| Literature DB >> 2131839 |
Abstract
The sequence-preferential reversible covalent binding of certain saframycin antitumor antibiotics from Streptomyces lavendulae has been examined by complementary-strand methidium propyl-EDTA (MPE) footprinting on an EcoRI/HindIII restriction fragment of pBR322 DNA under several experimental conditions. A buffer at pH 7.4 and in the presence of 9.5 mM dithiothreitol at 37 degrees C was found to be optimum for the interaction of these antibiotics with DNA. At r' = 0.6 both saframycins A and S exhibited footprints in the regions 4244-4257 (CAAATAGGGTTCC) and 4265-4286 (TTCCCCAAAAGTGCCACCTG) and a weak footprint in the region 4297-4302 (AACCAT). The binding locations identified that are common to saframycins A and S are (all 5'----3') GGGG (4250-4253), CCCC (4268-4271), and GCC (4279-4281), and weak interaction locations are ACC (4282-4284 and 4298-4300) (underlined bases are shared by two adjacent binding sites). Both the antibiotic saframycins A and S show preference for 5'-GGG or 5'-GGC sequences. It appears that saframycin A has no affinity for 5'-CGG while saframycin S shows a strong footprint at this sequence. Neither of the saframycins recognizes alternating CG sequences. Saframycin S also binds to 5'-CTA, which suggests that molecular recognition processes involving the parent antibiotics are also important, and not only recognition by, and covalent binding of, the common iminium species to the DNA. The protection sites at 5'-GCC and 5'-ACC suggest that saframycins A and S recognize 5'-GGPy sequences. However, between the two pyrimidine bases, C is preferred to T. Enhancement of cleavage by both saframycins is observed in the AT-rich region of 4301-4318.(ABSTRACT TRUNCATED AT 250 WORDS)Entities:
Mesh:
Substances:
Year: 1990 PMID: 2131839 DOI: 10.1021/tx00015a012
Source DB: PubMed Journal: Chem Res Toxicol ISSN: 0893-228X Impact factor: 3.739