factor (k = 7.1 ± 0.5 mV) of activation were obtained from a Boltzmann fit of normalized conductance (Figure 8D). The activation voltage-dependence for sodium currents in OSNs (V1/2 = - 40.9 mV) is more hyperpolarized than that (V1/2 range: -16 to -29 mV) for Nav1.7 currents in HEK293 cells [9,30-40].
Figure 8
Voltage-dependent activation and fast-inactivation for sodium currents in mouse OSN. (A), sodium currents were evoked by 100 ms depolarizing pulses from -90 mV to +50 mV in steps of 5 mV every 5 s from a holding potential of -100 mV. (B), Normalized peak current-voltage relationship. (C), The inward current was completely blocked by 300 nM TTX. (D), Voltage dependence of activation and steady-state fast-inactivation. To measure steady-state fast-inactivation, sodium currents were elicited by 500 ms prepulses from -160 mV to -20 mV stepped by 10 mV and followed by a 40 ms depolarizing pulse to -20 mV from a holding potential of -100 mV. The activation and fast-inactivation curves were obtained from a Boltzmann fit to the normalized conductance.
Voltage-dependent activation and fast-inactivation for sodium currents in mouse OSN. (A), sodium currents were evoked by 100 ms depolarizing pulses from -90 mV to +50 mV in steps of 5 mV every 5 s from a holding potential of -100 mV. (B), Normalized peak current-voltage relationship. (C), The inward current was completely blocked by 300 nM TTX. (D), Voltage dependence of activation and steady-state fast-inactivation. To measure steady-state fast-inactivation, sodium currents were elicited by 500 ms prepulses from -160 mV to -20 mV stepped by 10 mV and followed by a 40 ms depolarizing pulse to -20 mV from a holding potential of -100 mV. The activation and fast-inactivation curves were obtained from a Boltzmann fit to the normalized conductance.To examine the voltage-dependence of steady-state fast-inactivation, OSNs were held at -100 mV and the sodium currents were induced by a double pulse protocol of 500 ms prepulses from -160 mV to -20 mV in 10 mV increments, followed by a 40 ms depolarizing pulse to -20 mV to measure the fraction of available channels. The fast-inactivation curve was obtained from a Boltzmann fit to the normalized current (Figure 8D). The voltage midpoint (V1/2) and slope factor (k) of steady-state fast-inactivation were -96.4 ± 2.1 mV and 8.9 ± 0.5 mV (n = 17). Similar to activation properties, the steady-state fast-inactivation for sodium currents in OSNs is also more hyperpolarized than that (V1/2 range: -71 to -83 mV) for Nav1.7 currents in HEK293 cells [9,30-40].
Discussion
We show here that Nav1.7 is the predominant transcript in adult rat and mouse olfactory epithelium, with low abundance of Nav1.6 transcripts. Immunostaining of olfactory epithelium and the olfactory nerve show that Nav1.7 is the main sodium channel which accumulates in the thin unmyelinated fibers, with undetectable Nav1.6 immunolabeling. Co-immunostaining with the synaptic marker synaptophysin reveals a complementary distribution of Nav1.7 and Nav1.6 channels, with accumulation of Nav1.7 in presynaptic axons, and Nav1.6 in processes of mitral and granule neurons within glomeruli of the olfactory bulb. The limited Nav1.7 immunoreactivity at the presynaptic axon termini within the glomeruli may possibly reflect the dispersion of axons and their small diameter, and the robust Nav1.6 immunostaining within the glomeruli reflects the abundant expression of this channel within processes of mitral and granule neurons. Weiss et al. [41] recently reported the presence of Nav1.7 within mouse and human OSN, and observed Nav1.7 immunoreactivity that extended from the cell bodies of mouse OSN to their axons within olfactory glomeruli. Their results, like ours, indicate that, while Nav1.7 is the major sodium channel within OSN, it is not detectable in the mitral and granule neurons that receive synaptic inputs from the OSN. Consistent with this conclusion, they report that there is no synaptic transmission of the electric impulse from OSN to the post-synaptic neurons in mice where Nav1.7 is knocked-out in mature OSN that express the olfactory marker protein. In the aggregate, these data support the conclusion that Nav1.7 is the predominant sodium channel responsible for peripheral odorant signaling to the olfactory bulb.Transient inward currents in rat and mouseOSNs are completely blocked by 100 nM TTX or by substitution of choline for external sodium, and action potentials are blocked by 100 nM TTX ([3,41,42] and this study), indicating that OSN excitability is dependent upon a TTX-Ssodium channel. Consistent with the electrophysiological data, our molecular and immunostaining data show that Nav1.7, a TTX-S channel, is the predominant sodium channel in OSNs and their unmyelinated axons. Low levels of other TTX-Ssodium transcripts could be amplified from olfactory epithelial cDNA templates (Figure 1A and 1B), but weak or no immunostaining for these channels was detectable in OSN and in axons within the olfactory nerve (Figure 3). While the cellular origin of sodium channel transcripts other than Nav1.7 is difficult to identify, one possibility is that low expression levels of these channels occurs in OSN, but the level of the channel protein is below the detection of our immunostaining assays. Alternatively, other cell types within the olfactory epithelium may express sodium channels other than Nav1.7. Irrespective of the source of these weakly-expressed channels, the vast abundance of Nav1.7 in the OSN points to a critical role of this channel in olfactory signal transmission, and that the presence of other sodium channels does not appear to be sufficient to rescue olfaction in humans and mice which lack Nav1.7.The ability of Nav1.7 to boost subthreshold stimuli, for example odorant-induced receptor potential depolarization of OSN membrane, is consistent with its role as a threshold channel for firing action potentials in neurons [14]. Single openings of the metabotropic odorant receptors have been shown to be sufficient to generate action potentials [43], although a recent study [44] has estimated that a single odorant binding event results in ~0.034 pA current while the threshold for action potential is ~1.2 pA. An elaborate Ca2+- and Cl--based signaling amplification system in the cilia has been reported to boost the odorant receptor potential for successful initiation of action potentials [1,2]. However, the abundant expression of Nav1.7 with its demonstrable ability to boost weak depolarizations, and weak expression of other sodium channels in rodent and human OSN ([41] and this study), supports the conclusion that Nav1.7 plays a central role in action potential transmission along the peripheral olfactory nerve axis.While the molecular and immunostaining data show dominant expression of Nav1.7 channels in rodent and human OSN ([41] and this study), whole-cell patch-clamp recordings of mouse OSN show a TTX-S current with hyperpolarized activation and inactivation; threshold for activation was near -70 mV with a peak around -25 mV and V1/2 of -41 mV (Figure 8). Data presented in Figure 3B by Weiss et al [41] are in agreement with hyperpolarized voltage dependence for activation (threshold and peak) in OSN. These data are consistent with a published report of V1/2 of -48 mV from isolated P5-P15 rat OSN [45]. The voltage-dependence of activation for sodium current in OSNs is more hyperpolarized than those for humanNav1.7 currents (V1/2 range: -16 to -29 mV) in HEK293 cells [9,30-40] or DRG neurons [10,46], or of TTX-S currents in native DRG neurons (-23 to -28 mV) [47-49]. Similarly, a wide range of V1/2 for steady-state inactivation of sodium current has been reported for ratOSNs: -96 mV for adult mouse (this study), -87 mV for P5-P15 rat [45], and -110 mV [50], -107 mV [51], and -105 mV [52] for adult ratOSNs. The wide range of reported V1/2 may arise from the use of neurons from neonatal, juvenile or adult rats, different recording buffers, time in culture and other technical issues. However, the V1/2 of -96 mV that we obtained is hyperpolarized compared to those (V1/2 range: -71 to -83 mV) reported for Nav1.7 current in HEK cells [9,30-40] or DRG neurons [10,46,53] or the TTX-S currents (-66 to -72 mV) in native DRG [47-49]. Since we report in this study that the sequence of the Nav1.7 cDNA is identical in mouse OSN and DRG templates, modulation of the Nav1.7 channels by post-translational modification and possible interaction with cell-specific channel partners, rather than a different Nav1.7 splicing isoform, is likely responsible for the altered gating properties of this channel in OSN versus DRG neuronal backgrounds.Using RT-PCR, we also observed (Figure 1A) Nav1.6 mRNA at low levels in mouse and rat olfactory epithelium (the only detectable sodium channel transcript other than Nav1.7 in mouse tissue), but found no detectable immunostaining signal in rat OSN or olfactory nerve axons, which suggest a limited contribution of this channel to peripheral olfactory signal transmission. Studies on Scn8amice which lack Nav1.6 channels support our view that Nav1.7 is essential for olfaction in mice. While global knock-out of Nav1.7 in mice is neonatal lethal [20], total loss of Nav1.6 in mice is juvenile lethal although these mice are indistinguishable from WT or heterozygote littermates in terms of feeding and open field behavior for the first 10-14 days after birth [54-56]. Neonatal lethality of Nav1.7 knock-out mouse has been linked to lack of feeding [20], while death of Nav1.6 knock-out mouse is linked to muscle degeneration [54-56]. These data are consistent with a minor role for Nav1.6 in OSN excitability and olfactory signal transmission, at least within the first two weeks after birth.Recent data have shown that Nav1.7, which is normally considered a threshold sodium channel [14], is critical to nerve signal transduction and transmission in two sensory neuronal pathways: nociception and olfaction. The predominant expression of Nav1.7 in OSN ([41] and this study), compared to other channels, provides a reasonable explanation for anosmia in human subjects [15,17-19] and mice [20] when this channel is not functional. Thus, Nav1.7 appears to be critically important for olfactory signaling by OSN. In contrast to OSN where Nav1.7 expression predominates, Nav1.7 is co-expressed with several other channels within DRG neurons which signal pain [4], and these channels are distributed to the peripheral free endings of the axons in the epidermis [12]. These observations, together with the profound loss of pain sensibility in CIP, point to a dominant role of Nav1.7 in pain-signaling, although the exact mechanism is not well understood. Intriguingly, Nav1.7 is present in sympathetic neurons and gain-of-function mutations that depolarize resting membrane potential cause hypoexcitability of these neurons [57]. However, Nav1.7-related CIPpatients do not report significant sympathetic dysfunction [15-18], thus it appears that Nav1.7 does not play an equally central role in signal transduction/transmission in sympathetic neurons. These data show that the contribution of Nav1.7 channels to neuronal activity appears to be neuronal-type dependent.
Conclusions
We present here molecular and immunolabeling data that demonstrate that Nav1.7 is the predominant sodium channel in OSN and along olfactory nerve fibers. Gain-of-function mutations of Nav1.7 cause hyperexcitability of DRG neurons, underlying pain symptoms in inherited erythromelalgia and PEPD; however, it has not been reported that patients with these disorders also manifest hyperosmia. In contrast, patients with Nav1.7-related CIP report anosmia, and the data presented in this study provide a molecular basis for anosmia in these patients. Nav1.7-specific blockers are being pursued as a highly targeted approach for the treatment of pain. Our data suggest that hyposmia or anosmia are potential side effects that need to be taken into consideration in the clinical application of these therapeutics.
Materials and methods
Animal care
Sprague-Dawley male rats (adult, 225-250 gm, Harlan, Indianapolis, IN) and C57BL/6 mice (adult, 25-30 gm, Harlan) were housed under a 12 hr light/dark cycle in a pathogen-free area with ad libitum access to water and food. The experimental procedures were approved by the VA Connecticut Healthcare System Institutional Animal Care and Use Committee, in accordance with NIH guidelines and conform to the guidelines of the Committee for Research and Ethical Issues of the IASP.
RNA extraction and cDNA synthesis
Rats and mice were deeply anaesthetized with CO2, decapitated, and olfactory epithelium was quickly removed and immediately frozen in liquid nitrogen. Total RNA was extracted using RNeasy mini kit (Qiagen, Valancia, CA) and RNA was eluted in 30-50 μl of H2O. First strand cDNA was reverse transcribed in a 20 μl reaction volume including 7 μl total RNA, 200 ng random primers and 200 U SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA), and 40 U RNase inhibitor (Roche Biosciences, Indianapolis, IN). The buffer consisted of: 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 5 mM DTT and 0.5 mM dNTP. The reaction proceeded at 25°C for 5 min, 50°C for 90 min and then terminated by heating to 70°C for 15 min. A parallel reaction was performed as a negative control by substituting sterile water for the reverse transcriptase enzyme (data not shown).
Multiplex PCR and Restriction endonuclease analysis
A multiplex PCR was used to amplify Nav channel transcripts (Nav1.1, Nav1.2, Nav1.3, Nav1.4, Nav1.5, Nav1.6, Nav1.7, Nav1.8, Nav1.9, and Nax) which may be present in the cDNA pool as previously described [21-23]. Primers were designed against highly conserved sequences in domain I of sodium channel α subunits. Sequences of the four forward and three reverse primers (F1-F4 and R1-R3) are as follows: F1 5'-AATCCCTGGAATTGGTTGGA-3', F2 5'-GACCCRTGGAACTGGCTGGA-3', F3 5'-GACCCGTGGAACTGGTTAGA-3', F4 5'-GATCTTTGGAACTGGCTTGA-3'; R1 5'-CAAGAAGGCCCAGCTGAAGGTGTC-3', R2 5'-GAGGAATGCCCACGCAAAGGAATC-3', R3 5'-AAGAAGGGACCAGCCAAAGTTGTC-3'. Amplification was performed in a 60 μl reaction volume using 4 μl first-strand cDNA, 1-3 μM of each primer and 5 U of Expand Long Template DNA polymerase enzyme mixtures (Roche). The PCR reaction buffer contained 2.75 mM MgCl2 and detergents. Amplification was carried out in two stages using a programmable thermal cycler (PTC-200, MJ Research, Cambridge, MA). First, a denaturation step at 94°C for 2 min, an annealing step at 57°C for 2 min and an elongation step at 68°C for 2 min. Second, a denaturation step at 94°C for 30 sec, an annealing step at 57°C for 45 sec and an elongation step at 68°C for 45 sec. The second stage was repeated 39 times for a total of 40 cycles, with the elongation step in the last cycle extended to 10 min. Control PCR reactions in which the template was substituted by H2O produced no amplification products (data not shown).The identity of the α-subunits expressed in rat or mouse olfactory epithelium were determined by a combination of length polymorphism and restriction endonuclease analysis of the PCR products. Typically 1/20th of the PCR products were digested for 1 hr at the recommended temperature and the products resolved by electrophoresis in a 2% agarose gel. Fragment sizes were determined by comparison to a standard 100-bp ladder molecular weight marker (Invitrogen). DNA was visualized by ethidium bromide fluorescence and the gel image was digitized by a Kodak Image Station 440 CF (Kodak, Rochester, NY).The Nav1.7 cDNA from mouse OSN and DRG templates were amplified using 6 primer pairs which amplified overlapping fragments (Table 1). Amplicons were purified using spin columns (Qiagen), and cloned into pGEM-Teasy vectors (Promega Inc.). The identity of the fragments was determined by sequencing of both strands at the W. Keck core facility of Yale School of Medicine. Sequence analysis was done using Lasergene and BLAST software.
In situ hybridization
Rats were deeply anesthetized with ketamine/xylazine (80/5 mg/kg, i.p.) and transcardially perfused with PBS and then ice-cold fixative solution containing 4% paraformaldehyde in 0.14 M Sorensen's phosphate buffer, pH 7.4. Olfactory epithelium was removed and fixed for an additional 2-4 hr in the fixative solution and then transferred to a 4% paraformaldehyde solution containing 30% sucrose overnight at 4°C. Twelve micron cryosections were cut and tissue processed for non-radioactive in situ hybridization detection of Nav1.7 mRNA as previously described [58]. Briefly, sections were deproteinized with proteinase K (10 μg/ml), acetylated with 0.25% acetic anhydride in 0.1 M triethanolamine, and incubated in pre-hybridization buffer (50% formamide, 5 × SSC, 5 × Denhardt's solution, 100 μg/ml salmon sperm DNA; Sigma, St. Louis, MO) for 1 hr at room temperature followed by hybridization buffer (50% formamide, 10% dextran sulfate, 5 × SSC, 1 × Denhardt's solution, 100 μg/ml salmon sperm DNA, Sigma) containing digoxigenin (DIG)-UTP-labeled Nav1.7 (1.0 ng/μl) riboprobes overnight at 58°C. The slides were then sequentially incubated in: (1) 4 × SSC, 5 min; (2) 2 × SSC, 2 × 10 min each; (3) RNase A solution (20 μg/ml; Sigma) in 10 mM Tris/500 mM NaCl/1 mM EDTA, pH 8.0, for 45 min at 37°C; (4) 2 × SSC, 2 × 10 min each; (5) 0.2 × SSC, 3 × 20 min each at 58°C; (6) 100 mM Tris/150 mM NaCl, pH 7.5, 1 min; (7) blocking solution, containing 100 mM Tris/150 mM NaCl/2% normal sheep serum/1% BSA, 30 min, (8) alkaline phosphatase-labeled anti-DIG antibody (1:500 in blocking solution; Roche) overnight at 4°C; (9) 100 mM Tris/150 mM NaCl, pH 7.5, 4 × 5 min each; (10) 100 mM Tris/100 mM NaCl/50 mM MgCl2, pH 9.5, 4 × 5 min each; (11) NBT/X-phos solution [384 μg/ml ρ-nitro-blue tetrazolium chloride (NBT) and 188 μg/ml 5-bromo-4-chloro-3-indolyl phosphate (X-phos) in 100 mM Tris/100 mM NaCl/50 mM MgCl2, pH 9.5]. The reaction was stopped by rinsing in 10 mM Tris/1 mM EDTA, pH 8.0. Sections were incubated with 300 nM 4', 6-diamidino-2-phenylindole (DAPI) to label olfactory sensory nuclei.
Immunocytochemistry
Rats were deeply anesthetized with ketamine/xylazine (80/5 mg/kg, i.p.) and transcardially perfused with 0.01 M PBS (pH 7.4) followed by ice-cold 4% paraformaldehyde in 0.14 M Sorensen's phosphate buffer (pH 7.4). The olfactory epithelium was removed, immersion-fixed for an additional 20 min (total fixation time 30 min) and cryoprotected with 30% (w/v) sucrose in PBS overnight at 4°C. Ten-μm thick cryosections were mounted on slides (Fisher, Pittsburgh, PA) and processed for detection of Nav1.7 protein as described previously [59]. In brief, sections were incubated in the following (1) blocking solution (PBS containing 5% cold water fish skin gelatin, 3% normal donkey serum, 2% BSA, 0.1% Triton X-100, and 0.02% sodium azide) for 15 min at room temperature; (2) primary antibody(ies) singly or in combination [mouse anti-Nav1.1 (1:100, Antibodies, Inc., Davis, CA); mouse anti-Nav1.2 (1:100, Antibodies, Inc.); rabbit anti-Nav1.6 (1:100, Sigma); rabbit anti-Nav1.7 (1:250, Y083 [60]); goat anti-olfactory mature protein (OMP) (1:200 Wako, Richmond, VA); mouse anti-peripherin (1:1000, Abcam), and mouse anti-synaptophysin (1:50, GeneTex, Irvine, CA)] in blocking solution overnight at 4°C; (3) PBS, 6 × 5 min each; (4) appropriate secondary antibodies in blocking solution for 6-8 hr at room temperature; (5) PBS, 6 × 5 min each.Sections of rat DRG and cerebellum were also reacted with the antibodies to serve as specificity controls. Figure 9 shows immunostaining pattern that is consistent with the known distribution of these channels in DRG and cerebellum [4,29]. We have previously shown that rabbit anti-Nav1.6 (1:100, Sigma) does not stain nodes of Ranvier from Scn8amice [61] which lack Nav1.6 channels [62]. Additional control experiments were performed without inclusion of primary antibodies, which yielded only background levels of fluorescence (data not shown). Tissue sections were examined with a Nikon C1 confocal microscope (Nikon USA, Melville, NY).
Figure 9
Sodium channel immunolabeling in rat cerebellum and DRG. Isoform-specific antibodies generated against sodium channels Nav1.1, Nav1.2, Nav1.6 and Nav1.7 were reacted with sections of adult rat cerebellum and DRG. Purkinje cell bodies and apical dendrites exhibit robust Nav1.1 immunolabeling, while limited Nav1.1 immunoreactivity is displayed in DRG neurons (inset). Parallel fibers of cerebellar granule cells exhibit substantial Nav1.2 labeling; Nav1.2 is not detectable in DRG neurons (inset). Nav1.6 is robustly expressed in Purkinje cell bodies and dendrites and is also localized within parallel fibers of cerebellar granule cells; Nav1.6 immunolabeling is exhibited by most neurons within DRG (inset). Within cerebellum, Nav1.7 immunostaining is not detectable, but Nav1.7 immunoreactivity is exhibited by many DRG neurons. The labeling patterns obtained with the isoform-specific sodium channel antibodies Nav1.1, Nav1.2, Nav1.6 and Nav1.7 utilized in these studies is consistent with previous descriptions of their localization within CNS and PNS tissue [4,29].
Sodium channel immunolabeling in rat cerebellum and DRG. Isoform-specific antibodies generated against sodium channels Nav1.1, Nav1.2, Nav1.6 and Nav1.7 were reacted with sections of adult rat cerebellum and DRG. Purkinje cell bodies and apical dendrites exhibit robust Nav1.1 immunolabeling, while limited Nav1.1 immunoreactivity is displayed in DRG neurons (inset). Parallel fibers of cerebellar granule cells exhibit substantial Nav1.2 labeling; Nav1.2 is not detectable in DRG neurons (inset). Nav1.6 is robustly expressed in Purkinje cell bodies and dendrites and is also localized within parallel fibers of cerebellar granule cells; Nav1.6 immunolabeling is exhibited by most neurons within DRG (inset). Within cerebellum, Nav1.7 immunostaining is not detectable, but Nav1.7 immunoreactivity is exhibited by many DRG neurons. The labeling patterns obtained with the isoform-specific sodium channel antibodies Nav1.1, Nav1.2, Nav1.6 and Nav1.7 utilized in these studies is consistent with previous descriptions of their localization within CNS and PNS tissue [4,29].
Voltage-clamp recordings from OSN cultured from adult mice
OSN cultures from adult C57BL/6 mice were done according to report by Sosnowski et al [63] with some modifications. In brief, mice were anesthetized with ketamine/xylazine (100/10 mg/kg, i.p.), decapitated, and olfactory tissue was dissected and immediately placed in ice-cold Ca2+/Mg2+-free HBSS. After freeing olfactory epithelium from other tissues, olfactory epithelium was rinsed in ice-cold Ca2+/Mg2+-free HBSS and minced to 1 mm pieces. Trypsin (0.125% in Ca2+/Mg2+-free HBSS) treatment was used to dissociate epithelial tissue at 35°C for 30 min with gentle agitation. Trypsin was inactivated by OSN medium (MEM containing 10% fetal bovine serum and antibiotics). Dispersed cells were mixed gently and centrifuged at 1200 × g for 2 min. The pellet was resuspended in 1 ml OSN medium with a fire-polished glass pipette and filtered through a 40-μm mesh. Approximately 50 μl of cell suspension was plated on a poly-D-lysine/laminin coated coverslip in 24-well plate (BD Biosciences). Cultures were placed in a humidified 35°C incubator receiving 5% CO2. One hour later, cells were fed with 450 μl of OSN medium with fresh NGF (50 ng/ml). Half the medium was replaced daily and supplied with NGF. Cultures were used for patch-clamp recording on the same day of culture.The whole-cell voltage-clamp recording was conducted at room temperature (21-23°C) using an Axopatch 200B amplifier (Molecular Devices, Union City, CA). The bath solution contained (in mM): 140 NaCl, 3 KCl, 1 CaCl2, 1 MgCl2, 10 glucose and 20 HEPES, pH 7.3 with NaOH (adjusted to 320 mOsm with sucrose), and the pipette solution contained (in mM): 140 CsF, 1 EGTA, 10 NaCl, 10 mM HEPES, pH 7.3 with CsOH (adjusted to 310 mOsm with sucrose). 20 mM TEA-Cl was included in the bath solution to block endogenous potassium current. Fire-polished electrodes were fabricated from capillary glass (PG10165-4, World Precision Instruments, Sarasota, FL) using a P-97 puller (Sutter Instrument Co., Novato, CA). The resistance of recording pipettes in the bath solution was 2-5 MΩ. Whole-cell capacitive currents were compensated with analog compensation and 60-80% series resistance compensation was applied to minimize voltage errors. The voltages were not corrected for liquid junction potential. The currents were filtered at 5 kHz, acquired at 100 kHz, and then digitized using pClamp 10 software and Digidata 1440A (Molecular Devices). The Origin 8.1 software (OriginLab Corporation, Northampton, MA) was used for data analysis. Data are presented as means ± S.E.
The authors declare that they have no competing interests.
Authors' contributions
HA acquired and analyzed electrophysiology data, established OSN cell culture, and participated in writing the manuscript. JAB designed immunocytochemical experiments, acquired and analyzed and interpreted data, and participated in writing the manuscript. PZ established OSN cultures, acquired and analyzed multiplex RT-PCR and immunohistochemical data. LT designed, acquired and analyzed molecular data to determine the identity of sodium channels in OSN and DRG. SCG and SDH conceived and coordinated the study and wrote and edited the manuscript. All authors read and approved the final manuscript.
Authors: Anthony M Rush; Sulayman D Dib-Hajj; Shujun Liu; Theodore R Cummins; Joel A Black; Stephen G Waxman Journal: Proc Natl Acad Sci U S A Date: 2006-05-15 Impact factor: 11.205
Authors: Hye-Sook Ahn; Sulayman D Dib-Hajj; James J Cox; Lynda Tyrrell; Frances V Elmslie; Antonia A Clarke; Joost P H Drenth; C Geoffrey Woods; Stephen G Waxman Journal: Eur J Pain Date: 2010-04-10 Impact factor: 3.931
Authors: T Patrick Harty; Sulayman D Dib-Hajj; Lynda Tyrrell; Rachael Blackman; Fuki M Hisama; John B Rose; Stephen G Waxman Journal: J Neurosci Date: 2006-11-29 Impact factor: 6.167
Authors: Y P Goldberg; J MacFarlane; M L MacDonald; J Thompson; M-P Dube; M Mattice; R Fraser; C Young; S Hossain; T Pape; B Payne; C Radomski; G Donaldson; E Ives; J Cox; H B Younghusband; R Green; A Duff; E Boltshauser; G A Grinspan; J H Dimon; B G Sibley; G Andria; E Toscano; J Kerdraon; D Bowsher; S N Pimstone; M E Samuels; R Sherrington; M R Hayden Journal: Clin Genet Date: 2007-04 Impact factor: 4.438
Authors: James J Cox; Frank Reimann; Adeline K Nicholas; Gemma Thornton; Emma Roberts; Kelly Springell; Gulshan Karbani; Hussain Jafri; Jovaria Mannan; Yasmin Raashid; Lihadh Al-Gazali; Henan Hamamy; Enza Maria Valente; Shaun Gorman; Richard Williams; Duncan P McHale; John N Wood; Fiona M Gribble; C Geoffrey Woods Journal: Nature Date: 2006-12-14 Impact factor: 49.962
Authors: Michael E Rothenberg; Michael Tagen; Jae H Chang; Janel Boyce-Rustay; Michel Friesenhahn; David H Hackos; Avis Hains; Dan Sutherlin; Michael Ward; William Cho Journal: Clin Drug Investig Date: 2019-09 Impact factor: 2.859
Authors: Christopher T Frenz; Anne Hansen; Nicholas D Dupuis; Nicole Shultz; Simon R Levinson; Thomas E Finger; Vincent E Dionne Journal: J Neurophysiol Date: 2014-05-28 Impact factor: 2.714
Authors: Yan Li; Robert Y North; Laurence D Rhines; Claudio Esteves Tatsui; Ganesh Rao; Denaya D Edwards; Ryan M Cassidy; Daniel S Harrison; Caj A Johansson; Hongmei Zhang; Patrick M Dougherty Journal: J Neurosci Date: 2017-12-18 Impact factor: 6.167
Authors: János A Perge; Jeremy E Niven; Enrico Mugnaini; Vijay Balasubramanian; Peter Sterling Journal: J Neurosci Date: 2012-01-11 Impact factor: 6.167
Authors: John V Mulcahy; Hassan Pajouhesh; Jacob T Beckley; Anton Delwig; J Du Bois; John C Hunter Journal: J Med Chem Date: 2019-05-07 Impact factor: 7.446