Literature DB >> 21552497

A recurrent mutation in CRYGD is associated with autosomal dominant congenital coralliform cataract in two unrelated Chinese families.

Guoxing Yang1, Chunlei Xiong, Shanlan Li, Yuanyuan Wang, Jialiang Zhao.   

Abstract

PURPOSE: Congenital cataract is a clinically and genetically heterogeneous lens disorder. The purpose of this study was to identify the mutation responsible for autosomal dominant congenital coralliform cataracts in two Chinese families and to investigate the relationship between virulence genes and lens morphology.
METHODS: Patients received a physical examination, and blood samples were collected for DNA extraction. Mutation analysis was performed by direct sequencing of the candidate genes: gammaC-crystallin (CRYGC), gammaD-crystallin (CRYGD), gammaS-crystallin (CRYGS), gap-junction protein, alpha 8 (GJA8), gap-junction protein, alpha 3 (GJA3), and alphaA-crystallin (CRYAA).
RESULTS: The affected individuals in two families had congenital coralliform cataracts. Mutational analysis of the CRYGD identified a C→A transversion at nucleotide position c.70 in exon 2, which resulted in a threonine substitution for proline at amino-acid residue 24 (P24T). This mutation was identified in all affected individuals but was not found in healthy relatives or 100 control chromosomes from the same ethnic background.
CONCLUSIONS: Our results indicated that the P24T mutation of CRYGD was responsible for two Chinese pedigrees with congenital coralliform cataracts. CRYGD and coralliform cataracts are highly related, and P24T may be a hot-point mutation for this disorder.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21552497      PMCID: PMC3086606     

Source DB:  PubMed          Journal:  Mol Vis        ISSN: 1090-0535            Impact factor:   2.367


Introduction

Congenital cataract is a significant cause of vision loss, resulting in approximately one third of all cases of blindness in infants. Congenital cataracts occur in approximately 1–6/10,000 of live births, and one quarter of congenital cataracts are hereditary [1-4]. Hereditary (i.e., Mendelian) cataracts are mostly inherited as autosomal dominant forms, but X-linked and autosomal recessive forms are also observed. Congenital cataracts are a clinically and genetically heterogeneous lens disorder. Phenotypically identical cataracts can result from mutations at different genetic loci and can have different inheritance patterns. While in the same genetic locus or a single large family, phenotypically different cataract types can also be found. To date, about forty genetic loci have been linked to congenital cataracts, and 26 genes have been cloned [5], including crystallins, connexins, heat shock transcription factor-4, aquaporin-0, and beaded filament structural protein-2. The types of mutations and the morphology of the cataracts are considered related [5]. In this study, we report on two congenital coralliform cataract pedigrees caused by the P24T mutation of the gammaD-crystallin (CRYGD) gene.

Methods

Patients and clinical data

Family 1 enrolled in this study was from the Inner Mongolia Autonomous Region, China. The patients had completed a cataract operation, but their vision recovery was not optimal. Family 2 was from Liaoning province, China. These patients had, in part, received cataract operations of one eye; their vision recovery was less than satisfactory. Clinical examination, peripheral blood collection, and DNA extraction were performed at the Department of Ophthalmology, Peking Union Medical College Hospital. Informed consent in accordance with the Declaration of Helsinki and the Institutional Review Board and Ethics Committee of Peking City was obtained from all participants. Family 1 included four confirmed patients, and Family 2 included seven confirmed patients (Figure 1). Clinical data for these subjects was ascertained by detailed ocular examinations.
Figure 1

Pedigree and haplotype. Haplotype analysis of the families demonstrated segregation of three microsatellite markers flanking CRYGD on chromosome 2q33-q35 region.

Pedigree and haplotype. Haplotype analysis of the families demonstrated segregation of three microsatellite markers flanking CRYGD on chromosome 2q33-q35 region.

Mutation analysis and haplotype analysis

The reported genes, gammaC-crystallin (CRYGC), CRYGD, gammaS-crystallin (CRYGS), gap-junction protein, alpha 8 (GJA8), gap-junction protein, alpha 3 (GJA3), and alphaA-crystallin (CRYAA) were selected as candidate genes. All coding exons for these genes were amplified by polymerase chain reaction (PCR) using a set of previously described paired primers [6] and presented in Table 1. The PCR products were sequenced using an ABI3730 Automated Sequencer (PE Biosystems, Foster City, CA). Microsatellite markers close to CRYGD loci were selected. PCR products from each DNA sample were separated using an ABI 3730XL DNA Analyzer (PE Biosystems).
Table 1

Primers used for candidate gene amplification related with congenital cataract.

Exonprimer (5′-3′)Product length (bp)Annealing temperature (°C)
CRYGD-1–2F
AGAACACGAAAATGCCCTTG
 
 
CRYGD-1–2R
TGCTTGAAACCATCCAGTGA
579
60
CRYGD-3F
GCTGGACTGCCTAACAATGC
 
 
CRYGD-3R
CACATCTTGGTTGCCATTTG
498
58
CRYGS-1F
TTGACTGAAACCAGCCCATA
 
 
CRYGS-1R
TTAGGTGAAAAGCGGGTAGG
166
58
CRYGS-2F
AATTAAGCCACCCAGCTCCT
 
 
CRYGS-2R
AAGCAAGAGAAAGCGGACAG
356
58
CRYGS-3F
CCTGCTGGTGATTTCCATAA
 
 
CRYGS-3R
GATGATGCCTATTTGGACCAC
399
58
GJA8–1F
CGGGGCCTTCTTTGTTCTCTAGTCC
 
 
GJA8–1R
AGGCCCAGGTGGCCCAACTCC
750
67
GJA8–2F
CAGCCGGTGGCCCTGCC
 
 
GJA8–2R
GTTGCCTGGAGTGCACTGCCC
770
66
GJA3–1F
CGGTGTTCATGAGCATTTTC
 
 
GJA3–1R
GACGTAGGTCCGCAGCAG
496
58
GJA3–2F
GCAGGACAATCCCTCGTC
 
 
GJA3–2R
GGTCAGGGCTAGCAGTTTGA
532
58
GJA3–3F
TCGGGTTCCCACCCTACTAT
 
 
GJA3–3R
TGCACTTTGGTTTTGGTTTC
579
58
CRYAA-1 F
CACGCCTTTCCAGAGAAATC
 
 
CRYAA-1 R
CTCTGCAAGGGGATGAAGTG
466
58
CRYAA-2 F
CTTGGTGTGTGGGAGAAGAGG
 
 
CRYAA-2R
TCCCTCTCCCAGGGTTGAAG
377
58
CRYAA-3 F
CCCCCTTCTGCAGTCAGT
 
 
CRYAA-3R
GCTTGAGCTCAGGAGAAGGA
989
58
CRYGC-1–2F
GCAGTATGTACAGGACAGCGTTA
 
 
CRYGC-1–2R
CCTCCCTGTAACCCACATTG
644
58
CRYGC-3F
ATTCCATGCCACAACCTACC
 
 
CRYGC-3RCCCACCCCATTCACTTCTTA52758

Results

Clinical findings

All patients enrolled in this study were afflicted with coralliform congenital cataracts (Figure 2), and none of the participants had any other clinical related ophthalmic syndromes.
Figure 2

Slit lamp photograph showing coralliform cataract of patient: II:6 in family 1 and III:7 in family 2 (from Figure 1).

Slit lamp photograph showing coralliform cataract of patient: II:6 in family 1 and III:7 in family 2 (from Figure 1). By directly sequencing the coding region of CRYGD, we identified a C→A transversion at nucleotide position c.70 in exon 2 of CRYGD. This mutation resulted in a threonine substitution for proline at amino-acid residue 24 (P24T; Figure 3). This mutation was only identified in the patients and was not found in healthy relatives or the 100 control chromosomes from the same ethnic background. The disease haplotype cosegregated in all affected members in each family. The haplotype indicated that the two families did not share the same microsatellite markers group. This confirmed that these two families were unrelated (Figure 1).
Figure 3

DNA sequences of CRYGD in unaffected and affected individuals. The C→A transversion resulted in a threonine substitution for proline at amino-acid residue 24 (P24T) in the affected individuals.

DNA sequences of CRYGD in unaffected and affected individuals. The C→A transversion resulted in a threonine substitution for proline at amino-acid residue 24 (P24T) in the affected individuals.

Discussion

Coralliform cataract is a special form of congenital cataracts. Several studies have shown that mutations in the CRYGD gene, located at 2q33–35, can result in congenital coralliform cataracts, and the P24T mutation of CRYGD has been reported in multiple cases. In the two autosomal dominant congenital coralliform cataract pedigrees in this study, we identified a recurrent P24T mutation. This mutation has been found in ten pedigrees, including two cerulean, one lamellar, six coralliform (including our two pedigrees and an unreported pedigree from Tianjin Eye Hospital, China), and one fasciculiform phenotype. From the reported pedigrees, the congenital coralliform cataracts all resulted from CRYGD mutations. This information indicated that the coralliform phenotype and the CRYGD gene are closely related. Our results supported the idea that virulence genes and lens morphology are related [7-12]. Results of biophysical analysis have shown that the P24T mutant protein has a significantly lower solubility compared with wild-type human γD crystallin. With synchrotron radiation circular dichroism spectroscopy, Evans et al. [13] found that the P24T mutant has a slightly increased content of beta-sheets, due to the substitution of the Pro24 residue, which may be attributed to the extension of an edge beta-strand. This indicates that the insolubility of the P24T mutant protein, rather than the loss of stability, likely causes the occurrences of congenital cataracts. Based on nuclear magnetic resonance analysis, jung et al. found that the pivotal local conformation and dynamics of the threonine substitution in the P24T mutant are different from that of wild-type γD crystallin [14]. The substitution alters motional behavior of the associated region of the protein, speculating that the P24T substitution may initiate aggregation or polymerization. Such aggregation could result in reduced solubility and formation of high-molecular weight complexes. Up to now, fourteen mutations in CRYGD have been reported [15-19]. Several studies have verified that mutation of CRYGD can lead to a decrease in solubility of the mutant protein compared to wild type. However, the conformation and stability of the mutant protein undergoes little change. In conclusion, mutations in CRYGD are responsible for coralliform cataracts, and the P24T mutation may be a hot-point mutation affecting the formation of congenital coralliform cataracts.
  19 in total

1.  Novel mutations in the gamma-crystallin genes cause autosomal dominant congenital cataracts.

Authors:  S T Santhiya; M Shyam Manohar; D Rawlley; P Vijayalakshmi; P Namperumalsamy; P M Gopinath; J Löster; J Graw
Journal:  J Med Genet       Date:  2002-05       Impact factor: 6.318

Review 2.  Infantile cataracts.

Authors:  S R Lambert; A V Drack
Journal:  Surv Ophthalmol       Date:  1996 May-Jun       Impact factor: 6.048

3.  Gamma-D crystallin gene (CRYGD) mutation causes autosomal dominant congenital cerulean cataracts.

Authors:  E Nandrot; C Slingsby; A Basak; M Cherif-Chefchaouni; B Benazzouz; Y Hajaji; S Boutayeb; O Gribouval; L Arbogast; A Berraho; M Abitbol; L Hilal
Journal:  J Med Genet       Date:  2003-04       Impact factor: 6.318

4.  Congenital and infantile cataract in the United Kingdom: underlying or associated factors. British Congenital Cataract Interest Group.

Authors:  J S Rahi; C Dezateux
Journal:  Invest Ophthalmol Vis Sci       Date:  2000-07       Impact factor: 4.799

5.  The structure of the cataract-causing P23T mutant of human gammaD-crystallin exhibits distinctive local conformational and dynamic changes.

Authors:  Jinwon Jung; In-Ja L Byeon; Yongting Wang; Jonathan King; Angela M Gronenborn
Journal:  Biochemistry       Date:  2009-03-31       Impact factor: 3.162

6.  The P23T cataract mutation causes loss of solubility of folded gammaD-crystallin.

Authors:  P Evans; K Wyatt; G J Wistow; O A Bateman; B A Wallace; C Slingsby
Journal:  J Mol Biol       Date:  2004-10-15       Impact factor: 5.469

7.  Aetiology of congenital and paediatric cataract in an Australian population.

Authors:  M G Wirth; I M Russell-Eggitt; J E Craig; J E Elder; D A Mackey
Journal:  Br J Ophthalmol       Date:  2002-07       Impact factor: 4.638

8.  Special fasciculiform cataract caused by a mutation in the gammaD-crystallin gene.

Authors:  Xingchao Shentu; Ke Yao; Wen Xu; Shu Zheng; Songnian Hu; Xiaohua Gong
Journal:  Mol Vis       Date:  2004-03-29       Impact factor: 2.367

9.  A missense mutation in the gammaD crystallin gene (CRYGD) associated with autosomal dominant "coral-like" cataract linked to chromosome 2q.

Authors:  Donna S Mackay; Usha P Andley; Alan Shiels
Journal:  Mol Vis       Date:  2004-03-17       Impact factor: 2.367

10.  Autosomal dominant coralliform cataract related to a missense mutation of the gammaD-crystallin gene.

Authors:  Wei-zhen Xu; Shu Zheng; Shi-jie Xu; Wei Huang; Ke Yao; Su-zhan Zhang
Journal:  Chin Med J (Engl)       Date:  2004-05       Impact factor: 2.628

View more
  8 in total

1.  Epidemiology and molecular genetics of congenital cataracts.

Authors:  Jun Yi; Jun Yun; Zhi-Kui Li; Chang-Tai Xu; Bo-Rong Pan
Journal:  Int J Ophthalmol       Date:  2011-08-18       Impact factor: 1.779

2.  Crystal structure of the cataract-causing P23T γD-crystallin mutant.

Authors:  Fangling Ji; Leonardus M I Koharudin; Jinwon Jung; Angela M Gronenborn
Journal:  Proteins       Date:  2013-06-17

3.  A mutated CRYGD associated with congenital coralliform cataracts in two Chinese pedigrees.

Authors:  Su-Ping Cai; Lan Lu; Xi-Zhen Wang; Yun Wang; Fen He; Ning Fan; Jing-Ning Weng; Jun-Hua Zhang; Xu-Yang Liu
Journal:  Int J Ophthalmol       Date:  2021-06-18       Impact factor: 1.779

4.  Coralliform cataract caused by a novel connexin46 (GJA3) mutation in a Chinese family.

Authors:  Xiaohui Zhang; Lina Wang; Jun Wang; Bing Dong; Yang Li
Journal:  Mol Vis       Date:  2012-01-25       Impact factor: 2.367

5.  A Novel CRYBB2 Stopgain Mutation Causing Congenital Autosomal Dominant Cataract in a Chinese Family.

Authors:  Yu Zhou; Yaru Zhai; Lulin Huang; Bo Gong; Jie Li; Fang Hao; Zhengzheng Wu; Yi Shi; Yin Yang
Journal:  J Ophthalmol       Date:  2016-11-29       Impact factor: 1.909

6.  Combinational analysis of linkage and exome sequencing identifies the causative mutation in a Chinese family with congenital cataract.

Authors:  Xueyuan Jia; Feng Zhang; Jing Bai; Linghan Gao; Xuelong Zhang; Haiming Sun; Donglin Sun; Rongwei Guan; Wenjing Sun; Lidan Xu; Zhichao Yue; Yang Yu; Songbin Fu
Journal:  BMC Med Genet       Date:  2013-10-08       Impact factor: 2.103

7.  Novel mutations in CRYGD are associated with congenital cataracts in Chinese families.

Authors:  Guoxing Yang; Zhimin Chen; Wulin Zhang; Zhiqiang Liu; Jialiang Zhao
Journal:  Sci Rep       Date:  2016-01-06       Impact factor: 4.379

8.  Targeted Exome Sequencing of Congenital Cataracts Related Genes: Broadening the Mutation Spectrum and Genotype-Phenotype Correlations in 27 Chinese Han Families.

Authors:  Yi Zhai; Jinyu Li; Wangshu Yu; Sha Zhu; Yinhui Yu; Menghan Wu; Guizhen Sun; Xiaohua Gong; Ke Yao
Journal:  Sci Rep       Date:  2017-04-27       Impact factor: 4.996

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.