Literature DB >> 21457162

Frequent mutations of KRAS in addition to BRAF in colorectal serrated adenocarcinoma.

Karoliina Stefanius1, Laura Ylitalo, Anne Tuomisto, Rami Kuivila, Tiina Kantola, Päivi Sirniö, Tuomo J Karttunen, Markus J Mäkinen.   

Abstract

AIMS: To define the occurrence of KRAS and BRAF mutations, microsatellite instability (MSI), and MGMT and hMLH1 methylation and expression in colorectal serrated adenocarcinoma. METHODS AND
RESULTS: KRAS codon 12/13 and 59/61 and BRAF V600E mutations, MSI, and MGMT and hMLH1 methylation and expression in 42 serrated adenocarcinomas and 17 serrated adenomas were compared with those in 59 non-serrated colorectal carcinomas (CRCs) and nine adenomas. KRAS and BRAF mutations were observed in 45% and 33% of serrated adenocarcinomas and in 27% and 0% of non-serrated CRCs (P < 0.001). The KRAS c12G→A transition was the predominant type of mutation in serrated adenocarcinomas. Forty-two per cent of BRAF-mutated serrated adenocarcinomas showed high-level MSI (MSI-H) (P = 0.075), 100% showed hMLH1 methylation (P = 0.001) and 90.9% showed MGMT methylation (P = 0.019). Fifty-six per cent of serrated adenocarcinomas with microsatellite stability/low-level microsatellite instability harboured KRAS mutations. In non-serrated cancers, KRAS mutations were not associated with MSI status.
CONCLUSIONS: A high combined mutation rate (79-82%) of KRAS and BRAF in serrated adenomas and adenocarcinomas indicates that mitogen-activated protein kinase activation is a crucial part of the serrated pathway. BRAF mutations are specific for serrated adenocarcinoma and identify a subset of serrated adenocarcinomas with gene methylation and a tendency for MSI-H. A high frequency of KRAS mutations in serrated adenocarcinomas suggests that a significant proportion of KRAS-mutated CRCs originate from serrated precursors, thus challenging the traditional model of Vogelstein.
© 2011 Blackwell Publishing Limited.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21457162      PMCID: PMC3107946          DOI: 10.1111/j.1365-2559.2011.03821.x

Source DB:  PubMed          Journal:  Histopathology        ISSN: 0309-0167            Impact factor:   5.087


Introduction

Colorectal cancer (CRC) is the second most common cancer type in the Western world.1 For a long time, non-serrated adenomas were thought to represent the only significant precursor lesion for CRC.2 However, it is now apparent that the development of 15–20% of sporadic CRCs is not explained by Vogelstein's adenomacarcinoma model. These cancers often show concurrent BRAF mutations and DNA CpG island hypermethylation (CIM), and associate with high-level DNA microsatellite instability (MSI-H) via methylation of the DNA mismatch repair gene hMLH.3,4 It is generally believed that these cancers originate from serrated polyps, because this combination of alterations is frequent in serrated polyps (hyperplastic polyps, sessile serrated adenomas, mixed hyperplastic/adenomatous polyps, also known as admixed polyps, and traditional serrated adenomas), but absent in sporadic non-serrated adenomas. The serrated pathway has emerged as the second most significant pathway leading to CRC. A smaller subset of CRCs, at least 7.5%, can be distinguished by their morphology as being derived from serrated precursor lesions, even when such precursor lesions are no longer visible. We have referred to them as ‘serrated adenocarcinoma’ to indicate their origin in serrated polyps. Although many of these cancers retain a serrated pattern of epithelium, poorly differentiated ones are better characterized by abundant eosinophilic cytoplasm and a trabecular growth pattern.4,5 KRAS mutations have been considered to be the hallmark mutations of Vogelstein's adenomacarcinoma model. Given the fact that the development of CRCs from serrated polyps with KRAS mutations has not yet been described, KRAS-mutated serrated polyps have been suggested to make a minor contribution to CRC development.6,7 KRAS and BAF belong to the intracellular RAS/RAF/MEK/mitogen-activated protein kinase (MAPK) cascade, which mediates cellular responses to growth signals. Activating mutations of KRAS occur in 30–50% of CRCs.8,9 Most (90%) are found in codons 12 and 13 of exon 1, and about 5% in codons 59 and 61 of exon 2.10 A single missense mutation of BRAF (BRAF V600E) accounts for 80% of the mutations in CRCs.11,12 Both BRAF and KRAS mutations have been found in the earliest detectable lesions with a serrated morphology, i.e. in hyperplastic/heteroplastic aberrant crypt foci.4,13BRAF mutations have been reported in 19–36% of hyperplastic polyps, in 40–89% of admixed polyps, in 75–82% of sessile serrated adenomas, and in 20–66% of traditional serrated adenomas.3,4,14,15 Similarly, KRAS mutations have been reported in about 18% of aberrant crypt foci, in 4–37% of hyperplastic polyps, in 60% of admixed polyps, in up to 80% of traditional serrated adenomas, and in up to 10% of sessile serrated adenomas.4,16 A recent study based on 11 cases found BRAF mutations to be frequent and highly specific for serrated adenocarcinoma,17 but the significance of KRAS mutations in serrated adenocarcinoma development is not known. Therefore, this study was conducted in order to identify the prevalence of BRAF and KRAS mutations in serrated adenomas and serrated adenocarcinomas, and their potential associations with both the microsatellite instability (MSI) status and the methylation of hMLH1 and MGMT, which are known to be altered in serrated polyps and in the sporadic MSI/methylator pathway to CRC.

Materials and methods

Materials

Altogether, 47 serrated adenocarcinomas were obtained for this study. The histology was confirmed by two independent pathologists (M.J.M. and T.J.K.) from the haematoxylin and eosin-stained slides. Samples were diagnosed as serrated adenocarcinomas when the cancer tissue was composed of epithelial proliferation reminiscent of serrated adenoma, i.e. the cytoplasm of these cells was clear or eosinophilic, and when the cellular changes were accompanied by a serrated growth pattern, i.e. cells forming pseudopapillary or pseudocribriform structures with tufting of the cells into the lumen without true papillary structures with a fibrovascular core.5 CRC specimens with serrated morphology were screened from the previously described, consecutively collected and population-based Finnish collection of 466 samples.18 This material yielded 38 serrated cases, of which 35 were previously diagnosed as serrated cancers.5 After careful review, three cases were reclassified as serrated adenocarcinomas. These cases did not have a residual serrated adenoma component (see Figure 1B for an example). The original series of samples was extended to cover the years 1997–1998, raising the number of samples in the consecutive series to 552 and the number of serrated CRCs to 45. Two additional serrated cases removed between the years 2006 and 2007 were included. With five serrated cases of the consecutive series lacking sufficient sample material, 42/47 serrated CRCs were included in the DNA analyses of the present study. For the sake of simplicity, we have referred to all the other adenomas and carcinomas as ‘non-serrated’ in this paper.
Figure 1

Representative histological sections of serrated adenocarcinomas in regard to KRAS or BRAF mutations and microsatellite instability (MSI) status. A–C, Cases of serrated adenocarcinomas with BRAF V600E mutations. D–F, Serrated adenocarcinomas with KRAS c12 mutations. G–H, Serrated adenoma and adenocarcinoma wild type for BRAF and KRAS, but presenting with high-level MSI (MSI-H). A, A case of serrated adenocarcinoma of the proximal colon with MSI-H, and harbouring a BRAF V600E mutation. This case is well differentiated and mucin-producing. The serrated epithelial folding is conspicuous. B, Another case of serrated adenocarcinoma of the proximal colon with MSI-H, and harbouring a BRAF V600E mutation, initially diagnosed as conventional adenocarcinoma. Serrated epithelial folding is less conspicuous, but present (arrowheads). C, A case of a serrated adenocarcinoma of the proximal colon with microsatellite stability (MSS), presenting with BRAF V600E mutation. D, A case of a serrated adenocarcinoma of the proximal colon with MSS, and harbouring a KRAS mutation. The serrations are apparent. E, A case of serrated adenocarcinoma of the proximal colon with MSS/low-level MSI, and harbouring a KRAS mutation. There is abundant clear cytoplasm, preserved polarity and luminal serration. F, A case of serrated adenocarcinoma of the proximal colon with MSI-H, and harbouring a KRAS mutation. There is a prominent serrated pattern with epithelial tufting towards the lumen. G, A case of traditional serrated adenoma of the proximal colon. This tumour was wild type for both KRAS and BRAF, and had MSI-H. The patient was 78 years old. There was no evidence of hereditary non-polyposis colorectal carcinoma. H, A case of serrated adenocarcinoma adjacent to the traditional serrated adenoma shown in (G). The tumour shows preserved serrations (arrowheads).

Representative histological sections of serrated adenocarcinomas in regard to KRAS or BRAF mutations and microsatellite instability (MSI) status. A–C, Cases of serrated adenocarcinomas with BRAF V600E mutations. D–F, Serrated adenocarcinomas with KRAS c12 mutations. G–H, Serrated adenoma and adenocarcinoma wild type for BRAF and KRAS, but presenting with high-level MSI (MSI-H). A, A case of serrated adenocarcinoma of the proximal colon with MSI-H, and harbouring a BRAF V600E mutation. This case is well differentiated and mucin-producing. The serrated epithelial folding is conspicuous. B, Another case of serrated adenocarcinoma of the proximal colon with MSI-H, and harbouring a BRAF V600E mutation, initially diagnosed as conventional adenocarcinoma. Serrated epithelial folding is less conspicuous, but present (arrowheads). C, A case of a serrated adenocarcinoma of the proximal colon with microsatellite stability (MSS), presenting with BRAF V600E mutation. D, A case of a serrated adenocarcinoma of the proximal colon with MSS, and harbouring a KRAS mutation. The serrations are apparent. E, A case of serrated adenocarcinoma of the proximal colon with MSS/low-level MSI, and harbouring a KRAS mutation. There is abundant clear cytoplasm, preserved polarity and luminal serration. F, A case of serrated adenocarcinoma of the proximal colon with MSI-H, and harbouring a KRAS mutation. There is a prominent serrated pattern with epithelial tufting towards the lumen. G, A case of traditional serrated adenoma of the proximal colon. This tumour was wild type for both KRAS and BRAF, and had MSI-H. The patient was 78 years old. There was no evidence of hereditary non-polyposis colorectal carcinoma. H, A case of serrated adenocarcinoma adjacent to the traditional serrated adenoma shown in (G). The tumour shows preserved serrations (arrowheads). A control series of non-serrated adenocarcinomas (n = 32) was selected from the demographic series of 552 cases to match gender, location, Dukes’ stage and World Health Organization histological grade. In the proximal colon, serrated adenocarcinomas represented such a large proportion that matched controls could not be obtained for all cases. Therefore, the matched control group remained smaller than the study group, and thus a set of 27 unmatched non-serrated adenocarcinomas selected from the same series to the study was added, yielding a total of 59 non-serrated adenocarcinomas. Residual benign, serrated adenoma in contact with cancer tissue was present in 28/42 serrated adenocarcinoma cases. For purposes of comparison, adenoma tissue was separately collected for the analyses. In nine cases of serrated adenocarcinoma, the residual serrated adenoma tissue was available for the analyses. An additional set of 17 serrated adenomas and nine non-serrated adenomas with a size of 5 mm or more was retrieved from the archives of Oulu University Hospital Department of Pathology.

DNA extraction and MSI analysis

DNA extraction and MSI analysis were performed as described previously.5,19 Tumour DNA was analysed with the NIH consensus marker panel, and distinction of MSI-H from microsatellite stability (MSS)/low-level MSI (MSI-L) was made according to the NIH consensus statement.20

Methylation analysis

Methylation analyses of the promoter sequences of the hMLH1 and MGMT genes were performed using the methylation-specific polymerase chain reaction (PCR)21 based on bisulphite pretreatment of DNA. The primer pairs used for the methylated and unmethylated templates of hMLH1 were TTTTTTAGGAGTGAAGGAGGTTACG (forward) and GCCACTACGAAACTAAACACGAA (reverse), and TTTTTAGGAGTGAAGGAGGTTATGG (forward) and AAACACCACTACAAAACTAAACACAAA (reverse), respectively. The primer pairs used for the methylated and unmethylated templates of MGMT were TTTCGACGTTCGTAGGTTTTCGC (forward) and GCACTCTTCCGAAAACGAAACG (reverse),22 and TTTGTGTTTTGATGTTTGTAGGTTTTTGT (forward) and AACTCCACACTCTTCCAAAAACAAAACA (reverse), respectively. Bisulphite-treated genomic DNA (100 ng) was used as a template in the PCR. The 2× JumpStart REDTaq ReadyMix (Sigma-Aldrich, St Louis, MO, USA) was used according to the manufacturer's instructions. Commercial methylated DNA (CpGENOME Methylated DNA) and unmethylated DNA (CpGENOME Unmethylated DNA) were included in all the analyses as internal controls (Chemicon International, Temecula, CA, USA). The PCR products were visualized with UV illumination on a 2.5% agarose gel. The results of the methylation analyses of the hMLH1 and MGMT genes were compared with the intensity of the immunoreaction of the corresponding proteins.5

Mutation analysis

Mutation analyses of BRAF V600E and KRAS were performed by direct sequencing with PCR-amplified template DNA (25 ng), using a dynazyme DNA polymerase kit (Finnzymes Oy, Espoo, Finland). The primers used in the analysis were AAACTCTTCATAATGCTTGCTCTG (forward) and GGCCAAAAATTTAATCAGTGGA (reverse) for BRAF V600E, TGGTGGAGTATTTGATAGTGTA (forward) and ATGGTCCTGCACCAGTAATA (reverse) for KRAS c12/13, and TGAAGTAAAAGGTGCACTGTAATA (forward) and TAAACCCACCTATAATGGTGAA (reverse) for KRAS c59/61. PCR conditions are available on request. The amplifications were performed with a PTC-200 thermal cycler (MJ Research, Waltham, MA, USA). The PCR products were enzymatically purified with EXOSAPit (USB, Cleveland, OH, USA) according to the manufacturer's instructions. Sequencing of the product was performed in both directions on the ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA), with the forward and reverse primers. The data obtained were analysed with CHROMAS 1.6 sequencing analysis software (Technelysium Pty, Halensvale, Australia). All mutations were reconfirmed by independent PCR reactions and sequencing.

Immunohistochemistry

MLH1 and MSH2 analyses were carried out as described previously.5 Briefly, mouse monoclonal antibodies for MLH1 and MSH2 (BD-PharMingen, San Diego, CA, USA) were applied at a dilution of 1:25 (MLH1) or 1:50 (MSH2) for 1 h at room temperature. The reaction in the tumour area was considered to be negative if there was no staining in any of the tumour cell nuclei. For MGMT analysis, tissue sections were pretreated in 0.01 m citrate (pH 6.0) buffer in a microwave oven at 800 W for 2 min and at 300 W for 10 min. Primary antibody for MGMT was applied at a dilution of 1:300 for 1 h at room temperature. A Dako EnVision kit (Dako, Copenhagen, Denmark) was used in the detection of the bound antibodies, with 3,3′-diaminobenzidine as a chromogen. The reaction in the tumour area was considered to be negative if less than 10% of the tumour cell nuclei stained positive.

Statistical analysis

Tests were performed with statistical software (SPSS 16.1; SPSS, Chicago, IL, USA). The chi-square-test or Fisher's exact test were used unless otherwise stated. A P-value of <0.05 was considered to be statistically significant.

Ethical aspects

The protocol (58/2002) was approved by the Ethical Committee of Oulu University Hospital.

Results

The success rates of each DNA analyses are shown in Table 1. Clinicopathological features of the study material are presented in Tables 2 and 3, and examples of serrated adenocarcinomas in relation to KRAS and BRAF mutations and MSI status are illustrated in Figure 1. BRAF and KRAS mutations did not coexist. The prevalence and distribution patterns of BRAF V600E, KRAS c12/13 and KRAS c59/61 mutations are presented in Table 4. BRAF mutations were frequent (33.3%; 14/42) and specific to serrated adenocarcinomas. After a careful histopathological re-evaluation of the cases, three BRAF-mutated cases, originally placed in the control group, were reclassified as serrated adenocarcinomas because the serrated morphology was preserved in the tumour. KRAS mutations were more frequent in serrated adenocarcinomas (45.2%) than in non-serrated adenocarcinomas (27.1%; P = 0.002). The higher frequency of KRAS mutations was clearly more evident (although not statistically significant) in cancers with a residual serrated adenoma (57.1%, 16/28), being observed twice as often as BRAF mutations (28.6%, 8/28). The combined prevalence of BRAF and KRAS mutations (78.6%) in serrated adenocarcinomas was higher than in non-serrated adenocarcinomas (27.1%; P < 0.001; Table 4), and the combined prevalence of BRAF and KRAS mutations in serrated adenocarcinomas with a residual serrated adenoma component reached 85.7% (24/28). In adenomas, BRAF mutations were specific to serrated adenomas, as none of the non-serrated adenomas showed a BRAF mutation (P = 0.058). Only one non-serrated adenoma carried a KRAS mutation. Either BRAF or KRAS mutation was observed in 82.4% of serrated adenomas (P < 0.001; Table 4).
Table 1

The success rates of DNA analyses

Serrated CRCsMatched non-serrated CRCsAll non-serrated CRCsSerrated adenomasSerrated adenomas adjacent to cancerNon-serrated adenomas
BRAF V600E42/4231/3249/5917/179/99/9

KRAS c12/1342/4232/3245/5917/179/99/9

KRAS c59/6140/4231/3256/5917/178/99/9

MSI analyses37/4230/3256/5911/172/94/9

Methylation analyses
 hMLH127/4229/3251/59

MGMT29/4229/3253/59

CRC, Colorectal carcinoma.

Table 2

The clinical and pathological features of serrated and non-serrated adenocarcinomas

Serrated adenocarcinomas (n = 42)Non-serrated adenocarcinomas (n = 59)P-value (χ2-test)
Mean age in years (range)67.5 (43–85)68.5 (38–88)

Gender, N (%)
 Male17 (40.5)23 (39.0)0.880

 Female25 (59.5)36 (61.0)

Location, N (%)
 Proximal colon24 (57.1)20 (33.9)0.050

 Distal colon6 (14.3)9 (15.3)

 Rectum/rectosigmoid colon12 (28.6)30 (50.8)

Grade, N (%)
 I14 (33.3)11 (18.6)0.085

 II20 (47.6)41 (69.5)

 III8 (19.0)7 (11.9)

Dukes' stage, N (%)
 A6 (14.3)13 (22.0)0.699

 B20 (47.6)23 (39.0)

 C10 (23.8)16 (27.1)

 D6 (14.3)7 (11.9)

Mucinous, N (%)
 No26 (61.9)54 (91.5)<0.001

 Yes16 (38.1)5 (8.5)

MSI
 MSI-H7 (18.9)4 (7.1)0.164

 MSS/MSI-L30 (81.1)52 (92.9)

MSI, Microsatellite instability; MSI-H, high-level MSI; MSI-L, low-level MSI.

Table 3

The clinical and pathological features of serrated and non-serrated adenomas

Serrated adenomas (n = 26)*Non-serrated adenomas (n = 9)P-value (χ2-test)
Mean age in years (range)64.1 (36–84)*74.1 (60–83)

Gender, N (%)
 Male13 (50.0)8 (90)0.040

 Female13 (50.0)1 (10)

Location, N (%)
 Proximal colon6 (20)0 (0)0.396

 Distal colon4 (5)2 (20)

 Rectum/rectosigmoid colon16 (75)7 (80)

Dysplasia, N (%)
 Mild6 (35)3 (40)0.024

 Moderate8 (25)6 (60)

 Severe12 (40)0 (0)

All serrated adenomas, including adenomas adjacent to cancer (n = 9).

Table 4

The prevalence and distribution of BRAF V600E and KRAS (codons 12/13 and 59/61) mutations according to the type of neoplasm

BRAFV 600EKRAS (all)KRAS c12/13KRAS c59/61Either BRAF or KRAS
Serrated adenocarcinomas (n = 42)

No adjacent adenoma component (n = 14)
 With mutation/all6/143/142/141/149/14

 %42.921.414.37.164.3

With adjacent serrated adenoma (n = 28)
 With mutation/all8/2816/2815/281/2824/28

 %28.657.153.63.685.7

All (n = 42)
 With mutation/all14/4219/4217/422/4233/42

 %33.345.240.54.878.6

Matched non-serrated carcinomas (n = 32)
 With mutation/all0/3213/3212/321/3213/32

 %040.637.53.140.6

P<0.0010.8941.000.842<0.001

All non-serrated carcinomas (n = 59)
 With mutation/all0/5916/5915/591/5916/59

 %027.125.41.727.1

P<0.0010.0020.0020.848<0.001

Serrated adenomas (n = 17)
 With mutation/all7/177/176/171/1714/17

 %41.241.235.35.982.4

Non-serrated adenomas (n = 9)
 With mutation/all0/91/91/90/91/9

 %011.111.1011.1

P0.0580.2430.4531<0.001

Serrated adenomas adjacent to cancer (n = 9)
 With mutation/all2/94/93/91/96/9

 %22.244.433.311.166.7

P0.0680.3530.60.4360.001
The success rates of DNA analyses CRC, Colorectal carcinoma. The clinical and pathological features of serrated and non-serrated adenocarcinomas MSI, Microsatellite instability; MSI-H, high-level MSI; MSI-L, low-level MSI. The clinical and pathological features of serrated and non-serrated adenomas All serrated adenomas, including adenomas adjacent to cancer (n = 9). The prevalence and distribution of BRAF V600E and KRAS (codons 12/13 and 59/61) mutations according to the type of neoplasm Among non-serrated adenocarcinomas, KRAS c12/13 and c59 mutations were found in 16 cases (Table 4). The mutation pattern of KRAS c12/13 and c59/61 is shown in Table 5. The c12 G→A transitions were found in 52.6% (10/19) of KRAS-mutated serrated adenocarcinomas and in 12.5% (2/16; P = 0.047) of KRAS-mutated non-serrated cancers. This transition showed a distinct association with serrated adenocarcinomas, being present in 24% of cases (10/42), but in only 3.4% of non-serrated carcinomas (2/59; P = 0.001; Fisher's exact test).
Table 5

The observed sequence changes and the corresponding amino acid substitutions in KRAS c12/13 and c59/61 in the study population

KRAS c12/13 and c59/61 sequence changeAmino acid changeSerrated adenocarcinomas, N (%)Non-serrated adenocarcinomas, N (%)Total, N (%)P-value (Fisher's exact test)Serrated adenomasNon-serrated adenomasTotalP-value (Fisher's exact test)
c12 GGT→GTTGly→Val4 (21.1)7 (43.8)11 (31.4)0.0474 (36.4)0 (0)4 (33.3)1.00


c12 GGT→TGTGly→Cys1 (5.3)3 (18.8)4 (11.4)0 (0)0 (0)0 (0)


c12 GGT→GATGly→Asp10 (52.6)2 (12.5)12 (34.3)4 (36.4)1 (100)5 (41.7)


c13 GGC→GACGly→Asp2 (10.5)3 (18.8)5 (14.3)1 (9.1)0 (0)1 (8.3)


c59 GCA→GGAAla→Gly0 (0)1 (6.3)1 (2.9)0 (0)0 (0)0 (0)


c61 CAA→AAAGln→Lys2 (10.5)0 (0)2 (5.7)2 (18.2)0 (0)2 (16.7)


Total19 (100)16 (100)35 (100)11 (100)1 (100)12 (100)
The observed sequence changes and the corresponding amino acid substitutions in KRAS c12/13 and c59/61 in the study population The MSI analyses in carcinoma material were successful in 93 cases (Table 1). Concurrent data from the MSI analyses and the KRAS/BRAF mutation analyses were obtained in 74 carcinoma cases (Table 6). Five BRAF mutations and one KRAS c61 mutation were observed among 11 MSI-H cancers when unmatched cases were included (P = 0.007) (Table 6). Serrated adenocarcinomas presenting with MSI-H were unlikely to be hereditary non-polyposis CRC cases. They occurred in old patients (Table 7) and presented with an adjacent sessile serrated adenoma (cases 1 and 5 in Table 7) or traditional serrated adenoma (cases 2, 3 and 6 in Table 7). Sixty-three MSS/MSI-L cancers showed an almost equal distribution of the wild-type cancers and KRAS-mutated cancers (P = 0.007; Table 6).
Table 6

The prevalences of BRAF V600E and KRAS mutations in serrated and non-serrated adenomas and adenocarcinomas with high-level microsatellite instability (MSI-H) and microsatellite stability (MSS)/low-level microsatellite instability (MSI-L)

MutationAll, NMSS/MSI-L, n (%)MSI-H, n (%)P-value (Fisher's exact test)
All CRCBRAF V600E mutation127 (58.3)5 (41.7)0.007

KRAS c12/13 or c59/61 mutation3130 (96.8)1 (3.2)

Wild type3126 (83.9)5 (16.1)

Serrated CRC with their matched controlsBRAF V600E mutation127 (58.3)5 (41.7)0.008

KRAS c12/13 or c59/61 mutation2928 (96.5)1 (3.5)

Wild type2318 (78.3)5 (21.7)

Serrated CRCBRAF V600E mutation127 (58.3)5 (41.7)0.075

KRAS c12/13 or c59/61 mutation1615 (93.8)1 (6.2)

Wild type65 (83.3)1 (16.7)

Non-serrated CRCBRAF V600E mutation00 (0)0 (0)0.278

KRAS c12/13 or c59/61 mutation1515 (100)0 (0)

Wild type2521 (84)4 (16.0)

Matched non-serrated CRCsBRAF V600E mutation00 (0)0 (0)0.113

KRAS c12/13 or c59/61 mutation1313 (100)0 (0)

Wild type1713 (76.5)4 (23.5)

All adenomasBRAF V600E mutation44 (100)0 (0)0.588

KRAS c12/13 or c59/61 mutation77 (100)0 (0)

Wild type65 (83.3)1 (16.7)

Serrated adenomasBRAF V600E mutation44 (100)0 (0)NA

KRAS c12/13 or c59/61 mutation77 (100)0 (0)

Wild type22 (100)0 (0)

Non-serrated adenomasBRAF V600E mutation00 (0)0 (0)NA

KRAS c12/13 or c59/61 mutation00 (0)0 (0)

Wild type43 (75)1 (25.0)

CRC, Colorectal carcinoma; NA, not applicable.

Table 7

Features of serrated (n = 7) and non-serrated (n = 4) cancers with high-level microsatellite instability with respect to cancer and family history, mutation status of KRAS/BRAF, MLH1/MSH2 immunohistochemistry, and hMLH1 methylation

CaseType of carcinomaAge (years)Family history of cancerOther cancers in patientMutation status of KRAS/BRAFhMLH1 immunohistochemistryMSH2 immunohistochemistryhMLH1 methylation
1Serrated78Not knownNoWild typeNo

2Serrated85Not knownNoBRAF V600E+Yes

3Serrated84Not knownYes, skinKRAS c59/61+Yes

4Serrated71Not knownYes, breastBRAF V600E+Yes

5Serrated68Yes, CRCNoBRAF V600E+Yes

6Serrated60Not knownNoBRAF V600E++Yes

7Serrated83Not knownNoBRAF V600E+Yes

8Non-serrated73Not knownNoWild type+No

9Non-serrated72Not knownNoWild type+No

10Non-serrated71Not knownNoWild type+No

11Non-serrated53Not knownYes, breastWild type+No

CRC, Colorectal carcinoma.

The prevalences of BRAF V600E and KRAS mutations in serrated and non-serrated adenomas and adenocarcinomas with high-level microsatellite instability (MSI-H) and microsatellite stability (MSS)/low-level microsatellite instability (MSI-L) CRC, Colorectal carcinoma; NA, not applicable. Features of serrated (n = 7) and non-serrated (n = 4) cancers with high-level microsatellite instability with respect to cancer and family history, mutation status of KRAS/BRAF, MLH1/MSH2 immunohistochemistry, and hMLH1 methylation CRC, Colorectal carcinoma. Seven of 34 serrated adenocarcinomas showed MSI-H (20.6%), and five of them (71.4%) had a concurrent BRAF mutation (P = 0.075; Table 6). One MSI-H case was wild type for both BRAF and KRAS, and another showed a KRAS mutation at codon 61. KRAS c12/13 mutations in serrated adenocarcinomas were never accompanied by MSI-H, in contrast to 15/27 (55.6%) of MSS/MSI-L cases harbouring a KRAS mutation (P = 0.075). In non-serrated adenocarcinomas, MSI-H and KRAS mutations did not co-occur (P = 0.278). Analyses with the matched controls yielded similar results (not shown). Promoter methylation analysis was successful in 78/101 cases for hMLH1 and in 82/101 cases for MGMT (Table 1). The relationships between BRAF and KRAS mutations and hMLH1 and MGMT methylation status are summarized in Table 8. BRAF mutations were tightly associated with hMLH1 and MGMT methylation, whereas KRAS mutations had a negative correlation with hMLH1 and MGMT methylation (Table 8). The loss of MGMT expression in immunohistochemistry was associated with the corresponding methylation of the MGMT gene (P < 0.0001; Table 9). In MSS cancers, the presence of hMLH1 and MGMT methylation did not correspond to the loss of immunohistochemical expression (not shown), suggesting incomplete methylation of hMLH1.
Table 8

Mutation status of BRAF and KRAS according to the promoter methylation status of hMLH1 and MGMT in serrated and non-serrated cancers

hMLH1 methylationMGMT methylation


YesNoAll, NYesNo




All, Nn (%)n (%)P-valueAll, Nn (%)n (%)P-value
Serrated adenocarcinoma
BRAF V600E1010 (100)0 (0.0)0.0011110 (90.9)1 (9.1)0.019


Wild-type BRAF176 (35.3)11 (64.7188 (44.4)10 (55.6)

KRAS c12/13 or c59/61135 (38.5)8 (61.5)0.034145 (35.5)9 (64.3)0.005


Wild-type KRAS (all)1411 (78.6)3 (21.4)1513 (86.7)2 (13.3)

All non-serrated cancers
BRAF V600E000NA000NA


Wild-type BRAF4310 (23.3)33 (76.7)4318 (41.9)25 (58.1)

KRAS c12/13 or c59/61161 (6.3)15 (93.8)0.108163 (18.8)13 (81.3)0.084


Wild-type KRAS (all)257 (28.0)18 (72.0)2513 (52.0)12 (48.0)

Matched non-serrated cancers
BRAF V600E000NA000NA


Wild-type BRAF285 (17.9)23 (82.1)2814 (25.0)14 (25.0)

KRAS c12/13 or c59/61131 (7.7)12 (92.3)0.343153 (23.1)10 (76.9)0.014


Wild-type KRAS (all)164 (25.0)12 (75.0)1611 (68.8)5 (31.2)

NA, Not applicable.

Table 9

The correlation of MGMT/hMLH1 promoter methylation with the immunoreaction of the corresponding proteins in all cancers, serrated cancers and their matched controls

MGMT expression*hMLH1 expression


Promoter methylation of MGMT/hMLH1All, NPositiveNegativeP-value (Fisher's exact test)All, NPositiveNegativeP-value (Fisher's exact test)
All casesUnmethylated45450<0.0001524840.086


Unmethylated and methylated2721625214


Methylated1156532

Serrated CRCUnmethylated131300.041131210.186


Unmethylated and methylated1713414113


Methylated422422

Matched controlsUnmethylated161600.013242130.553


Unmethylated and methylated642431


Methylated633110

For *MGMT immunoreaction, tumour tissue presenting over 10% of positive cells was considered to be positive.

CRC, Colorectal carcinoma.

Mutation status of BRAF and KRAS according to the promoter methylation status of hMLH1 and MGMT in serrated and non-serrated cancers NA, Not applicable. The correlation of MGMT/hMLH1 promoter methylation with the immunoreaction of the corresponding proteins in all cancers, serrated cancers and their matched controls For *MGMT immunoreaction, tumour tissue presenting over 10% of positive cells was considered to be positive. CRC, Colorectal carcinoma. Our findings fit relatively well with the molecular classification of CRC proposed by Jass6 (Table 10). We were able to show that Jass groups 1 and 2 definitely represent serrated adenocarcinomas, but KRAS-mutated cases belonging to Jass group 3 were composed of serrated and non-serrated cancers. Most Jass group 4 tumours could be classified as non-serrated, and most cases in Jass group 5 were probably Lynch syndrome cases, except for one case presenting with a typical serrated growth pattern and residual serrated adenoma (illustrated in Figure 1G,H).
Table 10

The distribution of serrated and non-serrated cancers according to the Jass classification

Putative Jass group

Group 1Group 2Group 3Group 4Group 5Unclassified






MSI-H and BRAF V600E mutationMSS/MSI-L and BRAF V600E mutationMSS/MSI-L and KRAS mutationMSS/MSI-L, wild-type KRAS and wild-type BRAFMSI-H, wild-type KRAS and wild-type BRAFMSI-H and KRAS mutationAll

n (%)n (%)n (%)n (%)n (%)n (%)N
Serrated CRC5 (14.7)7 (20.6)15 (44.1)5 (14.8)1* (2.9)1 (2.9)34

Non-serrated CRC0 (0)0 (0)15 (37.5)21 (52.5)4 (10)0 (0)40

P < 0.0001, exact contingency table. Groups 1–5 follow the original categorization of Jass,6 with the exception of CpG island hypermethylation status and the methylation status of hMLH1 and MGMT, which are not included in the definitions of the groups.

Single case of serrated adenocarcinoma, bearing no evidence of hereditary non-polyposis CRC, is also illustrated in Figure 1G,H, and its clinical characteristics are shown in Table 7.

CRC, Colorectal carcinoma; MSI-H, high-level microsatellite instability; MSI-L, low-level microsatellite instability; MSS, microsatellite stability.

The distribution of serrated and non-serrated cancers according to the Jass classification P < 0.0001, exact contingency table. Groups 1–5 follow the original categorization of Jass,6 with the exception of CpG island hypermethylation status and the methylation status of hMLH1 and MGMT, which are not included in the definitions of the groups. Single case of serrated adenocarcinoma, bearing no evidence of hereditary non-polyposis CRC, is also illustrated in Figure 1G,H, and its clinical characteristics are shown in Table 7. CRC, Colorectal carcinoma; MSI-H, high-level microsatellite instability; MSI-L, low-level microsatellite instability; MSS, microsatellite stability.

Discussion

This is the first study to show that KRAS mutations are frequent (45%) in serrated adenocarcinomas, and that the MAPK activation resulting from either KRAS or BRAF mutations is very common (79%) in serrated adenocarcinomas. Earlier studies have claimed that BRAF predominates over KRAS in biological significance in the serrated pathway,17,23 because: (i) BRAF mutations are specific to serrated polyps and serrated adenocarcinoma; (ii) malignant serrated endpoints presenting with KRAS mutations have not been reported until now; and (iii) there has been no previous evidence that KRAS-mutated CRCs emerge from two separate molecular pathways. Sporadic MSI-H cancers have been attributed to the serrated pathway.5,14,17,24,25 In our study, MSI-H was seen in only 20.6% of serrated adenocarcinomas. A distinct association of BRAF mutations with MSI-H and the methylation of hMLH1 and MGMT was observed among serrated cases, thus corroborating the idea that BRAF-mutated CRCs (Jass groups 1 and 2) represent serrated adenocarcinomas with high accuracy,6,14,26 but the relatively low frequency of MSI-H cancers among serrated adenocarcinomas indicates that sporadic MSI-H colorectal cancers can be attributed only to a subset of serrated adenocarcinomas.4,5,14 The serrated adenocarcinoma cases presenting with a residual adenoma component undoubtedly showed KRAS mutations (57.1%) to be twice as frequent as BRAF mutations (28.6%) in serrated adenocarcinomas. Either KRAS or BRAF mutation was observed in 85.7% of these cases, and in 82.4% of the serrated adenomas. These numbers suggest that MAPK activation is central for the serrated adenocarcinoma pathway, and that many CRCs with KRAS mutations, MSS/MSI-L and less frequent DNA hypermethylation originate from serrated polyps. KRAS mutations have generally been considered to be characteristic of Vogelstein's adenomacarcinoma model, and the integration of KRAS mutation in the model was justified by the high frequency of KRAS mutations in CRCs. Recent, well-conducted studies based on extensive case series – carried out after the recognition of serrated adenomas – have repeatedly found that KRAS mutations are rare in tubular adenomas, which constitute 85–90% of colorectal non-serrated adenomas.27,28 Barry et al.28 documented a 3% frequency of KRAS mutations in a prospective study of 303 adenomas, most mutations being observed in sessile and tubulovillous adenomas. Only two of 259 tubular adenomas (0.8%) harboured a KRAS mutation. Maltzman et al.27reported a 10.6% frequency for KRAS mutations in tubular adenomas. The high frequency of KRAS mutations in serrated adenomas and serrated adenocarcinomas observed in the present study explains, in part, why KRAS mutations are less frequent in non-serrated adenomas but occur in abount 40% of CRCs. The high frequency of KRAS mutations in serrated adenocarcinomas further strengthens the importance of the colorectal serrated pathway. The estimated 15–20% frequency of serrated adenocarcinomas is based on the frequency of sporadic BRAF-mutated, CIM-positive CRCs.4 If KRAS-mutated serrated adenocarcinomas were taken into account, the proportion of the serrated pathway could reach 30% of all CRCs: KRAS mutations are more frequent in serrated polyps than in non-serrated adenomas, being observed in up to 37% of hyperplastic polyps, in up to 60% of admixed polyps, and in up to 80% of traditional serrated adenomas.4,16 The given frequencies of 30–50% for KRAS mutations for all colorectal cancers and 45% for serrated adenocarcinomas allow an assumption that 15–30% of KRAS-mutated CRCs may evolve from serrated adenomas, if we consider that the serrated pathway represents 15–20% of colorectal cancers.4 A similar conclusion can be drawn on the basis of polyp demographics. If traditional serrated adenomas represent 3% and non-serrated adenomas 85% of all polyps, then the 80%KRAS mutation rate in traditional serrated adenomas and the 3% mutation rate in non-serrated adenomas would yield KRAS-mutated polyps in roughly equal numbers (2.4% and 2.6% of all polyps, respectively). It must be emphasized that serrated adenocarcinoma has not been considered as an entity in any of the previous studies on the frequency and pathogenesis of KRAS-mutated CRCs.29–31 This should be kept in mind when interpreting previous data on the KRAS mutation rate in CRCs. The Vogelstein adenomacarcinoma model, published in 1990, was constructed ahead of the description of serrated adenomas in the same year. Therefore, it is likely that the Vogelstein model was originally contaminated by observations on (traditional) serrated adenomas bearing KRAS mutations misclassified as non-serrated adenomas. The most frequent KRAS mutation in codons 12/13 are c12 2G→A (31–38%), c12 2G→T (21–31%), c13 2G→A (13–21%), and c12 1G→T (7–10%).29–31 The relative proportions of specific types of KRAS mutations that we identified were similar to those previously described (Table 5). However, the c12 G→A transition was almost completely specific to serrated adenocarcinomas, being present in 24% (10/42) of the cases, whereas in non-serrated carcinomas it was present in only 3% (2/59) of cases (P = 0.001). Therefore, it is likely that many CRCs with the KRAS c12 G→A transversion represent serrated adenocarcinomas. Besides providing a potential genetic marker for the serrated adenocarcinomas, the specificity of the c12 G→A transition may indicate the occurrence of specific aetiological factors, such as endogenous environmental or endogenous alkylating agents.22,32 The specificity of G→A transitions to serrated adenocarcinomas justifies the analysis of specific environmental risk factors, such as smoking, as possible causative agents. In conclusion, the cumulative 79–82% frequency of BRAF and KRAS mutations in serrated adenocarcinoma and its precursors observed in our study underlines the importance of MAPK pathway activation in the serrated pathway, and suggests that these mutations are the driver mutations in the serrated pathway. The co-occurrence of BRAF mutations, CIM and MSI-H represents an easily identifiable subset of serrated adenocarcinoma, and BRAF mutation analysis can be utilized to detect these cases. However, the high frequency of KRAS mutations, particularly the c12 G→A transition, in serrated neoplasms emphasizes that KRAS mutation is an even more important alteration in the serrated pathway. Many KRAS-mutated CRCs originate from serrated polyps, and complete removal and follow-up of serrated adenomas with KRAS mutations is therefore essential to reduce the total CRC burden. The high frequency of KRAS mutations in serrated adenocarcinomas also indicates that most serrated adenocarcinomas are natively insensitive to epidermal growth factor receptor-blocking therapies, which are increasingly being used to treat metastatic colorectal cancer.33,34
  32 in total

1.  Relationship of Ki-ras mutations in colon cancers to tumor location, stage, and survival: a population-based study.

Authors:  W S Samowitz; K Curtin; D Schaffer; M Robertson; M Leppert; M L Slattery
Journal:  Cancer Epidemiol Biomarkers Prev       Date:  2000-11       Impact factor: 4.254

2.  Colorectal carcinoma associated with serrated adenoma--prevalence, histological features, and prognosis.

Authors:  M J Mäkinen; S M George; P Jernvall; J Mäkelä; P Vihko; T J Karttunen
Journal:  J Pathol       Date:  2001-03       Impact factor: 7.996

3.  Features of colorectal cancers with high-level microsatellite instability occurring in familial and sporadic settings: parallel pathways of tumorigenesis.

Authors:  J Young; L A Simms; K G Biden; C Wynter; V Whitehall; R Karamatic; J George; J Goldblatt; I Walpole; S A Robin; M M Borten; R Stitz; J Searle; D McKeone; L Fraser; D R Purdie; K Podger; R Price; R Buttenshaw; M D Walsh; M Barker; B A Leggett; J R Jass
Journal:  Am J Pathol       Date:  2001-12       Impact factor: 4.307

Review 4.  DNA alkylation and repair in the large bowel: animal and human studies.

Authors:  Andrew C Povey; Alaa F Badawi; Donald P Cooper; C Nicholas Hall; Kathryn L Harrison; Peta E Jackson; Nicholas P Lees; Peter J O'Connor; Geoffrey P Margison
Journal:  J Nutr       Date:  2002-11       Impact factor: 4.798

5.  Ki-ras proto-oncogene mutations in sporadic colorectal adenomas: relationship to histologic and clinical characteristics.

Authors:  T Maltzman; K Knoll; M E Martinez; T Byers; B R Stevens; J R Marshall; M E Reid; J Einspahr; N Hart; A K Bhattacharyya; C B Kramer; R Sampliner; D S Alberts; D J Ahnen
Journal:  Gastroenterology       Date:  2001-08       Impact factor: 22.682

6.  Characterisation of a subtype of colorectal cancer combining features of the suppressor and mild mutator pathways.

Authors:  J R Jass; K G Biden; M C Cummings; L A Simms; M Walsh; E Schoch; S J Meltzer; C Wright; J Searle; J Young; B A Leggett
Journal:  J Clin Pathol       Date:  1999-06       Impact factor: 3.411

7.  K-ras oncogene mutations in sporadic colorectal cancer in The Netherlands Cohort Study.

Authors:  Mirian Brink; Anton F P M de Goeij; Matty P Weijenberg; Guido M J M Roemen; Marjolein H F M Lentjes; Marco M M Pachen; Kim M Smits; Adriaan P de Bruïne; R Alexandra Goldbohm; Piet A van den Brandt
Journal:  Carcinogenesis       Date:  2003-04       Impact factor: 4.944

8.  Molecular characteristics of serrated adenomas of the colorectum.

Authors:  E J Sawyer; A Cerar; A M Hanby; P Gorman; M Arends; I C Talbot; I P M Tomlinson
Journal:  Gut       Date:  2002-08       Impact factor: 23.059

9.  Mutations of the BRAF gene in human cancer.

Authors:  Helen Davies; Graham R Bignell; Charles Cox; Philip Stephens; Sarah Edkins; Sheila Clegg; Jon Teague; Hayley Woffendin; Mathew J Garnett; William Bottomley; Neil Davis; Ed Dicks; Rebecca Ewing; Yvonne Floyd; Kristian Gray; Sarah Hall; Rachel Hawes; Jaime Hughes; Vivian Kosmidou; Andrew Menzies; Catherine Mould; Adrian Parker; Claire Stevens; Stephen Watt; Steven Hooper; Rebecca Wilson; Hiran Jayatilake; Barry A Gusterson; Colin Cooper; Janet Shipley; Darren Hargrave; Katherine Pritchard-Jones; Norman Maitland; Georgia Chenevix-Trench; Gregory J Riggins; Darell D Bigner; Giuseppe Palmieri; Antonio Cossu; Adrienne Flanagan; Andrew Nicholson; Judy W C Ho; Suet Y Leung; Siu T Yuen; Barbara L Weber; Hilliard F Seigler; Timothy L Darrow; Hugh Paterson; Richard Marais; Christopher J Marshall; Richard Wooster; Michael R Stratton; P Andrew Futreal
Journal:  Nature       Date:  2002-06-09       Impact factor: 49.962

Review 10.  Biomarkers predicting clinical outcome of epidermal growth factor receptor-targeted therapy in metastatic colorectal cancer.

Authors:  Salvatore Siena; Andrea Sartore-Bianchi; Federica Di Nicolantonio; Julia Balfour; Alberto Bardelli
Journal:  J Natl Cancer Inst       Date:  2009-09-08       Impact factor: 13.506

View more
  29 in total

1.  Annexin A10 is a marker for the serrated pathway of colorectal carcinoma.

Authors:  Sara A Sajanti; Juha P Väyrynen; Päivi Sirniö; Kai Klintrup; Jyrki Mäkelä; Anne Tuomisto; Markus J Mäkinen
Journal:  Virchows Arch       Date:  2014-11-14       Impact factor: 4.064

Review 2.  Extent of field change in colorectal cancers with BRAF mutation.

Authors:  Aaron Poh; Heidi Sian Ying Chang; Kok Yang Tan; Xin Xiu Sam; Avery Khoo; Shoa Nian Choo; Min En Nga; Wei Keat Wan
Journal:  Singapore Med J       Date:  2017-02-17       Impact factor: 1.858

3.  Downregulation of the hedgehog receptor PTCH1 in colorectal serrated adenocarcinomas is not caused by PTCH1 mutations.

Authors:  Karoliina Stefanius; Tiina Kantola; Anne Tuomisto; Pia Vahteristo; Tuomo J Karttunen; Lauri A Aaltonen; Markus J Mäkinen; Auli Karhu
Journal:  Virchows Arch       Date:  2011-01-14       Impact factor: 4.064

4.  Distinct histopathological characteristics in colorectal submucosal invasive carcinoma arising in sessile serrated adenoma/polyp and conventional tubular adenoma.

Authors:  Takashi Murakami; Hiroyuki Mitomi; Takashi Yao; Tsuyoshi Saito; Tomoyoshi Shibuya; Naoto Sakamoto; Taro Osada; Sumio Watanabe
Journal:  Virchows Arch       Date:  2017-09-19       Impact factor: 4.064

5.  Novel anti-invasive properties of a Fascin1 inhibitor on colorectal cancer cells.

Authors:  Silvia Montoro-García; Begoña Alburquerque-González; Ángel Bernabé-García; Manuel Bernabé-García; Priscila Campioni Rodrigues; Helena den-Haan; Irene Luque; Francisco José Nicolás; Horacio Pérez-Sánchez; María Luisa Cayuela; Tuula Salo; Pablo Conesa-Zamora
Journal:  J Mol Med (Berl)       Date:  2020-01-29       Impact factor: 4.599

Review 6.  Serrated Colorectal Cancer: The Road Less Travelled?

Authors:  Yuki Nakanishi; Maria T Diaz-Meco; Jorge Moscat
Journal:  Trends Cancer       Date:  2019-10-28

Review 7.  Sweating the small stuff: microRNAs and genetic changes define pancreatic cancer.

Authors:  Siuwah Tang; Jillian Bonaroti; Sebnem Unlu; Xiaoyan Liang; Daolin Tang; Herbert J Zeh; Michael T Lotze
Journal:  Pancreas       Date:  2013-07       Impact factor: 3.327

8.  A clinicopathological and molecular analysis of 200 traditional serrated adenomas.

Authors:  Mark L Bettington; Neal I Walker; Christophe Rosty; Ian S Brown; Andrew D Clouston; Diane M McKeone; Sally-Ann Pearson; Kerenaftali Klein; Barbara A Leggett; Vicki L J Whitehall
Journal:  Mod Pathol       Date:  2014-09-12       Impact factor: 7.842

9.  VE1 immunohistochemistry accurately detects BRAF V600E mutations in colorectal carcinoma and can be utilized in the detection of poorly differentiated colorectal serrated adenocarcinoma.

Authors:  Sara Sajanti; Päivi Sirniö; Juha P Väyrynen; Anne Tuomisto; Kai Klintrup; Jyrki Mäkelä; Ari Ristimäki; Markus J Mäkinen
Journal:  Virchows Arch       Date:  2014-04-11       Impact factor: 4.064

10.  Detection of Circulating BRAF(V600E) in Patients with Papillary Thyroid Carcinoma.

Authors:  Carrie C Lubitz; Sareh Parangi; Tammy M Holm; M Jordana Bernasconi; Aislyn P Schalck; Hyunsuk Suh; Konstantinos P Economopoulos; Viswanath Gunda; Samuel E Donovan; Peter M Sadow; Lori J Wirth; Ryan J Sullivan; David J Panka
Journal:  J Mol Diagn       Date:  2015-11-26       Impact factor: 5.568

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.