Literature DB >> 21437200

Absence of Vsx1 expression in the normal and damaged mouse cornea.

Tom Watson1, Robert L Chow.   

Abstract

PURPOSE: To examine the expression of visual system homeobox 1 (Vsx1) in the mouse cornea and its potential role in the corneal wound response pathway.
METHODS: Expression of Vsx1 was examined by quantitative reverse-transcription PCR (qRT-PCR) in corneal tissue from developing and adult mice and from mice that had undergone alkali-burn corneal wounding. Immunolabeling and Vsx1 knock-in reporter gene expression in wild type and Vsx1 null-mice were used to confirm the qRT-PCR data.
RESULTS: Using qRT-PCR, Vsx1 expression was not detected in either the postnatal or adult mouse cornea or in corneas following wounding. This qRT-PCR data was supported by the absence of specific Vsx1 immunolabeling and Vsx1 knock-in reporter expression in untreated and wounded corneas.
CONCLUSIONS: In mice, Vsx1 mRNA, protein or reporter gene expression is not detected in the normal or damaged cornea. These results make it uncertain what role VSX1/Vsx1 plays in corneal biology. Future experiments examining the pathogenicity of VSX1 mutations associated with corneal dystrophy are required to rule out species differences and possible non-cell autonomous roles for VSX1 in the cornea.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21437200      PMCID: PMC3062518     

Source DB:  PubMed          Journal:  Mol Vis        ISSN: 1090-0535            Impact factor:   2.367


Introduction

Visual system homeobox 1 (Vsx1) is a paired-like homeobox gene, initially described in the goldfish retina [1] and later as RINX in the human retina [2]. In mice, Vsx1 expression is first detected in the developing retinal inner nuclear layer (INL) cells at postnatal day 5 [3]. In the mature retina, Vsx1 expression persists in the INL and is expressed in a subset ON and OFF cone bipolar cells [3,4]. Vsx1 has been found to play a central role in bipolar cell differentiation. In Vsx1 null mice bipolar cells are specified properly, but exhibit terminal differentiation defects characterized by reduced levels of bipolar marker expression in OFF cone bipolar cells [4,5]. Accompanying these defects in bipolar cell marker expression, Vsx1 null mice have visual signaling defects that include a reduced electroretinogram b-wave and reduced OFF ganglion cell signaling, indicating a role for Vsx1 in OFF bipolar cell function. Despite the well characterized role for Vsx1 in mouse retinal bipolar cells, the role of VSX1/Vsx1 in human corneal disease is controversial. Eight dominant VSX1 missense mutations associated with Posterior Polymorphous Corneal Dystrophy 1 (PPCD1; OMIM 122000) and keratoconus (OMIM 148300) have been identified [6-9]. Several of these mutations are compelling in that they alter highly conserved amino acid residues and/or are accompanied by electroretinogram defects indicative of retinal bipolar cell dysfunction as is observed in Vsx1 null mice [4,5]. In contrast, other studies examining sporadic or familial keratoconus [10-13] and PPCD1 [14-16] have failed to reveal VSX1 mutations. In addition, while VSX1 corneal expression has been reported in adult [17] and neonatal [18] human cornea, other studies in mouse [3] and human [7,16,19] have failed to detect VSX1/Vsx1 expression in the mature cornea. Interestingly, it has been reported that VSX1 is upregulated in human and mouse corneal stromal keratocytes following corneal wounding [19]. This has led to the suggestion that VSX1 functions as a corneal damage response gene and that corneal dystrophies associated with changes in VSX1 are linked to defects in the corneal wound-healing pathway [19]. To investigate the role of Vsx1 in the mouse cornea, we undertook a quantitative RT–PCR (qRT–PCR) approach to characterize the expression of Vsx1 in the developing and mature mouse cornea. Vsx1 expression was also examined in corneal tissue from mice that underwent alkali-burn corneal-wounding. qRT–PCR data on untreated and wounded corneas was complemented by immunohistological and Vsx1 knock-in reporter gene expression studies. Using these approaches, we failed to detect Vsx1 expression in both untreated and wounded corneas. Our findings make it uncertain what role, if any, Vsx1 plays in the mouse cornea.

Methods

Animals

All experiments on wild type mice were performed on 129S1 inbred mice (The Jackson Laboratory, Bar Harbor, ME). Vsx1:τLacZ knock-in mice [4] were maintained on a 129S1 genetic background. All mouse work was done with approval from the University of Victoria Animal Care Committee, in accordance with the Canadian Council for Animal Care.

RNA extraction

Mice were euthanized by cervical dislocation and tissues dissected in chilled phosphate buffered saline (PBS), transferred to 2 ml microcentrifuge tubes containing 1 ml Trizol (Invitrogen, Carlsbad, CA) and Precellys CK28 ceramic beads (Precellys, Montigny-le-Bretonneux, France) and then frozen on dry ice. Tissue homogenization was performed on a Precellys-24 homogenizer using two 10-s pulses. Homogenized tissue was spun for 10 min at 12,000× g at 2–8 °C, the supernatant transferred into fresh tubes and then kept at room temperature for 5 min. Next, 0.2 ml chloroform was added per ml of Trizol in the initial tubes, the tubes shaken, left to sit for 3 min at room temperature and then samples were centrifuged at 12,000× g for 15 min at 2–8 °C. The upper aqueous phase was then transferred into a fresh tube, 0.5ml isopropyl alcohol was added and samples were mixed by shaking. Following 10 min at room temperature and a 10-min centrifuge at 2–8 °C, 12,000× g, the supernatant was removed and resulting RNA pellet was washed using 75% ethanol before being stored in distilled RNase/DNase-free water (Gibco, Invitrogen,  Carlsbad, CA).

qRT–PCR

Primers for Vsx1 were designed using Primer 3Plus software while those for housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (Gapdh), myofibroblast marker alpha-smooth muscle actin (Acta2) and rhodopsin (Rho) were taken from the literature (Table 1) [20-22]. Specific amplification was verified through comparison of PCR product sequences against published cDNA sequences. Cloning for sequencing was preformed using pGEMT Easy Vector protocol (Promega, Madison, WI) and QIAprep Miniprep kit (Qiagen Inc., Mississauga, Ontario). RT reactions were preformed as per Quantitect Reverse Transcription kit (Qiagen) protocol and reactions run as per Quantitect SYBR Green PCR kit (Qiagen): 15 min 95 °C, 35× (15 s 94 °C, 30 s 60 °C, 30 s 72 °C) using a Stratagene Mx300p (Agilent Technologies, Inc., Santa Clara, CA). Relative expression between samples was calculated using the 2-ΔΔCt method [23] using the housekeeping gene GAPDH to normalize.
Table 1

Sequence and details of qRT–PCR primers.

GenePrimerSequenceNotes
Vsx1 primer pair 1
forward
TATGCCCCGTTTTAGTCTGG
both primers within exon 5; 143 bp product

reverse
CCCAAAACAGACAACCCTTC

Vsx1 primer pair 2
forward
GGTTTTCACTGCCCATCAAC
reverse primer spans exon 3/4 junction; 109 bp product

reverse
TTCCGGGAGCTCTGTTTTC

Vsx1 primer pair 3
forward
TGGGGATGCATAAAAAGTCC
forward primer spans 4/5 junction; 146 bp product

reverse
GTTCTGGGTTGTTTCGTCTG

Gapdh
forward
TGTGTCCGTCGTGGATCTGA
77 bp product [20]

reverse
CCTGCTTCACCACCTTCTTGA

Rho (rhodopsin)
forward
TTGCCACACTTGGAGGTGAA
forward primer spans exon 1/2 junction, 70 bp product [21]

reverse
ACCACCACGTAGCGCTCAAT

Acta2 (alpha 2-SMA)
forward
ACTGGGACGACATGGAAAAG
240 bp product [22]
reverseCATCTCCAGAGTCCAGCACA

Corneal wounding procedure

Our alkali-burn corneal wounding protocol was based on previously published protocols [24,25]. Briefly, 4 μl of 0.2 M NaOH was applied to the corneas of anesthetized mice for 30 s followed by flushing with 10 ml of saline solution. Mice were then euthanized using cervical dislocation at desired time points post-wounding. Mice undergoing the wounding procedure were injected subcutaneously with buprenorphine (0.1 mg/kg) pre-wounding, and every 12 h for up to 3 days after the procedure to provide analgesia. One drop of Proparacaine was also applied to eyes immediately before NaOH application as a topical anesthesia. All mice were monitored throughout the experiments in accordance with University of Victoria animal care guidelines.

Immunolabeling

Eyes removed from euthanized mice were transferred to chilled PBS and bisected longitudinally using scissors to expose inner ocular chambers. Bisected eyes were then fixed for 1 h in 4% paraformaldehyde/PBS on ice followed by washing in PBS and overnight cyroprotection in 30% sucrose/PBS at 4 °C. Tissue was frozen in Tissue-Tek OCT (Sakura Finetek, Torrance, CA) and sectioned at a thickness of 14 μm and stored at −20 °C. Sections were washed with PBS and cleared in 1% Triton X-100/PBS for 30 min. Blocking was performed in 10% horse serum/PBS for 1 h before incubating with primary rabbit anti-Vsx1 antibody [3] used at a 1:100 dilution in 1% horse serum/PBS. Secondary labeling was performed using an Alexa-Fluor-488 conjugated donkey anti-rabbit (1:100 in PBS). Nuclei were stained with Draq-5 (Biostatus, Leicestershire, UK). Slides were imaged using a Nikon confocal microscope (Nikon, Mississauga, Ontario). Post-imaging adjustment of levels in order to observe non-specific labeling was done in Adobe Photoshop (Adobe Systems Incorporated, San Jose, CA) by changing the maximum levels value from 256 to 26.

Results

Analysis of Vsx1 mRNA expression in the postnatal and mature mouse cornea

To examine Vsx1 mRNA expression, 4 primer pairs spanning Vsx1 exons 3–5 were designed. Only 3 of these primer pairs (Figure 1A) robustly amplified products from adult (2–8 months old) retinal cDNA of the predicted size (Figure 1B), with similar efficiencies (Figure 2A) and correct sequence (data not shown). In contrast to the retina, no qRT–PCR product was observed for any of the 3 Vsx1 primer pairs when amplifying from adult corneal cDNA (Figure 2 B, n=3 mice). No specific qRT-PCT product was observed after up to 40 cycles (data not shown).
Figure 1

Vsx1 qRT-PCR primer design. Locations of Vsx1 qRT–PCR primers (see Table 1) on the Vsx1 cDNA (A) and qRT–PCR samples of wild type mouse retina with Vsx1 primers as well as Gapdh housekeeping and Rho sets (B) run on a 1.2% agarose gel. In mRNA schematic: Grey box – homeodomain, open box – CVC domain.

Figure 2

Representative Vsx1 qRT-PCR amplification plots. Amplification plots of qRT–PCR of wild type mouse retinal (A) and corneal (B) samples using primers for Vsx1, Gapdh and Rho shown in Table 1. x-axis shows qRT–PCR cycle number, y-axis shows SYBR-green fluorescence values.

Vsx1 qRT-PCR primer design. Locations of Vsx1 qRT–PCR primers (see Table 1) on the Vsx1 cDNA (A) and qRT–PCR samples of wild type mouse retina with Vsx1 primers as well as Gapdh housekeeping and Rho sets (B) run on a 1.2% agarose gel. In mRNA schematic: Grey box – homeodomain, open box – CVC domain. Representative Vsx1 qRT-PCR amplification plots. Amplification plots of qRT–PCR of wild type mouse retinal (A) and corneal (B) samples using primers for Vsx1, Gapdh and Rho shown in Table 1. x-axis shows qRT–PCR cycle number, y-axis shows SYBR-green fluorescence values. We next examined retinal and corneal cDNA from wild type mice over the course of several postnatal time points (postnatal days 0, 3, 7, 14, and 21; n=3 mice for all time points; Figure 3). Consistent with the previously described onset of Vsx1 expression in mouse at postnatal day 5, retinal expression of Vsx1 was detected in our samples at post-natal day 7 onward. In contrast, no Vsx1 expression was detected in any of the corneal samples. Likewise, Rho (which served as a control for retinal contamination) was absent from the cornea.
Figure 3

Expression of Vsx1 in postnatal mouse retinal and corneal samples relative to P21 levels from qRT–PCR. Three animals were used for each time point. The y-axis shows Vsx1 expression relative to expression on postnatal (P) day 21. x-axis shows postnatal day, tissue, and Vsx1 primer set number.

Expression of Vsx1 in postnatal mouse retinal and corneal samples relative to P21 levels from qRT–PCR. Three animals were used for each time point. The y-axis shows Vsx1 expression relative to expression on postnatal (P) day 21. x-axis shows postnatal day, tissue, and Vsx1 primer set number.

Analysis of Vsx1 mRNA expression following corneal wounding

Corneal wounding experiments were performed on 8 wild type mice with one eye receiving an alkali burn and the other serving as an untreated control (4 mice with treated left eye, 4 with treated right). Wounded corneas appeared cloudy from 1 day post-wounding. Retinal and corneal tissue was taken 3 days after the corneal wounding with NaOH and the wounded morphology of treated corneas was confirmed through examination during dissection (Figure 4A,B). Alkali treated corneas were no longer transparent, appeared thicker and had considerably pitted surfaces compared to the unwounded control eyes from the same mouse. qRT–PCR results found no significant change in Vsx1 expression post-wounding in the retina samples. Vsx1 expression was not observed in untreated or alkali-wounded corneal samples but Acta2, a gene that is known to be upregulated following corneal alkali burn [25] was significantly unregulated by an average of 16.3 times in treated relative to untreated control eyes for both wild type and Vsx1 mice (Figure 4C). A time course experiment set-up identically to the 3 day wounding found no Vsx1 expression in the corneas of wild type mice 6 h, 1 day, 3 days, 7 days or 14 days post-wounding although Acta2 was upregulated in each case (data not shown).
Figure 4

Vsx1 qRT-PCR expression is not detected in the cornea following alkali wounding. orneal wounding was performed through application of 0.2 M NaOH, which resulted in significant structural changes after 3 days between untreated (A) and treated (B) mouse eyes. Relative expression of Vsx1 in wounded versus unwounded eyes, normalized to Gapdh, from retinal and corneal samples is shown along with retinal Rho and Acta2 expression. y-axis shows relative expression between wounded and untreated eyes while the x-axis indicates primer set (Vsx1 sets 1–3, Acta2, and Rho) and tissue (retinal or corneal).

Vsx1 qRT-PCR expression is not detected in the cornea following alkali wounding. orneal wounding was performed through application of 0.2 M NaOH, which resulted in significant structural changes after 3 days between untreated (A) and treated (B) mouse eyes. Relative expression of Vsx1 in wounded versus unwounded eyes, normalized to Gapdh, from retinal and corneal samples is shown along with retinal Rho and Acta2 expression. y-axis shows relative expression between wounded and untreated eyes while the x-axis indicates primer set (Vsx1 sets 1–3, Acta2, and Rho) and tissue (retinal or corneal).

Histological examination of Vsx1 expression following corneal wounding

Immunohistological analysis aimed to confirm the qRT–PCR results in the cornea. No specific Vsx1 immunolabeling was observed in the corneas of alkali-burn wounded or untreated mice as compared to Vsx1 mice, which do not have Vsx1-immunolabeling [4] and therefore serve as a negative control (Figure 5). It was noted that when the post-acquisition imaging pixel intensity level was elevated by an order of magnitude higher than the optimal near-saturation levels used for imaging retinal Vsx1, non-specific labeling was observed in both wild type and Vsx1 alkali-burn treated corneas but not in untreated corneas (Figure 6). We next examined β-galactosidase knock-in reporter expression in normal and wounded corneas of Vsx1 mice. The Vsx1 τLacZ knock-in reporter recapitulates the normal Vsx1 expression pattern in retinal bipolar cells [4] and, although it is present in the developing ventral hindbrain and spinal cord, it is not detected from the embryonic retina and cornea (Figure 7 and data not shown). Similar to the non-specific Vsx1 immunolabeling observed in the wounded cornea, a high degree of non-specific β-galactosidase immunolabeling was also observed in wild type and wounded cornea (data not shown). We therefore examined β-galactosidase activity using the X-gal (5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside) chromogenic substrate. In contrast to robust β-galactosidase activity in the Vsx1 retina, no activity was observed in wounded or untreated corneas (Figure 8).
Figure 5

Vsx1 immunolabeling is not detected in normal or alkali-wounded corneas. sx1 immunolabeling (A, E, I, M, Q) of adult mouse retina (A-H) and cornea (I-T). Vsx1 immunolabeling of bipolar cells is present in wild type retinal section (A-D) but not in Vsx1 mice (E-H). Corneal sections from untreated mice (I-L) and from corneas receiving alkali-burn (M-T) were imaged for Vsx1 immunolabeling using the same imaging settings as those used for imaging retina. Sections were co-labeled with Draq5 nuclear stain.

Figure 6

Non-specific immunolabeling of alkali-wounded corneas. Panels A-C correspond to panels I, M, and Q, respectively, from Figure 5. The image pixel intensity levels have been elevated by an order of magnitude.

Figure 7

Vsx1 knock-in reporter gene expression at embryonic day 11.5. X-gal staining of wild type (A) and Vsx1 (B-D) mouse embryos embryonic day 11.5. Xgal staining is detected in the developing hindbrain (arrows in B and C) and spinal cord but is not detected in the developing eye (A, B - arrowhead). D: Cross-section through the eye of the embryo from panel B shows that ocular expression is undetectable in the developing retina (r), lens (L) and corneal region (c). Scale bar in D=50 μm.

Figure 8

Vsx1 knock-in reporter gene expression is not detected in normal or alkali-wounded corneas. X-gal staining of retina (A), untreated cornea (C) and alkali-burn damaged cornea (D) from Vsx1 mice as well as the untreated cornea from a wild type mouse (B).

Vsx1 immunolabeling is not detected in normal or alkali-wounded corneas. sx1 immunolabeling (A, E, I, M, Q) of adult mouse retina (A-H) and cornea (I-T). Vsx1 immunolabeling of bipolar cells is present in wild type retinal section (A-D) but not in Vsx1 mice (E-H). Corneal sections from untreated mice (I-L) and from corneas receiving alkali-burn (M-T) were imaged for Vsx1 immunolabeling using the same imaging settings as those used for imaging retina. Sections were co-labeled with Draq5 nuclear stain. Non-specific immunolabeling of alkali-wounded corneas. Panels A-C correspond to panels I, M, and Q, respectively, from Figure 5. The image pixel intensity levels have been elevated by an order of magnitude. Vsx1 knock-in reporter gene expression at embryonic day 11.5. X-gal staining of wild type (A) and Vsx1 (B-D) mouse embryos embryonic day 11.5. Xgal staining is detected in the developing hindbrain (arrows in B and C) and spinal cord but is not detected in the developing eye (A, B - arrowhead). D: Cross-section through the eye of the embryo from panel B shows that ocular expression is undetectable in the developing retina (r), lens (L) and corneal region (c). Scale bar in D=50 μm. Vsx1 knock-in reporter gene expression is not detected in normal or alkali-wounded corneas. X-gal staining of retina (A), untreated cornea (C) and alkali-burn damaged cornea (D) from Vsx1 mice as well as the untreated cornea from a wild type mouse (B).

Discussion

The role of VSX1/Vsx1 in the corneal dystrophies keratoconus and posterior polymorphism dystrophy (PPCD1) and, the issue of whether it is expressed in the cornea has been a subject of considerable controversy. This study aimed to resolve the question of corneal Vsx1 expression in mice and evaluate a possible explanation for the association of VSX1 mutations with corneal disease. For qRT–PCR, the use of three different Vsx1 primers spaced over three of the five exons of the Vsx1 gene, two of which were intron-spanning, aimed to ensure reliable detection and reproducibility of any Vsx1 mRNA expression in samples. Further confidence in these primers was gained through comparison to previous Vsx1 expression studies. For example, in this study, postnatal Vsx1 expression in the mouse retina was only detected after postnatal day 3, which is consistent with Vsx1 expression detected by in situ hybridization at post-natal day 5 [3]. In contrast to the very low levels of VSX1 neonatal expression reported between day of birth and 9 months of age, we did not observe any Vsx1 corneal expression in the postnatal mouse at stages before and after eye opening. These findings suggest possible differences in the role of VSX1/Vsx1 in human and mouse corneal biology. Our inability to detect any corneal Vsx1 expression in adult wild-type mouse corneal tissue is consistent with the results of previous studies [3,7,26] that have failed to detect Vsx1 corneal expression. We thus investigated whether Vsx1 might be expressed as part of the wound healing response in the cornea as previously proposed [19]. The significant upregulation of Acta2, signifying the keratocyte to myofibroblast transformation associated with wound response in the cornea, in addition to the morphology changes seen in our wounded corneal samples both indicate that the alkali insult was successful in stimulating the corneal wounding response. Despite this response, qRT–PCR, immunolabeling and reporter gene expression revealed no specific corneal Vsx1/Vsx1 expression in untreated or alkali-burn damaged corneas at time points ranging from 6 h to 14 days post-wounding. Interestingly, there did appear to be a slight increase in non-specific labeling in alkali-burn damaged corneas that was not observed in untreated corneas. However, since this labeling was also present in Vsx1 mice, which lack Vsx1 immunolabeling, this suggests that wounded corneas are more prone to non-specific labeling than untreated corneas. Furthermore, following alkali-burn, no obvious changes in the corneal wound response at the histological level or in the upregulation of Acta2 were observed in Vsx1 mice, indicating that Vsx1 is not essential for these features of the wound response. Our findings call into question the potential association of Vsx1 with the wound response pathway in the mouse cornea. In this study, we show that Vsx1 is not expressed at detectable levels in the cornea at all stages examined. We demonstrated that Vsx1 is not detected in the cornea following alkali-burn damage using qRT–PCR, immunohistology and Vsx1 knock-in reporter expression. It remains possible that VSX1/Vsx1 contributes in corneal pathology through a cell non-autonomous mechanism, however this possibility has yet not been investigated. Our data suggests that in addition to the genetic heterogeneity and complexity that has been predicted for keratoconus and PPCD1, there may also be species differences in role of VSX1/Vsx1 in human and mouse corneal biology.
  26 in total

1.  Vsx1, a rapidly evolving paired-like homeobox gene expressed in cone bipolar cells.

Authors:  R L Chow; B Snow; J Novak; J Looser; C Freund; D Vidgen; L Ploder; R R McInnes
Journal:  Mech Dev       Date:  2001-12       Impact factor: 1.882

2.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

3.  Three VSX1 gene mutations, L159M, R166W, and H244R, are not associated with keratoconus.

Authors:  Yongming G Tang; Yoana Picornell; Xiaowen Su; Xiaohui Li; Huiying Yang; Yaron S Rabinowitz
Journal:  Cornea       Date:  2008-02       Impact factor: 2.651

4.  Absence of pathogenic mutations in VSX1 and SOD1 genes in patients with keratoconus.

Authors:  Mirna Stabuc-Silih; Mojca Strazisar; Marko Hawlina; Damjan Glavac
Journal:  Cornea       Date:  2010-02       Impact factor: 2.651

5.  RINX(VSX1), a novel homeobox gene expressed in the inner nuclear layer of the adult retina.

Authors:  T Hayashi; J Huang; S S Deeb
Journal:  Genomics       Date:  2000-07-15       Impact factor: 5.736

6.  Gene and cluster-specific expression of the Iroquois family members during mouse development.

Authors:  A C Houweling; R Dildrop; T Peters; J Mummenhoff; A F Moorman; U Rüther; V M Christoffels
Journal:  Mech Dev       Date:  2001-09       Impact factor: 1.882

7.  Isolation and characterization of a novel human paired-like homeodomain-containing transcription factor gene, VSX1, expressed in ocular tissues.

Authors:  E V Semina; H A Mintz-Hittner; J C Murray
Journal:  Genomics       Date:  2000-01-15       Impact factor: 5.736

8.  VSX1: a gene for posterior polymorphous dystrophy and keratoconus.

Authors:  Elise Héon; Alex Greenberg; Kelly K Kopp; David Rootman; Andrea L Vincent; Gail Billingsley; Megan Priston; Kimberley M Dorval; Robert L Chow; Roderick R McInnes; Godfrey Heathcote; Carol Westall; John E Sutphin; Elena Semina; Rod Bremner; Edwin M Stone
Journal:  Hum Mol Genet       Date:  2002-05-01       Impact factor: 6.150

9.  Molecular analysis of the VSX1 gene in familial keratoconus.

Authors:  Petra Liskova; Neil D Ebenezer; Pirro G Hysi; Rhian Gwilliam; Mohamed F El-Ashry; Lalitha C Moodaley; Scott Hau; Michael Twa; Stephen J Tuft; Shomi S Bhatacharya
Journal:  Mol Vis       Date:  2007-10-04       Impact factor: 2.367

10.  Bevacizumab accelerates corneal wound healing by inhibiting TGF-beta2 expression in alkali-burned mouse cornea.

Authors:  Sung Ho Lee; Hyun Sung Leem; Seon Mi Jeong; Koonja Lee
Journal:  BMB Rep       Date:  2009-12-31       Impact factor: 4.778

View more
  8 in total

1.  The Genetics of Keratoconus: A Review.

Authors:  Joshua Wheeler; Michael A Hauser; Natalie A Afshari; R Rand Allingham; Yutao Liu
Journal:  Reprod Syst Sex Disord       Date:  2012-06-03

2.  Vsx2 controls eye organogenesis and retinal progenitor identity via homeodomain and non-homeodomain residues required for high affinity DNA binding.

Authors:  Changjiang Zou; Edward M Levine
Journal:  PLoS Genet       Date:  2012-09-20       Impact factor: 5.917

Review 3.  The genetic and environmental factors for keratoconus.

Authors:  Ariela Gordon-Shaag; Michel Millodot; Einat Shneor; Yutao Liu
Journal:  Biomed Res Int       Date:  2015-05-17       Impact factor: 3.411

4.  Genetics in Keratoconus - What is New?

Authors:  Sarah Moussa; Günther Grabner; Josef Ruckhofer; Marie Dietrich; Herbert Reitsamer
Journal:  Open Ophthalmol J       Date:  2017-07-31

Review 5.  Genetic Aspects of Keratoconus: A Literature Review Exploring Potential Genetic Contributions and Possible Genetic Relationships with Comorbidities.

Authors:  Eleftherios Loukovitis; Konstantinos Sfakianakis; Panagiota Syrmakesi; Eleni Tsotridou; Myrsini Orfanidou; Dimitra Rafailia Bakaloudi; Maria Stoila; Athina Kozei; Spyridon Koronis; Zachos Zachariadis; Paris Tranos; Nikos Kozeis; Miltos Balidis; Zisis Gatzioufas; Aliki Fiska; George Anogeianakis
Journal:  Ophthalmol Ther       Date:  2018-09-06

6.  Screening the visual system homeobox 1 gene in keratoconus and posterior polymorphous dystrophy cohorts identifies a novel variant.

Authors:  Andrea L Vincent; Charlotte Jordan; Leo Sheck; Rachel Niederer; Dipika V Patel; Charles N J McGhee
Journal:  Mol Vis       Date:  2013-04-11       Impact factor: 2.367

7.  Induction of the integrated stress response in the rat cornea.

Authors:  C Peterson; Y C Kim; L M Ensign; A S Jun; J Foster
Journal:  Exp Eye Res       Date:  2021-08-08       Impact factor: 3.770

8.  Lack of association between polymorphisms of the DNA base excision repair genes MUTYH and hOGG1 and keratoconus in a Polish subpopulation.

Authors:  Ewelina Synowiec; Katarzyna A Wójcik; Anna Czubatka; Piotr Polakowski; Justyna Izdebska; Jerzy Szaflik; Janusz Błasiak; Jacek P Szaflik
Journal:  Arch Med Sci       Date:  2015-10-12       Impact factor: 3.318

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.