Literature DB >> 21473793

Sequence analysis for the complete proviral genome of subgroup J Avian Leukosis virus associated with hemangioma: a special 11 bp deletion was observed in U3 region of 3'UTR.

Min Shi1, Mingxing Tian, Cheng Liu, Yang Zhao, Yan Lin, Nianli Zou, Ping Liu, Yong Huang.   

Abstract

BACKGROUND: Avian Leukosis virus (ALV) of subgroup J (ALV-J) belong to retroviruses, which could induce tumors in domestic and wild birds. Myelocytomatosis was the most common neoplasma observed in infected flocks; however, few cases of hemangioma caused by ALV-J were reported in recent year.
RESULTS: An ALV-J strain SCDY1 associated with hemangioma was isolated and its proviral genomic sequences were determined. The full proviral sequence of SCDY1 was 7489 nt long. Homology analysis of the env, pol and gag gene between SCDY1 and other strains in GenBank were 90.3-94.2%, 96.6-97.6%, and 94.3-96.5% at nucleotide level, respectively; while 85.1-90.7%, 97.4-98.7%, and 96.2-98.4% at amino acid level, respectively. Alignment analysis of the genomic sequence of ALV-J strains by using HPRS-103 as reference showed that a special 11 bp deletion was observed in U3 region of 3'UTR of SCDY1 and another ALV-J strain NHH isolated from case of hemangioma, and the non-functional TM and E element were absent in the genome of SCDY1, but the transcriptional regulatory elements including C/EBP, E2BP, NFAP-1, CArG box and Y box were highly conserved. Phylogenetic analysis revealed that all analyzed ALV-J strains could be separated into four groups, and SCDY1 as well as another strain NHH were included in the same cluster.
CONCLUSION: The variation in envelope glycoprotein was higher than other genes. The genome sequence of SCDY1 has a close relationship with that of another ALV-J strain NHH isolated from case of hemangioma. A 11 bp deletion observed in U3 region of 3'UTR of genome of ALV-J isolated from case of hemangioma is interesting, which may be associated with the occurrence of hemangioma.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21473793      PMCID: PMC3080830          DOI: 10.1186/1743-422X-8-158

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


Background

Avian Leucosis virus subgroup J (ALV-J) was first reported in 1989 from commercial meat-type chickens with myelocytomatosis [1]. It is a novel subgroup different from classical ALV subgroup A, B, C, D and E, and a recombinant between exogenous avian leukosis viruses (ALVs) and the endogenous avian retrovirus (EAV) family of EAVs [2,3]. ALV-J could be transmitted from broiler breeders to progeny more frequently than other ALV subgroups by Vertical transmission [4], and has caused severe economic losses in breeding farms all over the world. Recent studies showed that the host range of ALV-J had been largely widened, it could infect not only broilers but also commercial layers. Meanwhile, some new clinical pathotypes were observed in diseased flocks, such as hemangioma, which might be observed on the skin of the trunk, digitus, joint, wing and internal organs. In China, the type of neoplasma induced by ALV-J was mainly myeloma leucosis (ML), and it occurred mainly in white meat-type chickens [5]. However, few cases of hemangioma caused by ALV subgroup J were reported in recent years [6,7], and they were diagnosed mainly by histopathological examination and PCR detection. To updates, two complete proviral genomic sequences of ALV-J strain associated with hemangioma were reported, which were NHH (HM235668) and JL0901 (not published in NCBI). In 2009, an infectious disease occurred in a grandparent breeding farm in Sichuan province of China, characteristics mainly of weakness, inappetance and emaciation. Hemangioma was observed in the digiti of the sick. The gross pathology seen in organs of diseased chickens included hepatomegaly, splenomegaly and gray-white nodules of various sizes on the surface of the liver, but no myeloma leucosis was observed. In this study, an ALV-J strain SCDY1 was isolated from the blood samples of the diseased chickens, and its complete genome sequence was amplified and analyzed, which should be helpful for the research on the pathogenesis of hemangioma induced by ALV-J.

Methods

Chicken embryo fibroblast (CEF)

Specific-pathogen-free (SPF) eggs were obtained from the Beijing experimental animal center (Merial Inc., Beijing, China) and hatched at our lab. Ten-day-old chicken embryos were used to prepare the Chicken embryo fibroblast (CEF) cell cultures.

Virus isolation

The whole blood sample was inoculated onto the CEF monolayers prepared from 11-day-old embryonated eggs, and incubated at 37°C with 5% CO2 for five days for each passage. Uninfected CEF monolayers were used as negative control. After one blind passage, the existence of ALV-J in CEF was verified by PCR detection of 545 bp repeated sequence. Three blind passage were conducted until the result of PCR detection of cellular genome and RT-PCR detection of supernatant were both positive.

Primers

First, a pair of primers designed by smith [8] was synthesized and used to detect the proviral genomic DNA of ALV-J in infected CEF, or the viral RNA of ALV-J in the supernatant of infected CEF. Next, nine pairs of primers (Table 1) were designed according to the published sequences of HPRS-103 to amplify nine fragments which overlapped with each other and covered the whole genome of ALV-J. The ninth pair was used specifically to amplify the LTRs of circular DNA of ALV-J.
Table 1

Primers used to amplify the proviral genomic DNA of SCDY1

No.NameSequence(5'----3')Position corresponding to the genome of HPRS-103Expected size(bp)
1A1FGGCTCTTATGTAACGATG16-33614
A1RGGAAATCACCTTTATGACGG610-629
2A2FGATGTGATAGTTAGGGAATAGTGG336-3591160
A2RCTCTCATTAGATTCGTAACGTC1474-1495
3A3FTCACAAGACTGGCTGATACGGT1376-13971098
A3RCCGAAATAATAGTGATGTCCGC2452-2473
4A4FTCATTCTGACTAACACTGGGAG2378-23991191
A4RCGCAACTGCTCATAAAAGGG3548-3568
5A5FGTAGCAGAACCCAGGATAGC3447-34661376
A5RGTGAAGCAGGACCCATTATC4803-4822
6A6FCGTGTCACATCGGTTGCTG4725-4743745
A6RCCCTGGGACAACGGAAATA5451-5469
7A7FACTCTAAGAAGAAGCCGCC5342-53601921
A7RCGA TTCGCAAGT TTCATACC7243-7262
8A8FGTTTGCCTTGCTTGTCATAG6855-6874968
A8RCAGGTGCTCGTAGTTGTCA7804-782
9*A9FTTAGGAAGGCAACAGACGG7644-7662466
A9RGGGCGACCAGAATCACG574-591

* Primers used to amplify the long terminal repeat (LTR) sequences from circularized viral DNA of SCDY1.

Primers used to amplify the proviral genomic DNA of SCDY1 * Primers used to amplify the long terminal repeat (LTR) sequences from circularized viral DNA of SCDY1.

Genomic DNA extract and PCR amplification

The total DNA was extracted from chicken embryo fibroblast (CEF) infected with virus by using a sodium dodecyl sulfate (SDS) - proteinase K and phenol/chloroform/isoamylol (25:24:1) protocol. Genomic DNA PCR amplification was performed according to the manual of rTaq kit (Takara, Dalian, China), by using the proviral genomic DNA as template. Primers pairs 1-8 were used to amplify the internal region of SCDY1 genome; while primer pair 9 was used to amplify the LTRs of circular DNA by using total DNA of CEF infected by SCDY1 for 8-24 h as templates. The optimum conditions for PCR were as follows: 94°C for 4 min, ten cycles at 94°C for 35 s, 55°C for 35 s (a decrease of 0.5°C per cycle), 72°C for 40 s and followed by 20 cycles at 94°C for 35 s, 50°C for 35 s, 72°C for 40 s and a final elongation at 72°C for 10 min. The PCR product was analyzed in 1% agarose in Tris-borate-EDTA (TBE) buffer gel containing 0.5 mg/ml ethidium bromide.

Cloning and sequencing of proviral genomic DNA of SCDY1

The PCR products were isolated from agarose gels and purified using E.Z.N. ATM Gel Extraction Kit (TaKaRa, Japan), then cloned into pMD19-T vector (Takara, Dalian) and transformed into DH5α E. Coli competent cell. Confirmation of clones containing recombinant plasmid was achieved by PCR and restriction enzyme (RE) digestion. The recombinant plasmid was sequenced by Shanghai Sanggong Biologiucal Engineering Tachnology & Services Co., Ltd (shanghai, China).

Sequence analysis

The complete genome sequences of the isolate was compared with these of other ALV-J strains published in GenBank, including Chinese strains isolated from white broilers and commercial layers by using the Clustal W method in MegAlign program of the DNASTAR package. Transcriptional regulatory elements in U3 were analyzed by the online service system of NSITE (Recognition of Regulatory motifs) of Soft Berry (http://linux1.softberry.com/berry.phtml). Phylogenetic analysis of the complete proviral sequences of ALV-J was performed with the neighbor-joining method using MEGA version 4.0. The background of the reference strains used in this study and their accession numbers are listed in table 2.
Table 2

ALV-J reference strains used in this study

ALV-J strainsOriginTumor PhaenotypeAccesstion number
yearcountryhost
HPRS-1031995UKWhite broilerMLZ46390
YZ99021999ChinaWhite broilerMLHM235670
ADOL-75012001USAWhite broilerN/AAY027920
NX01012001ChinaWhite broilerMLDQ115805
NM2002-12002ChinaWhite broilerMLHM235669
JS-nt2003ChinaWhite broilerMLHM235667
SD07LK12007ChinaCommercial layerMLFJ216405
NHH2007ChinaCommercial layerHemangiomaHM235668
HN*2007ChinaCommercial layerHemangiomaHM235666
HAY0132008ChinaLocal "yellow"MLHM235665
SCDY12009ChinaGrandparent breedHemangiomaHQ425636
JS09GY32009ChinaCommercial layerHemangioma and MLGU982308
JS09GY62009ChinaCommercial layerHemangioma and MLGU982310

* isolate with no complete genomic sequence. ML means myeloma leukosis; data not available

ALV-J reference strains used in this study * isolate with no complete genomic sequence. ML means myeloma leukosis; data not available

Results

Virus isolation and identification

An ALV-J strain was isolated from the sampled blood, and was designated as SCDY1. The genomic DNA of infected CEF were positive in PCR detection, and the supernatant of infected CEF was positive in RT-PCR detection (data not shown), indicating the existence of proviral genomic DNA of ALV-J in infected CEF and ALV in the supernatant of infected CEF.

PCR amplification of proviral genome

Total DNA from SCDY1-infected CEF was used as PCR templates, and nine DNA fragments with the expected sizes of 0.614, 1.16, 1.098, 1.191, 1.376, 0.745, 1.921, 0.968, 0.466 kb long were amplified (data not shown).

Sequence analysis of the proviral genome of SCDY1

Sequences of the PCR products were aligned by using the EDITSEQ program in DNAstar software (DNASTAR Inc., Madison, WI 53715, USA). The complete proviral genome sequence of SCDY1, compiled from sequences of nine overlapping DNA fragments, was 7489 nt in length, and submitted to GenBank under accession No. HQ425636. The structure of SCDY1 proviral genome was presented in Figure 1.
Figure 1

The structure of complete proviral genome of SCDY1. The boxed sequence at the two ends shows 5'LTR and 3'LTR. The arrows show the beginning and stopping nucleotides for each ORF or principal fragments DR1/E element. Partial sequences of SCDY1 genome were not shown.

The structure of complete proviral genome of SCDY1. The boxed sequence at the two ends shows 5'LTR and 3'LTR. The arrows show the beginning and stopping nucleotides for each ORF or principal fragments DR1/E element. Partial sequences of SCDY1 genome were not shown. Comparisons of the long terminal repeat (LTR) sequence showed that the LTR of SCDY1 shared a homology of 89.8-92.7% with these of other reference strains, and the LTR sequences of strains HPRS-103 and HN had the highest homology with these of SCDY1 (Table 3).
Table 3

The Homology of nucleotide sequences of LTR, gag, pol and env genes between SCDY1 and other reference strains

ALV-J strains*genes or fragment of SCDY1
NameLTRgagpolenv
HPRS-10392.796.397.394.2
YZ990290.195.597.293.6
ADOL-750190.494.897.490.3
NX010190.494.397.492.9
NM2002-191.195.796.992.7
JS-nt91.796.096.992.9
SD07LK189.896.297.693.7
NHH91.496.596.694.2
HN^92.7---------
HAY01389.895.597.193.6
JS09GY391.195.397.393.8
JS09GY690.895.297.194.0

* pathotype of isolates was available in table2; ^ means strain with only LTR sequence was available; "---" means no result could be obtained.

The Homology of nucleotide sequences of LTR, gag, pol and env genes between SCDY1 and other reference strains * pathotype of isolates was available in table2; ^ means strain with only LTR sequence was available; "---" means no result could be obtained. Comparisons of the three major structural genes revealed that the homology of nucleotide sequence of env, pol and gag gene between SCDY1 and other isolates in GenBank were 90.3-94.2%, 96.6-97.6% and 94.3-96.5%, respectively, and the homology of amino acid sequence of env, pol and gag gene between SCDY1 and other isolates in GenBank were 85.1-90.7%, 97.4-98.7% and 96.2-98.4%, respectively. The gag and pol genes of ALV-J were more conservative than the env gene relatively (Table 3, 4).
Table 4

The Homology of amino acid sequences of gag, pol and env proteins between SCDY1 and other reference strains

ALV-J strains*protein of SCDY1
gagpolenv
HPRS-10397.298.790.3
YZ990297.098.389.5
ADOL-750196.298.285.1
NX010194.397.789.0
NM2002-197.098.289.3
JS-nt97.498.289.7
SD07LK197.398.289.6
NHH98.497.490.7
HAY01396.698.390.5
JS09GY396.798.489.1
JS09GY696.698.389.1

* pathotype of isolates was available in table2.

The Homology of amino acid sequences of gag, pol and env proteins between SCDY1 and other reference strains * pathotype of isolates was available in table2. Homology analysis based on 3'UTR fragment of ALV-J associated with hemangioma was made by Clustal W method in MegAlign, and prototype strain HPRS-103 was used as a reference. The result showed that SCDY1 and NHH shared two almost identical deletions in 3'UTR, Which were the deletion of most part of the non-functional TM and a special 11 bp deletion in U3 region. Furthermore, most parts of E element in SCDY1 genome were absent; while, it was not observed in that of NHH (Figure 2). Online service analysis system of NSITE of SoftBerry showed that the transcriptional regulatory elements in U3 region of SCDY1 genome contained C/EBP, E2BP, CArG box and Y box, and they were highly conserved when comparing to these of the HPRS-103 strain. This special 11 bp deletion was found in the upstream of CArG box (Figure 3) and the sequence "TGATCAT" observed in this special 11 bp deletion region was recognized as a transcriptional regulatory element ABI REP1, which was the regulatory factor of human gene Apo-AI.
Figure 2

Comparison of the 3'UTR nucleotide sequences for different ALV-J strains. "---" means the deletion of nucleotide.

Figure 3

Transcriptional regulatory elements in U3 of different ALV-J strains. Bases deletions showed as "---" and nucleotide same to HPRS-103 indicated as "."; motifs were indicated in panes.

Comparison of the 3'UTR nucleotide sequences for different ALV-J strains. "---" means the deletion of nucleotide. Transcriptional regulatory elements in U3 of different ALV-J strains. Bases deletions showed as "---" and nucleotide same to HPRS-103 indicated as "."; motifs were indicated in panes.

Phylogenetic relationships between SCDY1 and other ALV-J strains

Phylogenetic analysis of the complete genome sequences of SCDY1 and other eleven ALV-J strains demonstated that SCDY1 and other eleven reference strains could be grouped into four clusters, SCDY1 and another strain NHH isolated from case of hemangioma were in the same cluster (Figure 4).
Figure 4

Phylogenetic tree of complete genome sequences of ALV-J with different clinical phaenotype. Black triangle (▲) referred to isolate SCDY-1, * referred to the isolate with unknown tumor phaenotype.

Phylogenetic tree of complete genome sequences of ALV-J with different clinical phaenotype. Black triangle (▲) referred to isolate SCDY-1, * referred to the isolate with unknown tumor phaenotype.

Discussion

ALV-J has spread all over the world and caused severe economic losses in broiler breeder flocks since it was isolated [5,9-11]. It can infect all species of chicken, but the types of neoplasma and the morbidity vary in different cases. The most common neoplasma observed in infected flocks was myeloid leucosis (ML) [12]; however, myelocytomas are not exclusive to ALV-J, other types of neoplasma such as histiocytic sarcomatosis, feather abnormalities, myelocyte infiltration in bones, hemangioma has also been reported [13-16]. Hemangioma has been even the most common neoplasm in broiler breeders in the UK [17], and an outbreak of hemangioma with 20% mortalities in young white Leghorn layers in Israel has also been reported [18]. In China, hemangioma was observed in several commercial layer flocks infected by ALV-J during 2007-2009 [19]. In this paper, a field ALV-J strain named as SCDY1 was isolated and its the complete proviral genome nucleotide sequence was determined. It contains 7489 nt with no EcoR I site, which could be found in the genome of NHH strain isolated from case of hemangioma. Homology analysis of the genes of SCDY1 and other reference strains showed that the envelope gene of ALV-J was prone to evolve compared to gag and pol genes, as the identity of the env gene between strain SCDY1 and other strains ranged from 90.3% to 94.2% at the nucleotides level and from 85.1% to 90.7% at the amino acid level respectively, lower than these of gag and pol genes. The 3'UTR of avian retroviruses is important in viral pathogenesis and replication, the LTR enclosed within the 3' UTR contains powerful transcription regulatory elements that might differ among viruses and determine the virulence [20]. According to sequences analysis, the transcriptional regulatory elements of U3 region of SCDY1 genoem contained several transcriptional elements such as C/EBP, E2BP, CArG box and Y box, which played an important role in the efficient transcription of virus; while, NFAP-1 was not observed in SCDY1 genome, and it could be found in these of other analyzed strains. NFAP-1 could be recognized by the activator protein 1 (AP-1), and AP-1 is a heterodimeric protein composed of proteins belonging to the c-Fos, c-Jun, ATF and JDP families. It regulates gene expression in response to a variety of stimuli, including cytokines, growth factors, stress, and bacterial and viral infections [21]. The absent of NFAP-1 might affect the infection abilities of ALV-J virus. Most of non-functional TM and E element of SCDY1 in 3'UTR were absent, which shared identical deletions with some ML strains isolated from meat-type chickens; while, the deletion of E element in SCDY1 genome was not observed in the genome of another strain NHH isolated from case of hemangioma. The E element has been found exclusively in some of the sarcoma viruses and ALV-J [22-24]. It may play a role in oncogenesis based on its close association with the src gene; however, it seemed not to be essential for oncogenesis, because other related oncogenic avian retroviruses lack the E element [25]. Therefore, the pathogenicity of SCDY1 may be unaffected by the deletion of TM and E element. The occurrence of hemangioma may be associated with multiple factors such as genetic backgroud, environment, concomitant infections, immunocompetence and the mode of transmission. Interestingly, a special 11 bp deletion was observed in the U3 region of ALV-J strains associated with hemangioma. Online service analysis showed that a sequence "TGATCAT" within this special 11 bp region of U3 of ALV-J strains other than SCDY1 was a transcriptional regulatory element ABI REP1, which was the regulatory factor of human gene Apo-AI and function in the process of recognition of regulatory motifs. One binding factor of ABI REP1 named as HNF-4 was also found, and it served as an inhibitor modulator and played an important role in the regulation of eukaryotic genes. Although the special 11 bp deletion did not locate in CArG box, PRE box or Y box, its appearance may played a role in the transcriptional regulation of ALV-J genes, further study such as reverse genetics should be taken to test its function in oncogenesis. So far, there are few proviral genomic sequence of ALV-J strains associated with hemangioma have been reported, the sequence comparison and phylogenetic analysis of SCDY1 and other ALV-J strains may help to reveal the evolution rhythm of ALV-J strains prevalent in fields, and benefit for the research on the pathogenicity and biological characteristics of ALV-J strain.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

MS: carried out most of the experiments and wrote the manuscript, YH: carried out study design, and revised the manuscript. MXT, CL, YZ, YL, NLZ, PL, XTW, SJC helped in experiments. All authors read and approved the final manuscript.
  22 in total

1.  Lesions of bone and bone marrow in myeloid leukosis occurring naturally in adult broiler breeders.

Authors:  K Nakamura; M Ogiso; K Tsukamoto; N Hamazaki; H Hihara; N Yuasa
Journal:  Avian Dis       Date:  2000 Jan-Mar       Impact factor: 1.577

2.  Avian endogenous retrovirus EAV-HP shares regions of identity with avian leukosis virus subgroup J and the avian retrotransposon ART-CH.

Authors:  M A Sacco; D M Flannery; K Howes; K Venugopal
Journal:  J Virol       Date:  2000-02       Impact factor: 5.103

3.  Novel endogenous retroviral sequences in the chicken genome closely related to HPRS-103 (subgroup J) avian leukosis virus.

Authors:  L M Smith; A A Toye; K Howes; N Bumstead; L N Payne; K Venugopal
Journal:  J Gen Virol       Date:  1999-01       Impact factor: 3.891

4.  Multiple enhancer domains in the 3' terminus of the Prague strain of Rous sarcoma virus.

Authors:  L A Laimins; P Tsichlis; G Khoury
Journal:  Nucleic Acids Res       Date:  1984-08-24       Impact factor: 16.971

Review 5.  Transcription regulatory elements of the avian retroviral long terminal repeat.

Authors:  A Ruddell
Journal:  Virology       Date:  1995-01-10       Impact factor: 3.616

6.  Isolation and some characteristics of a subgroup J-like avian leukosis virus associated with myeloid leukosis in meat-type chickens in the United States.

Authors:  A M Fadly; E J Smith
Journal:  Avian Dis       Date:  1999 Jul-Sep       Impact factor: 1.577

7.  Avian leukosis virus subgroup J infection profiles in broiler breeder chickens: association with virus transmission to progeny.

Authors:  R L Witter; L D Bacon; H D Hunt; R E Silva; A M Fadly
Journal:  Avian Dis       Date:  2000 Oct-Dec       Impact factor: 1.577

8.  Tumors associated with avian leukosis virus subgroup J in layer hens during 2007 to 2009 in China.

Authors:  Ziqiang Cheng; Jianzhu Liu; Zhizhong Cui; Li Zhang
Journal:  J Vet Med Sci       Date:  2010-05-12       Impact factor: 1.267

9.  Response of white leghorn chickens of various genetic lines to infection with avian leukosis virus subgroup J.

Authors:  Susan M Williams; Willie M Reed; Larry D Bacon; Aly M Fadly
Journal:  Avian Dis       Date:  2004 Jan-Mar       Impact factor: 1.577

10.  Detection of avian leukosis virus subgroup J in chicken flocks from Malaysia and their molecular characterization.

Authors:  B R Thapa; A R Omar; S S Arshad; M Hair-Bejo
Journal:  Avian Pathol       Date:  2004-06       Impact factor: 3.378

View more
  13 in total

1.  Full-length genome sequence analysis of four subgroup J avian leukosis virus strains isolated from chickens with clinical hemangioma.

Authors:  Lulu Lin; Peikun Wang; Yongli Yang; Haijuan Li; Teng Huang; Ping Wei
Journal:  Virus Genes       Date:  2017-07-17       Impact factor: 2.332

2.  Complete genome sequencing and characterization revealed a recombinant subgroup B isolate of avian leukosis virus with a subgroup J-like U3 region.

Authors:  Peikun Wang; Yongli Yang; Lulu Lin; Haijuan Li; Ping Wei
Journal:  Virus Genes       Date:  2017-07-17       Impact factor: 2.332

3.  Molecular characteristics of the complete genome of a J-subgroup avian leukosis virus strain isolated from Eurasian teal in China.

Authors:  Xiangwei Zeng; Yulong Gao; Delong Li; Ruijun Hao; Wansi Liu; Chunyan Han; Honglei Gao; Xiaole Qi; Yongqiang Wang; Lanlan Liu; Xiaomei Wang
Journal:  Virus Genes       Date:  2014-05-23       Impact factor: 2.332

4.  Identification of ALV-J associated acutely transforming virus Fu-J carrying complete v-fps oncogene.

Authors:  Yixin Wang; Jianliang Li; Yang Li; Lichun Fang; Xiaolong Sun; Shuang Chang; Peng Zhao; Zhizhong Cui
Journal:  Virus Genes       Date:  2016-04-25       Impact factor: 2.332

5.  Novel sequences of subgroup J avian leukosis viruses associated with hemangioma in Chinese layer hens.

Authors:  Wei Pan; Yulong Gao; Fenfen Sun; Litin Qin; Zaisi Liu; Bingling Yun; Yongqiang Wang; Xiaole Qi; Honglei Gao; Xiaomei Wang
Journal:  Virol J       Date:  2011-12-21       Impact factor: 4.099

6.  The MET gene is a common integration target in avian leukosis virus subgroup J-induced chicken hemangiomas.

Authors:  James Justice; Sanandan Malhotra; Miguel Ruano; Yingying Li; Guillermo Zavala; Nathan Lee; Robin Morgan; Karen Beemon
Journal:  J Virol       Date:  2015-02-11       Impact factor: 5.103

7.  Complete genome sequence of an avian leukosis virus isolate associated with hemangioma and myeloid leukosis in egg-type and meat-type chickens.

Authors:  Jun Ji; Hongxin Li; Huanmin Zhang; Qingmei Xie; Shuang Chang; Huiqin Shang; Jingyun Ma; Yingzuo Bi
Journal:  J Virol       Date:  2012-10       Impact factor: 5.103

8.  Complete genome sequence of an american avian leukosis virus subgroup j isolate that causes hemangiomas and myeloid leukosis.

Authors:  Sanandan Malhotra; James Justice; Nathan Lee; Yingying Li; Guillermo Zavala; Miguel Ruano; Robin Morgan; Karen Beemon
Journal:  Genome Announc       Date:  2015-04-09

9.  Reproduction of hemangioma by infection with subgroup J avian leukosis virus: the vertical transmission is more hazardous than the horizontal way.

Authors:  Yan Lin; Jing Xia; Yang Zhao; Fuyan Wang; Songcheng Yu; Nianli Zou; Xintian Wen; Sanjie Cao; Yong Huang
Journal:  Virol J       Date:  2013-03-27       Impact factor: 4.099

10.  An avian retrovirus uses canonical expression and processing mechanisms to generate viral microRNA.

Authors:  Yongxiu Yao; Lorraine P Smith; Venugopal Nair; Mick Watson
Journal:  J Virol       Date:  2013-10-23       Impact factor: 5.103

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.