Literature DB >> 21404042

Missense mutations and polymorphisms of the MC4R gene in Polish obese children and adolescents in relation to the relative body mass index.

Joanna Nowacka-Woszuk1, Jakub Cieslak, Bogda Skowronska, Katarzyna A Majewska, Witold Stankiewicz, Piotr Fichna, Marek Switonski.   

Abstract

Extensive studies of the MC4R gene polymorphism showed that, among numerous variants, there are mutations responsible for monogenic obesity, as well as polymorphisms negatively correlated with the risk of obesity. In this report, we present the first studies of the whole coding sequence of the MC4R gene in 243 Polish obese children and adolescents (the mean relative body mass index [RBMI] was 163.6). In addition, 101 non-obese adults were also analyzed. Direct sequencing facilitated the identification of six missense (K73R, V103I, T112M, S127L, M215L, and I251L) and one silent (c.756 C > T) single-nucleotide polymorphisms (SNPs). Two non-synonymous polymorphisms (K73R and M215L) appeared to be novel and one was found in obese patients (M215L, one patient) and one in non-obese adults (K73R, one person). The overall frequency of non-synonymous variant carriers reached 4.1% and 6.9% in obese patients and non-obese adults, respectively. Only one obesity-associated variant (127L) was found in two obese patients (0.82%) and in two non-obese adults (1.98%). The obesity-protecting variants (103I and 251L) appeared to be the most common in both groups: 3.3% and 4.0%, respectively. It was also observed that the RBMI in obese children and adolescents carrying the minor variants did not differ significantly from the non-carriers; however, the expected trends for the associated and protecting variants were observed. We conclude that the contribution of the MC4R gene variants to the pathogenesis of obesity in Polish children and adolescents is low.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21404042      PMCID: PMC3132382          DOI: 10.1007/s13353-011-0036-2

Source DB:  PubMed          Journal:  J Appl Genet        ISSN: 1234-1983            Impact factor:   3.240


Introduction

It is well known that the monogenic form of obesity is mainly caused by mutations of the MC4R gene (Santini et al. 2009; Tao 2009). There are over 150 variants of this gene described, but their causality varies and, usually, they are classified into five classes, in relation to their molecular effects (Tao 2009): class 1, truncated receptor with a loss of function; class 2, intracellular retention of the receptor presenting normal length; class 3, altered binding function of the receptor; 4, ligand binds the receptor but signal transduction is altered; and type 5, lack of the deleterious effect or the effect was not yet studied. Interestingly, there are also two MC4R variants which are negatively correlated with the risk of obesity (Stutzmann et al. 2007; Wang et al. 2010). These polymorphisms cause amino acid substitutions in codon 103 (valine > isoleucine, V103I) and codon 251 (isoleucine > leucine, I251L). The occurrence of the MC4R gene mutations causing obesity was studied in different populations and different age groups (for a review, see Santini et al. 2009). It was found that, in patients with an early-onset obesity, the incidence of the carriers varies from less than 1% among the Italian and Belgian populations to over 5% in the UK population. A recent study of Belgian obese children revealed the presence of 11 mutations, including two novel ones, where the mutation carrier frequency was 5.6% (Beckers et al. 2010). In obese adults, the frequency falls within the range from less than 1% (United Kingdom, Japan, Germany, etc.) to 5% (Switzerland). Obesity is a serious health problem also in Poland and the frequency of overweight and obesity in children and adolescents reaches 18.7% and 14.1% for boys and girls, respectively, with a significant increase among boys at younger ages if compared to the previous decade (Kułaga et al. 2010). Taking into consideration the major role of the MC4R gene mutations in the pathogenesis of monogenic obesity and the lack of knowledge on their distribution in the Polish population, we decided to search for variants in the coding sequence of this gene in a cohort of obese Polish children or adolescents. Moreover, a group of non-obese adults was also analyzed.

Materials and methods

Patients

Altogether, 344 blood samples (243 from obese subjects and 101 non-obese adults) were collected from patients of the Department of Pediatric Diabetes and Obesity, Poznan University of Medical Sciences, Poznan, Poland. Each patient was assigned to one of two groups: obese children and adolescents (relative body mass index [RBMI] > 120) or non-obese adults (body mass index [BMI] < 25) with no obesity episodes in their lifetime (healthy individuals, age range: 35–45 years). Unfortunately, a control group of non-obese children and adolescents was not included in this study and, thus, we assumed that non-obese adults may play, to some extent, a role as the control group. In the group of obese children and adolescents (119 girls and 124 boys), the following parameters were recorded: age, sex, total body mass, and height. The RBMI (relative BMI) was estimated by dividing the current BMI of every obese patient by the ideal (50th percentile) BMI for their age and gender and multiplying the obtained result by 100 (Cole et al. 2005). In the cohort of obese subjects (age range: 4–17 years, average age: 12.4 ± 3.8 years), the average RBMI was 163.6 ± 22.9. The study was approved by the local Bio-Ethics Committee at the Poznan University of Medical Sciences.

Methods

DNA was isolated from blood samples using a Blood Mini isolation kit (A&A Biotechnology, Poland) according to the manufacturer’s protocol. The coding region of the MC4R gene was polymerase chain reaction (PCR)-amplified as two fragments (536 and 708 bp, respectively). The PCR primers (MC4R1F: 5′atcaattcagggggacactg, MC4R1R: 5′ccaacccgcttaactgtcat, MC4R2F: 5′gtagctccttgcttgcatcc, MC4R2R: 5′acggaagagaaagctgttgc) were designed according to the reference sequence deposited in the GenBank (NC_000018.9) and generated with the use of the Primer3 tool (http://frodo.wi.mit.edu/primer3/). For both amplified fragments, the following PCR conditions were applied: 95°C, 10 min (preliminary denaturation); 35 cycles of: denaturation 95°C, 30 s, annealing 60°C, 30 s, elongation 72°C, 30 s, and 72°C, 10 min (final synthesis). PCR was run in a Biometra TGradient thermocycler (Biometra, Germany) using Allegro Taq polymerase (Novazym, Poland). Amplified fragments of the MC4R gene were screened for polymorphisms using the direct sequencing method (ABI Prism 3130 automatic sequencer, Applied Biosystems, USA). For statistical analysis, the R package was applied (version 2.12.0) (http://www.r-project.org/). Polymorphic variant frequencies between slim and obese subjects were compared with the use of Fisher’s exact test. We also measured the significance of differences in the average RBMI values between obese carriers of various MC4R variants versus non-carriers, using the Wilcoxon rank-sum test. The comparison was performed for each polymorphic variant, as well as for three variant groups: obesity-associated, obesity-protective, and variants with unknown or unclear function. The groups were formed according to the present knowledge on the variant functionality.

Results

Altogether, 17 carriers of the non-synonymous MC4R gene variants were found in the studied cohort (Table 1). To our knowledge, among the six identified missense substitutions, two were novel, i.e., c.218A > G and c.643A > T (Fig. 1), causing K73R and M215L amino acid substitutions, respectively. The other variants described in our study were already reported earlier in other populations. The effect of four known variants could be classified, according to Tao (2009), to the following classes: 2 (S127L) and 5 (V103I, T112M, and I251L). Two novel variants (K73R and M215L) with unknown function represented class 5. In addition, one obese patient was a carrier of the synonymous polymorphism (c.756 C > T).
Table 1

Distribution of non-synonymous MC4R polymorphism carriers in obese Polish children and adolescents, in comparison with a group of non-obese adults

SNPa Codon changeAmino acid positionAmino acid changeVariant classb Obese subjects (n = 243)Non-obese adults (n = 101)
c.218A > GAAG > AGG73K > Rucc 1 (0.99%)
c.307 G > AGUC > AUC103V > I56 (2.46%)3 (2.97%)
c.335 C > TACG > AUG112T > M51 (0.41%)2 (1.98%)
c.380 C > TUCG > UUG127S > L22 (0.82%)2 (1.98%)
c.643A > TAUG > UUG215M > Lucc 1 (0.41%)
c.751A > CAUU > CUU251I > L52 (0.82%)1 (0.99%)
 All variants10* (4.1%)7** (6.9%)
 Obesity-protective variants (103I and 251L)8 (3.3%)4 (4.0%)
 Obesity-associated variant (127L)2 (0.82%)2 (1.98%)
 Neutral variants or variants with unknown effect (73R, 112M, and 215L)2 (0.82%)3 (2.97%)

aAlso, one silent substitution c.756 C > T was identified in an obese subject;

bAccording to Tao (2009)

cUnclassified

*Two patients carried two SNPs (103I and 127L)

**Two adults carried two SNPs (103I and 127L)

Fig. 1

Novel variants of the MC4R gene causing amino acid substitutions: a c.218A > G, K73R; b c.643A > T, M215L

Distribution of non-synonymous MC4R polymorphism carriers in obese Polish children and adolescents, in comparison with a group of non-obese adults aAlso, one silent substitution c.756 C > T was identified in an obese subject; bAccording to Tao (2009) cUnclassified *Two patients carried two SNPs (103I and 127L) **Two adults carried two SNPs (103I and 127L) Novel variants of the MC4R gene causing amino acid substitutions: a c.218A > G, K73R; b c.643A > T, M215L A comparison of variant carriers in obese versus non-obese subjects did not show any significant differences (Table 1). However, the observed frequency tendencies appeared to be unexpected in case of some variants. When all of the non-synonymous variants were considered, the frequency of the carriers among the obese subjects was lower (4.1%) than in the controls (6.9%). Among the identified substitutions, only one variant (127L) was associated with obesity. The frequency of its carriers was lower among obese patients (0.82%) than in the control subjects (1.92%). The V103I polymorphism was the most widely distributed and the incidence of the obesity-protective variant (103I) carriers was only slightly smaller in the obese patients (2.46%) than in non-obese adults (2.97%). A similar trend was recorded for the other variant protecting against obesity (251L), found in 0.82% of obese subjects and 0.99% of non-obese adults. Two obese patients were carriers of two polymorphic variants, the obesity-associated (127L) and obesity-protective (103I) ones. The RBMI in obese subjects (n = 243) was 163.6. We compared this parameter among the carriers (n = 10) and non-carriers (n = 233) for the identified variants (Table 2). The differences were not significant; however, some tendencies were observed. In case of the obesity-associated variant (127L), a higher mean RBMI was observed in the carriers (177.5, n = 2) than in the non-carriers (163.5, n = 241). A comparison of the obesity-protective variants (103I and 251L) revealed lower RBMI in the carriers (159.7, n = 8) than in the non-carriers (163.7, n = 235). Two carriers of the neutral variant (112M) or variant with unknown effect (215L) had slightly higher mean RBMI (166.5, n = 2) than the non-carriers (163.6, n = 241).
Table 2

A comparison of the RBMI in obese carriers of the MC4R variants and in obese non-carriers

MC4R minor variant and its effect on obesityObese carriersObese non-carriers
n RBMI n RBMI
127L: obesity-associated2*177.5241163.5
103I: obesity-protective6*163.9237163.6
251L: obesity-protective2147.0241163.7
Total: obesity-protective8159.7235163.7
112M: neutral1167.0242163.6
73R: unknown0243163.6
215L: unknown1166.0242163.6
Total: neutral and unknown2166.5241163.6

*Two patients carried two SNPs (103I and 127L)

A comparison of the RBMI in obese carriers of the MC4R variants and in obese non-carriers *Two patients carried two SNPs (103I and 127L)

Discussion

Our main concern was focused on variants causing or associated with obesity. We found only one such variant (127L) which affects the function of the encoded receptor. Two carriers of this variant, found in the studied cohort of obese patients, showed that their mean RBMI was higher than in non-carriers, as one could expect, but the difference was not significant. Functional analysis of the 127L variant was performed by Lubrano-Berthelier et al. (2003) and it was found that the encoded receptor demonstrates an impaired response to α-MSH (a natural agonist for MC4R). However, the cell surface expression of the receptor was not altered. These authors also calculated that over 80% of all MC4R mutations associated with childhood obesity can be caused by the intracellular retention of the receptor. In our study, the frequency of this variant was lower in the obese patients (0.82%) than in a group of 101 non-obese adults (1.98%). However, it should be pointed out that the studied cohort of obese children and adolescents was rather small (n = 243). In another study, performed by Santoro et al. (2009), comprising a cohort of 240 obese Italian children, three obesity-associated mutations (S127L, Q307X, and Y332H) were found. The obesity variant (127L) was found in three subjects (1.25%), thus, the frequency was similar to our results. For these patients, also, their family members were investigated and it was shown that the mutation co-segregates with obesity. This mutation was also found in Czech obese children, but its frequency was very low (0.34%), while the total frequency of the MC4R gene mutations in this cohort reached 2.4% (Hainerová et al. 2007). We identified two novel missense substitutions (K73R and M215L). Unfortunately, we were not able to analyze the effect of these mutations on the receptor functionality. The variants were found in one obese patient (215L) and in one non-obese adult (73R). Both amino acid substitutions are located in the cytoplasmatic topological domain and they do not change significantly the character of the amino acids. In the first mutation, arginine as well as lysine belong to the polar amino acids, while in the other mutation, methionine and leucine are the non-polar amino acids. Two obesity-protective variants were the most frequently observed in both cohorts. This observation is in agreement with other studies. In a recent study of 291 obese Dutch children, 23 variants in the coding as well as 5′ flanking and 3′ UTR sequences of the MC4R gene were identified (van den Berg et al. 2011). Six of them were localized in the 5′ flanking region (four in the 5′ UTR), 11 in the coding sequence, and two in the 3′ UTR. The minor allele frequency (MAF) ranged from 0.0017 to 0.35. For the most common polymorphisms, considered as obesity-protective variants, V103I and I251L, the MAF amounted to 0.01 (103I) and 0.0017 (251L), respectively. In our study, the MAF values were similar: 0.013 for 103L and 0.004 for 251L. A similar trend for the V103I polymorphism was obtained from the meta-analysis, where the frequency of the 103I variant carriers was 2.9% in obese (n = 19,882) and 3.9% in non-obese (n = 35,373) subjects (Wang et al. 2010). In that study, the authors gathered data from previously published papers and concluded that, among obese patients, the incidence of the 103I variant carriers varied from less than 0.1% (Italy) and 0.6% (Germany and Finland) to almost 20% (Turkey). In non-obese subjects, the incidence of the carriers varied from 0% (Germany), 1% to 3.3% (Italy), 2.8% (Finland), up to 9% (Turkey). Recently, the V103I polymorphism was also studied in a cohort of 311 Polish adults (mean BMI = 27) in relation to their physical activity (Jóźków et al. 2011). The incidence of the 103I variant carriers was high (6.4%) and, in addition, one patient (0.3%) had a homozygous 103I/103I genotype. It was twofold higher than in the non-obese adults (2.97%) and obese children and adolescents (2.46%) described in our study. If the results presented in both reports were analyzed together (n = 343 + 311 = 654), the incidence of the carriers in the Polish population would be 4.43%. Our study on the association between both variants and the RBMI showed that six carriers of the 103L variant had a similar mean RBMI to that observed for non-carriers, while two carriers of the 251L variant had a lower RBMI, but, again, the differences were not significant. Recently, polymorphisms of other candidate genes for obesity were studied in the Polish population. Safranow et al. (2011) analyzed the distribution of mutations in the AMPD1 (adenosine monophosphate deaminase 1) gene in Polish patients with cardiovascular diseases and no significant associations between four studied polymorphic variants and the incidence of obesity (BMI > 30) were observed. Another study concerned polymorphisms in the 5′ flanking regions of three genes encoding adipokines: leptin, adiponectin, and resistin (Cieslak et al. 2011). The authors studied the same cohort of obese children and adolescents as in the present study. Altogether, 14 polymorphisms were detected and, among them, five were sufficiently distributed (minor allele frequency above 0.2) to study their association with the RBMI in obese children and adolescents, but none of them appeared to be associated. Concluding, our results show for the first time the distribution of polymorphisms in the entire coding sequence of the MC4R gene in a cohort of Polish obese children and adolescents, as well as in a group of non-obese adults. Among the six identified non-synonymous variants, two (K73R and M215L) were considered as novel. The overall frequency of the missense variants in the obese patients was quite high (4.1%), but not elevated when compared with the non-obese adults (6.9%). We assume that the contribution of the MC4R gene mutations and polymorphisms to the pathogenesis of obesity in Polish children and adolescents seems to be low.
  12 in total

1.  Identification and functional characterization of novel mutations in the melanocortin-4 receptor.

Authors:  Sigri Beckers; Doreen Zegers; Fenna de Freitas; Armand V Peeters; Stijn L Verhulst; Guy Massa; Luc F Van Gaal; Jean-Pierre Timmermans; Kristine N Desager; Wim Van Hul
Journal:  Obes Facts       Date:  2010-10-15       Impact factor: 3.942

Review 2.  Mutations in melanocortin-4 receptor and human obesity.

Authors:  Ya-Xiong Tao
Journal:  Prog Mol Biol Transl Sci       Date:  2009-10-07       Impact factor: 3.622

3.  Melanocortin-4 receptor gene mutations in a Dutch cohort of obese children.

Authors:  Linda van den Berg; Olivier van Beekum; Peter Heutink; Bram A Felius; Monique P M van de Heijning; Stefan Strijbis; Rosalina van Spaendonk; Daniela Piancatelli; Keith M Garner; Rajae El Aouad; Erik Sistermans; Roger A H Adan; Henriette A Delemarre-van de Waal
Journal:  Obesity (Silver Spring)       Date:  2010-10-21       Impact factor: 5.002

4.  Association of the MC4R V103I polymorphism with obesity: a Chinese case-control study and meta-analysis in 55,195 individuals.

Authors:  Du Wang; Jun Ma; Su Zhang; Anke Hinney; Johannes Hebebrand; Yan Wang; Hai-Jun Wang
Journal:  Obesity (Silver Spring)       Date:  2009-08-20       Impact factor: 5.002

Review 5.  Melanocortin-4 receptor mutations in obesity.

Authors:  Ferruccio Santini; Margherita Maffei; Caterina Pelosini; Guido Salvetti; Giovanna Scartabelli; Aldo Pinchera
Journal:  Adv Clin Chem       Date:  2009       Impact factor: 5.394

6.  Polish 2010 growth references for school-aged children and adolescents.

Authors:  Zbigniew Kułaga; Mieczysław Litwin; Marcin Tkaczyk; Iwona Palczewska; Małgorzata Zajączkowska; Danuta Zwolińska; Tomasz Krynicki; Anna Wasilewska; Anna Moczulska; Aurelia Morawiec-Knysak; Katarzyna Barwicka; Aneta Grajda; Beata Gurzkowska; Ewelina Napieralska; Huiqi Pan
Journal:  Eur J Pediatr       Date:  2010-10-23       Impact factor: 3.183

7.  AMPD1 gene mutations are associated with obesity and diabetes in Polish patients with cardiovascular diseases.

Authors:  Krzysztof Safranow; Janina Suchy; Katarzyna Jakubowska; Maria Olszewska; Agnieszka Bińczak-Kuleta; Grzegorz Kurzawski; Ryszard Rzeuski; Edyta Czyżycka; Beata Łoniewska; Zdzisława Kornacewicz-Jach; Andrzej Ciechanowicz; Dariusz Chlubek
Journal:  J Appl Genet       Date:  2010-11-25       Impact factor: 3.240

8.  What is the best measure of adiposity change in growing children: BMI, BMI %, BMI z-score or BMI centile?

Authors:  T J Cole; M S Faith; A Pietrobelli; M Heo
Journal:  Eur J Clin Nutr       Date:  2005-03       Impact factor: 4.016

9.  Non-synonymous polymorphisms in melanocortin-4 receptor protect against obesity: the two facets of a Janus obesity gene.

Authors:  Fanny Stutzmann; Vincent Vatin; Stéphane Cauchi; Anita Morandi; Béatrice Jouret; Olfert Landt; Patrick Tounian; Claire Levy-Marchal; Raffaella Buzzetti; Leonardo Pinelli; Beverley Balkau; Fritz Horber; Pierre Bougnères; Philippe Froguel; David Meyre
Journal:  Hum Mol Genet       Date:  2007-05-21       Impact factor: 6.150

10.  Intracellular retention is a common characteristic of childhood obesity-associated MC4R mutations.

Authors:  Cecile Lubrano-Berthelier; Emmanuelle Durand; Beatrice Dubern; Astrid Shapiro; Paul Dazin; Jacques Weill; Camille Ferron; Philippe Froguel; Christian Vaisse
Journal:  Hum Mol Genet       Date:  2003-01-15       Impact factor: 6.150

View more
  4 in total

Review 1.  GENETIC AND EPIGENETIC CAUSES OF OBESITY.

Authors:  Vidhu V Thaker
Journal:  Adolesc Med State Art Rev       Date:  2017

2.  Common polymorphism (81Val>Ile) and rare mutations (257Arg>Ser and 335Ile>Ser) of the MC3R gene in obese Polish children and adolescents.

Authors:  J Cieslak; K A Majewska; A Tomaszewska; B Skowronska; P Fichna; M Switonski
Journal:  Mol Biol Rep       Date:  2013-10-20       Impact factor: 2.316

3.  Melanocortin-4 Receptor Gene Mutations in a Group of Turkish Obese Children and Adolescents.

Authors:  Selma Tunç; Korcan Demir; Fatma Ajlan Tükün; Cihan Topal; Filiz Hazan; Burcu Sağlam; Özlem Nalbantoğlu; Melek Yıldız; Behzat Özkan
Journal:  J Clin Res Pediatr Endocrinol       Date:  2017-02-20

4.  Identification of the MC4R start lost mutation in a morbidly obese Brazilian patient.

Authors:  Ana Carolina Proença da Fonseca; Gabriella de Medeiros Abreu; Verônica Marques Zembrzuski; Mario Campos Junior; João Regis Ivar Carneiro; Fernanda Cristina C Mattos Magno; Eliane Lopes Rosado; José Firmino Nogueira Neto; Giselda Maria Kalil de Cabello; Pedro Hernán Cabello
Journal:  Diabetes Metab Syndr Obes       Date:  2019-02-21       Impact factor: 3.168

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.