Literature DB >> 21279680

Regulation of hemocytes in Drosophila requires dappled cytochrome b5.

Kurt Kleinhesselink1, Corinna Conway, David Sholer, Irvin Huang, Deborah A Kimbrell.   

Abstract

A major category of mutant hematopoietic phenotypes in Drosophila is melanotic tumors or nodules, which consist of abnormal and overproliferated blood cells, similar to granulomas. Our analyses of the melanotic mutant dappled have revealed a novel type of gene involved in blood cell regulation. The dappled gene is an essential gene that encodes cytochrome b5, a conserved hemoprotein that participates in electron transfer in multiple biochemical reactions and pathways. Viable mutations of dappled cause melanotic nodules and hemocyte misregulation during both hematopoietic waves of development. The sexes are similarly affected, but hemocyte number is different in females and males of both mutants and wild type. Additionally, initial tests show that curcumin enhances the dappled melanotic phenotype and establish screening of endogenous and xenobiotic compounds as a route for analysis of cytochrome b5 function. Overall, dappled provides a tractable genetic model for cytochrome b5, which has been difficult to study in higher organisms.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21279680      PMCID: PMC3092937          DOI: 10.1007/s10528-010-9411-7

Source DB:  PubMed          Journal:  Biochem Genet        ISSN: 0006-2928            Impact factor:   1.890


Introduction

Drosophila is well studied as a model of innate immunity in humans and has been instrumental in establishing principles of defense and gene signaling pathways that involve both immune induction and hematopoiesis (Lemaitre and Hoffmann 2007). The Drosophila Toll pathway mediates the response to microbial infections, and humans were subsequently found to have a family of Toll receptors that also respond to infections. Other shared immune signaling pathways are the Imd (immune deficiency)/TNF1 (tumor necrosis factor 1), JNK (Jun kinase), and JAK-STAT (Janus kinase-STAT transcription factor) pathways. Activation of NFkB transcription factors, which regulate target genes such as cytokines and antimicrobial proteins, is a key shared feature (Wang and Ligoxygakis 2006). Like the signaling pathways, the cell and tissue components of the Drosophila and human immune systems are analogous (Kimbrell and Beutler 2001). In Drosophila, the hemocytes and the fat body mediate, respectively, the major cellular and humoral arms of the response. Hemocytes participate in immune signaling to the fat body, phagocytosis, damaged tissue surveillance, encapsulation of foreign intruders, and remodeling of cells during development and also respond to aberrant self-cells to form melanotic tumors/pseudotumors (Babcock et al. 2008; Brennan et al. 2007; Gateff 1994; Rizki and Rizki 1983; Tepass et al. 1994; Vass and Nappi 2000). The fat body, like the mammalian liver, produces abundant humoral response molecules, including antimicrobial peptides released into the hemolymph (Aggrawal and Silverman 2007). Drosophila produces three types of hemocytes: plasmatocytes, lamellocytes, and crystal cells (Crozatier and Meister 2007). Plasmatocytes account for ~95% of total blood cells and most functions. In particular, plasmatocytes are responsible for the phagocytosis of microorganisms during an infection and apoptotic cells during development. Lamellocytes are produced only in response to parasites or by mutations that produce melanotic tumors. Crystal cells constitute ~5% of total blood cells and are involved in melanization. As in vertebrates, Drosophila blood cells also have two developmental origins: one early in the embryonic head mesoderm and another during larval development in the lymph gland (Evans et al. 2003). Molecular cascades and factors regulating hematopoiesis are also shared with humans and involve many pathways, for example, Toll, JAK/STAT, Hedgehog, Notch, GATA, and Runx (Evans and Banerjee 2003; Mandal et al. 2007). A major category of mutant hematopoietic phenotypes in Drosophila is that of melanotic tumors or nodules. Melanotic nodules may be in the hemocoel or associated with the lymph glands and consist of abnormal and overproliferated blood cells that are covered by lamellocytes and melanized, similar to the immune response to a parasitic wasp egg (Luo et al. 1995; Meister and Lagueux 2003; Minakhina and Steward 2006b; Stofanko et al. 2008). Mutations in a variety of genes and genetic pathways have been found to produce this phenotype, such as JAKSTAT, which is also associated with blood cell overproliferation in humans, the Toll pathway, and Ras/MAPK (Asha et al. 2003; Li 2008; Minakhina and Steward 2006a; Zettervall et al. 2004). Some other genes with this mutant phenotype are air , encoding ribosomal protein s6 (Watson et al. 1992); black pearl, encoding a DnaJ homolog (Becker et al. 2001); l(3)malignant blood neoplasm, encoding a protein with human cytokeratin homology (Gateff 1994); yantar, encoding a conserved arginine-rich protein (Sinenko et al. 2004); and the Polycomb group gene multi sex combs (Remillieux-Leschelle et al. 2002). The melanotic tumor genes are an important category to identify and define in order to understand blood cell function and regulation. In a P-element enhancer detector screen concentrating on immune-related tissues and phenotypes, we identified the melanotic tumor gene dappled (dpld) (Rodriguez et al. 1996). Enhancer detector expression of dappled was high in the fat body, oenocytes, ring gland, and gut. Lethal and viable mutations of dappled produced melanotic tumors, and lethal mutation was also associated with aberrant tissue morphology, for example, of the fat body and gut (Rodriguez et al. 1996). A distinguishing feature of dappled mutants is consistent melanotic tumor formation, in contrast to other melanotic tumor mutants, which typically have low and variable rates. We now report identification of dappled as a member of the cytochrome b5 family. Cytochrome b5 is a conserved, ubiquitous, small hemoprotein that participates in electron transfer in multiple biochemical reactions and pathways, such as fatty acid desaturation, cytochrome P450-catalyzed reactions, sterol metabolism, and conversion of methemoglobin (Schenkman and Jansson 2003). Cytochrome b5 is thus involved in processes such as metabolism of endogenous and xenobiotic compounds, maintenance of oxygen levels, and production of steroid hormones (Locuson et al. 2007; Miller 2005; Yamazaki and Shimada 2006). Cytochrome b5 genetics in higher organisms has not been very amenable to study, and dappled provides a new avenue of approach for study of cytochrome b5 functions. In this report, we characterize the dappled mutant hemocyte phenotype and present the potential to study cytochrome b5 function by screening for compounds that affect the dappled hemocyte phenotype.

Materials and Methods

Drosophila Stocks and Rearing

Oregon R flies were used as the standard wild-type strain. The dappled mutants are the dpld (97/16) and dpld (142/2) strains of Rodriguez et al. (1996). Experiments were performed using dpld /dpld transheterozygotes or dpld mutants hemizygous with Df(2R)ST1 (Bloomington Stock Center). The hemese-Gal4 strain is that of Zettervall et al. (2004). The UAS-dappled transgenic strain was made using the cDNA clone RE66521 from the Bloomington Drosophila Genome Project, which matched our splice product for dappled mRNA (see below). The insert of plasmid RE66521 was isolated using the EcoRI and BamHI restriction enzyme sites, ligated into the EcoRI and XbaI sites of the pUAST vector using BamHI/XbaI linkers, and transgenic strains made by Genetic Services, Inc. Insertion strains of UAS-dappled into chromosomes X, 2, and 3 were recovered. All stocks were raised on the Bloomington Stock Center food recipe in a 25°C incubator. For the curcumin-raised flies, the food, before cooling, was supplemented with 20 mg/ml curcumin (Sigma), and parents were placed onto the food for mating and egg laying. Compare with Gupta et al. (2009), in which doses for mice were 5, 30, and 60 mg/kg orally, daily for 19 days, and note that at 100 mg/ml, flies had high lethality in addition to developmental delay.

Molecular Genetic Analysis

Genomic DNA fragments flanking the dappled 97/16 (k09716) and 142/2 (k14202) P-element insertion sites were recovered by the plasmid rescue technique (Wilson et al. 1989), sequenced (Davis Sequencing), and aligned to the genome (Blast). The PCR primers used to compare the 88/15 (k08815) strain P-element insertion sequences AQ034113 and AQ025871 (Tweedie et al. 2009) to wild-type sequences were TATCGTCGCTGTGCTTACAGAT (60, forward) and CTAAACCTCCAATTCGGCTATG (61, reverse) at the AQ034113 end and CTCCACGCGTAATATACCCATT (58, forward) and AGTCATGGATGCGTAGTCACAC (59, reverse) at the AQ025871 end. In order to confirm the 88/15 insertion site, PCR fragments that resulted from the P-element end primer RsyII (Tweedie et al. 2009) in combination with primers 59 and 60 were sequenced. The PCR primers used to test for possible alternative splicing of CG2140/dappled were sequences 55, 56, and 57 (Fig. 1). The sequence of the single transcript detected was translated to an amino acid sequence and placed into the cytochrome b5 family by Blast comparison. Clustal W was used to align the dappled cytochrome b5 sequence to selected other cytochrome b5 proteins.
Fig. 1

The dappled locus. a Four P-element insertions in dappled/CG2140 produce mutations with a melanotic tumor phenotype (k09716, k00107, k14202, and 01857). These four dappled insertions and the 03427 and 05643 insertions are included within the k08815 deletion. Insertions 03610 and 08492 are outside the dappled and k08815 regions. One dappled mRNA transcript has been detected, and it has one intron spanning from +120 to +1712 (dotted line). The numbers 55, 56, and 57 indicate the positions of PCR primers used to test for alternative mRNA splicing products; only the 55–57 pair produced a PCR product. Black bars indicate the dappled protein coding region. b Sequence of the dappled/CG2140 gene. The sequence of the PCR fragment obtained from primers 55 and 57 to total adult RNA was combined with the sequence data for CG2140 at Flybase (Tweedie et al. 2009). Transcribed sequence with 5′ UTR and 3′ UTR is shown in capital letters. The protein encoding sequence is underlined, with the ATG start site shaded gray, and the translated amino acid sequence is below the underline. Bold and italicized sequences indicate the primers 55, 56, and 57

The dappled locus. a Four P-element insertions in dappled/CG2140 produce mutations with a melanotic tumor phenotype (k09716, k00107, k14202, and 01857). These four dappled insertions and the 03427 and 05643 insertions are included within the k08815 deletion. Insertions 03610 and 08492 are outside the dappled and k08815 regions. One dappled mRNA transcript has been detected, and it has one intron spanning from +120 to +1712 (dotted line). The numbers 55, 56, and 57 indicate the positions of PCR primers used to test for alternative mRNA splicing products; only the 55–57 pair produced a PCR product. Black bars indicate the dappled protein coding region. b Sequence of the dappled/CG2140 gene. The sequence of the PCR fragment obtained from primers 55 and 57 to total adult RNA was combined with the sequence data for CG2140 at Flybase (Tweedie et al. 2009). Transcribed sequence with 5′ UTR and 3′ UTR is shown in capital letters. The protein encoding sequence is underlined, with the ATG start site shaded gray, and the translated amino acid sequence is below the underline. Bold and italicized sequences indicate the primers 55, 56, and 57

Northern Blot Analysis

Total RNA was isolated using the Totally RNA kit (Ambion), and poly-A RNA was isolated using the Oligotex Direct mRNA Purification kit (Qiagen). The RNA was run on formaldehyde gels and transferred overnight using Ambion Northern Max reagents. The dappled probe was 642 bp defined by the primers 55 and 57 (Fig. 1). This 642 bp PCR fragment was subcloned using the TA cloning kit (Invitrogen), following the manufacturer’s protocol. After blue/white screening to select the colony, PCR and sequencing were used to confirm the insert and determine orientation. Transcription used T7 polymerase and 32P-labeled UTP and the Ambion Strip EZ kit following the manufacturer’s protocol. The rp49 probe was made using the primers TCCTTCCAGCTTCAAGATGACC (forward) and AGAAGTTCCTGGTGCACAACGT (reverse). Hybridization was overnight, and a Fuji phosphoimager and ImageJ were used to analyze the hybridization signal.

Blood Cell Counts

Third-instar larvae were developmentally staged as early versus late wandering phase based on retention in the gut of food dye (Zettervall et al. 2004). The Bright-Line Counting Chamber (Fisher) hemocytometer was used to count blood cells stained with monochlorobimane dye (Tirouvanziam et al. 2004) or GFP-expressing blood cells as in Zettervall et al. (2004), except that instead of red food color we used blue (Deep Blue Shade, Esco Foods, Inc.). Siblings that were heterozygous for dappled were distinguished based on either a CyO balancer with the marker y+ (i.e., y; +/dpld vs. y; +/CyO, y+) or B-galactosidase staining to indicate presence or absence of a dpld enhancer trap (Rodriguez et al. 1996). Separate counts of blood cells in y versus y+ larvae established that y did not affect the blood cell counts. Determination of sex was by the size of the gonads or by marking the sexes with y versus y+. Hemocyte counts from different samples were compared using the t test, and P values were calculated using VassarStats (http://faculty.vassar.edu/lowry/VassarStats.html).

Results

Cytochrome b5, the Encoded Product of dappled

The original dappled alleles, dpld and dpld , result from the P-element insertions (P-lacW) in strains 142/2 (k14202) and 97/16 (k09716), respectively (Rodriguez et al. 1996). The dpld allele is homozygous and hemizygous lethal, and dpld is homozygous and hemizygous viable. Heteroallelic dpld /dpld is also viable and, like dpld and dpld homozygotes and hemizygotes, has melanotic tumors (Rodriguez et al. 1996). In order to identify the gene associated with the melanotic tumor phenotype, we molecularly cloned and sequenced the dappled gene. We used the technique of plasmid rescue to isolate the genomic DNA flanking the k14202 and k09716 insertions. Sequencing of the flanking DNA and alignment to the genome placed both insertions into the 5′ UTR of CG2140 (Tweedie et al. 2009), with k09716 46 bp farther upstream than k14202 (Fig. 1). In contrast to our results, genome annotation assigned dappled as CG1624 based on the position of the lethal P-element insertion 88/15 (k08815), which did not complement the 142/2 insertion (Spradling et al. 1999). We therefore investigated this discrepancy in the identification of dappled. The 5′ and 3′ flanking sequences for the k08815 insertion are 3′-AQ034113 and 5′-AQ025871. Alignment of these flanking sequences on the latest Drosophila genome sequence, however, places them 176,059 bp apart. There are several potential causes for this gap in the sequence: multiple insertions, an error in data reporting, or a large deletion. To test for the accuracy of the k08815 flanking sequence, primers were designed to (1) flank the 3′ and 5′ insertion sites of the k08815 transposon and (2) extend from a P-element end primer (pRsyII) into a flanking sequence. The resultant PCR fragments supported the published flanking sequences, as wild-type products were not observed in the mutant strain and both insertion sites were verified with the P-element end primer (Fig. 1). Finally, these PCR products were sequenced to provide confirmation of the flanking sequences. These results indicate that k08815 is not a simple insertion but is associated with additional disruption at its genomic position. We set out to differentiate between either multiple insertions or a large deletion by performing complementation tests with other lethal insertion strains in the region. Complementation tests confirmed that a large deletion accompanies the k08815 insertion (Fig. 1). Complementation and mapping also placed two more insertions, k00107 and 01857, into the 5′ UTR and intron of CG2140/dappled, respectively (Fig. 1). We tested these various dappled mutants for alterations in transcription, further confirming that the dappled phenotype results from an effect on CG2140, by performing Northern blot analysis using RNA from dappled mutants. This analysis showed a decrease in CG2140 transcript levels in the dappled mutants compared with the Oregon R controls (Fig. 2). The dappled strains are hypomorphic, with the lethal alleles stronger. The lethal allele dpld expresses approximately 10% of wild-type embryonic RNA levels, whereas the viable allele dpld has ~80% of wild-type adult RNA levels. Analysis of the transcripts by RT-PCR and sequencing showed one splice variant, with a single intron (Fig. 1).
Fig. 2

The dappled transcript levels are reduced in dappled mutants. Northern blot analysis of dappled transcripts shows reduced levels in mutants compared with wild type. Upper panels: Northern blots after probing with labeled dappled. Lower panels: control for loading of RNA in each lane by reprobing the blots with labeled rp49. a Adult total RNA from Oregon R (lane 1), dpld /dpld transheterozygotes (lane 2), and dpld homozygotes (lane 3). b Embryonic total RNA from Oregon R (lane 1) and dpld homozygotes (lane 2); embryonic poly-A RNA from Oregon R (lane 4), and dpld homozygotes (lane 5). Lane 3 contains no RNA. Embryos from the homozygous lethal strains dpld and dpld were sorted via a Balancer chromosome expressing GFP (CyO, Kr-GFP), in order to select for the homozygous mutant embryos. Quantitation after correcting for loading using rp49 shows reduced levels of dappled RNA in all mutants. Compared with wild type, approximate levels are (a) 65% in lane 2 and 80% in lane 3; (b) 40% in lane 2 and 10% in lane 5

The dappled transcript levels are reduced in dappled mutants. Northern blot analysis of dappled transcripts shows reduced levels in mutants compared with wild type. Upper panels: Northern blots after probing with labeled dappled. Lower panels: control for loading of RNA in each lane by reprobing the blots with labeled rp49. a Adult total RNA from Oregon R (lane 1), dpld /dpld transheterozygotes (lane 2), and dpld homozygotes (lane 3). b Embryonic total RNA from Oregon R (lane 1) and dpld homozygotes (lane 2); embryonic poly-A RNA from Oregon R (lane 4), and dpld homozygotes (lane 5). Lane 3 contains no RNA. Embryos from the homozygous lethal strains dpld and dpld were sorted via a Balancer chromosome expressing GFP (CyO, Kr-GFP), in order to select for the homozygous mutant embryos. Quantitation after correcting for loading using rp49 shows reduced levels of dappled RNA in all mutants. Compared with wild type, approximate levels are (a) 65% in lane 2 and 80% in lane 3; (b) 40% in lane 2 and 10% in lane 5 Based on sequence homology from our alignments and the Flybase Genome Annotation, Drosophila gene CG2140/dappled encodes a microsomal cytochrome b5 (Fig. 1; http://flybase.org/reports/FBgn0033189.html). Genome annotation has identified CG2140 as the only cytochrome b5 in Drosophila. One related Drosophila sequence has been identified, cytochrome b5-related (Cyt-b5-r; http://flybase.org/reports/FBgn0000406.html). Cyt-b5-r has 436 residues (there are only 134 for Dappled and 135 for human cytochrome b5), and only 30 of the Cyt-b5-r residues are identical to the Dappled sequence. In a comparison of the dappled encoded amino acid sequence with a selection of other cytochrome b5 proteins from mammals and insects, Dappled has 45% identity with human cytochrome b5 and 76% identity with housefly cytochrome b5 (Fig. 3). Overall, the selected mammals and insects have 32% identity. Cytochrome b5 is a highly conserved, ubiquitous family of small hemoproteins that participate in electron transfer in multiple biochemical reactions. These reactions are involved in many biological processes, such as conversion of methemoglobin, sterol metabolism, fatty acid desaturation, and cytochrome P450-catalyzed reactions (Schenkman and Jansson 2003).
Fig. 3

Cytochrome b5 sequences. The sequences of Dappled and selected other cytochrome b5 proteins from insects and mammals are compared using Clustal W for alignment and consensus generation (Prim. Cons.). See Wang et al. (2007) for an X-ray crystal structure comparison of the heme binding domain, residues 6–95. Note the high sequence identity within this region, which is 82% for residues 40–73. Sequence accession numbers are Rattus norvegicus GenBank AAB67610.1; Mus musculus Swiss-Prot P56395.2; Sus scrofa Swiss-Prot P00172.3, Homo sapiens GenBank AAA35729.1; Drosophila dappled GenBank HQ864711; Musca domestica GenBank AAA56985.1; Anopheles gambiae GenBank AAO24766.1

Cytochrome b5 sequences. The sequences of Dappled and selected other cytochrome b5 proteins from insects and mammals are compared using Clustal W for alignment and consensus generation (Prim. Cons.). See Wang et al. (2007) for an X-ray crystal structure comparison of the heme binding domain, residues 6–95. Note the high sequence identity within this region, which is 82% for residues 40–73. Sequence accession numbers are Rattus norvegicus GenBank AAB67610.1; Mus musculus Swiss-Prot P56395.2; Sus scrofa Swiss-Prot P00172.3, Homo sapiens GenBank AAA35729.1; Drosophila dappled GenBank HQ864711; Musca domestica GenBank AAA56985.1; Anopheles gambiae GenBank AAO24766.1

Hemocyte Misregulation and Melanotic Nodule Formation in dappled Mutants

The dpld insertion has made analysis possible, as in addition to producing consistent melanotic tumor formation, it is the only viable allele. Maintenance of dpld homozygotes as a stock, however, was not feasible because of effects on fertility. Homozygous dpld or transheterozygous dpld /dpld females and males produced few progeny, even when mated with wild-type flies (<5 progeny/dappled parent), and mutant females laid few eggs (~50/female). It is unlikely that this fertility problem is due simply to physical obstruction in the abdomen, because flies with less obtrusive tumors (i.e., small tumors near the thorax) also show low fertility. To avoid the effects of accumulation of second site mutations by maintaining the dpld chromosome over a balancer, all experiments were done on progeny from crosses that produced transheterozygotes or hemizygotes. The development of the Gal4–UAS system (Brand and Perrimon 1993) to include drivers for the hematopoietic system makes it more feasible to be able to investigate the blood cell phenotypes of mutant genes, for example, Kimbrell et al. (2002) and Zettervall et al. (2004). The hemese-Gal4 construct drives expression in blood cells of the plasmatocyte and lamellocyte classes (Zettervall et al. 2004). Strains with hemese-Gal4 UAS-GFP thus have the blood cells marked with GFP, enabling hemocyte counting and phenotype analysis in various genetic strains (Zettervall et al. 2004). We used hemese-Gal4 UAS-GFP to investigate the blood cells of dappled melanotic tumor mutants. In melanotic tumors of dpld /dpld ; hemese-Gal4 UAS-GFP larvae, all of the cells in the masses were found to fluoresce strongly for GFP (Fig. 4). Cell counts of circulating plasmatocytes and lamellocytes showed large numbers of circulating lamellocytes (Fig. 4). Lamellocytes are not found in normal, healthy larvae, whereas in melanotic nodule mutants lamellocytes are abundant (Crozatier and Meister 2007). The dappled melanotic tumors are thus specifically designated as melanotic nodules, which consist of hemocytes, as opposed to melanizations, which are non-blood cell tissues that have melanized (Minakhina and Steward 2006b).
Fig. 4

Hemocytes of dappled viable mutants. a Hemocytes visualized by GFP expression show (left) melanotic tumors/nodules in a third-instar larva as clumps of hemocytes that are partially melanized, along with circulating plasmatocytes, and (right), at higher magnification, lamellocytes. Lamellocytes are approximately four times larger than plasmatocytes. GFP expression is driven by the hemese-Gal4 driver. b Cell counts of circulating hemocytes in early and late wandering third-instar larvae show high levels of lamellocytes and characterize the dynamic process of melanotic tumor formation by comparing mutants with small (left bars) versus large (right bars) melanotic nodules. Error bars show 0.95 confidence limits. N ≥ 15 for each category. (Color figure online)

Hemocytes of dappled viable mutants. a Hemocytes visualized by GFP expression show (left) melanotic tumors/nodules in a third-instar larva as clumps of hemocytes that are partially melanized, along with circulating plasmatocytes, and (right), at higher magnification, lamellocytes. Lamellocytes are approximately four times larger than plasmatocytes. GFP expression is driven by the hemese-Gal4 driver. b Cell counts of circulating hemocytes in early and late wandering third-instar larvae show high levels of lamellocytes and characterize the dynamic process of melanotic tumor formation by comparing mutants with small (left bars) versus large (right bars) melanotic nodules. Error bars show 0.95 confidence limits. N ≥ 15 for each category. (Color figure online) Mutant dappled larvae were categorized based on the relative size of the melanotic nodules. Larvae with small versus large melanotic nodules showed different numbers of circulating plasmatocytes and lamellocytes (Fig. 4). Notably, lamellocytes are more prevalent in small tumors, whereas plasmatocytes are more abundant in large nodules. One possible interpretation of the higher number of lamellocytes in smaller nodules is that these nodules are still actively forming, and lamellocytes are still being recruited to the nodules. During normal larval development, the number of plasmatocytes typically increases two- to threefold from the early wandering (early) to the late wandering (late) stage of the third instar (Crozatier and Meister 2007; Zettervall et al. 2004). Plasmatocyte representation from early to late stage wandering was different for small and large tumors. Larvae with large tumors showed an increase from early to late stage, whereas larvae with small tumors did not (Fig. 4), and this may also reflect the dynamic nature of dappled melanotic nodule formation. Heterozygosity of dappled does not produce tumors, but it does have a dominant effect on blood cell number. The dappled heterozygotes (Bal/dpld) have a significantly higher number of plasmatocytes than wild-type larvae (+/+). This difference was confirmed by counting hemocytes of dappled heterozygotes (dpld/+) and their control siblings (Bal/+) (Fig. 5). Further, counts of siblings showed that the increase in plasmatocytes is present both early and late in the third instar. The relative numbers of lamellocytes in dappled heterozygotes is less clear, as the average was very low, many larvae had no lamellocytes, and the number did not increase from early to late stage (Fig. 5). Thus, although the lamellocyte data are statistically significant (P < 0.05), dappled heterozygosity at most yields a very weak induction of lamellocyte differentiation.
Fig. 5

Plasmatocytes and lamellocytes are increased in dappled heterozygotes. a Cell counts of plasmatocytes during late third instar of dappled heterozygotes, over a Balancer (Bal) or wild-type (+) chromosome, show significantly more plasmatocytes than wild-type (+/+) and Balancer (Bal/+) controls. Counts were normalized across three experiments to the percentage of controls. The average for control +/+ was 5,697 cells/larva and Bal/+ was 4,935 cells/larva. P < 0.01 for dpld/+ versus Bal/+, and P < 0.05 for Bal/dpld versus +/+. b Cell counts of plasmatocytes of dappled heterozygotes and controls that are siblings show that the increase in plasmatocytes has already occurred by early wandering third instar. Additionally, dappled heterozygotes show a normal increase, which is approximately two- to threefold, in plasmatocyte number from early to late stage. Counts were normalized across three experiments to the percentage of control Bal/+ late, which averaged 4,125 cells/larva. P < 0.01 for both early and late of dpld/+ versus Bal/+. c Cell counts of the larvae (b) show that lamellocytes are also increased. Control Bal/+ larvae had no lamellocytes in any sample. P < 0.05 for both early and late dpld/+ versus Bal/+. The average number of cells in early dappled heterozygotes was 5, with high variability and no significant difference from late dappled heterozygotes (P > 0.05). N ≥ 15 per genotype for each experiment

Plasmatocytes and lamellocytes are increased in dappled heterozygotes. a Cell counts of plasmatocytes during late third instar of dappled heterozygotes, over a Balancer (Bal) or wild-type (+) chromosome, show significantly more plasmatocytes than wild-type (+/+) and Balancer (Bal/+) controls. Counts were normalized across three experiments to the percentage of controls. The average for control +/+ was 5,697 cells/larva and Bal/+ was 4,935 cells/larva. P < 0.01 for dpld/+ versus Bal/+, and P < 0.05 for Bal/dpld versus +/+. b Cell counts of plasmatocytes of dappled heterozygotes and controls that are siblings show that the increase in plasmatocytes has already occurred by early wandering third instar. Additionally, dappled heterozygotes show a normal increase, which is approximately two- to threefold, in plasmatocyte number from early to late stage. Counts were normalized across three experiments to the percentage of control Bal/+ late, which averaged 4,125 cells/larva. P < 0.01 for both early and late of dpld/+ versus Bal/+. c Cell counts of the larvae (b) show that lamellocytes are also increased. Control Bal/+ larvae had no lamellocytes in any sample. P < 0.05 for both early and late dpld/+ versus Bal/+. The average number of cells in early dappled heterozygotes was 5, with high variability and no significant difference from late dappled heterozygotes (P > 0.05). N ≥ 15 per genotype for each experiment

Rescue of Hemocyte Phenotype but Not Lethality by Wild-Type dappled in Blood Cells

We next asked if the dappled phenotype could be rescued by expressing wild-type dappled only in blood cells. We constructed a plasmid containing UAS-dpld, which was used to make transgenic strains with UAS-dpld in different chromosomal locations. The hemese-Gal4 was then used to drive UAS-dpld, and the rates of melanotic nodule formation were compared in dappled mutants and controls. In addition to hemocytes, hemese-Gal4 drives strong expression in the salivary glands, so a control salivary gland driver, sgs3-Gal4, was also used to drive UAS-dpld. To test for rescue of lethality by ubiquitous expression, the da-Gal4 driver (Pili-Floury et al. 2004) was used. The dappled mutants with hemese-Gal4, but not sgs3-Gal4, driving UAS-dpld are rescued from the melanotic phenotype. Three different UAS-dpld insertions were tested with hemese-Gal4, and all showed similar rates of rescue (Table 1). Dissections were performed to determine if blood cell nodules might be forming but not melanizing. The dissections confirmed that blood cell nodule formation without accompanying melanization did not occur.
Table 1

Melanotic tumor phenotype is rescued by dappled expression in hemocytes

Cell type Gal4; UAS Percentage (n) of adultsa with melanotic nodulesTotal N
Negative controlb Positive controlc Rescue testd
Blood cells hemese-Gal4; UAS-dpld line 10% (352)87.5% (32)5% (121)505
hemese-Gal4; UAS-dpld line 3a0% (526)94.1% (43)7.5% (105)674
hemese-Gal4; UAS-dpld line 9b0% (353)93% (17)5.7% (106)476
Control sgs3-Gal4; UAS-dpld e 0% (514)89.3% (75)81.6% (103)692

aAdults are progeny from crosses of w; CyO/dpldMLB; Gal4 females with w/Y; CyO/dpldEJL; TM3,Sb or UAS-dpld/UAS-dpld males

bAll genotypes with CyO/dpldMLB or EJL. Two thirds of the progeny are expected to be in this category

c dpld transheterozygotes with Gal4 or UAS

d dpld transheterozygotes with both Gal4 and UAS

eResults with all three UAS-dpld lines

Melanotic tumor phenotype is rescued by dappled expression in hemocytes aAdults are progeny from crosses of w; CyO/dpldMLB; Gal4 females with w/Y; CyO/dpldEJL; TM3,Sb or UAS-dpld/UAS-dpld males bAll genotypes with CyO/dpldMLB or EJL. Two thirds of the progeny are expected to be in this category c dpld transheterozygotes with Gal4 or UAS d dpld transheterozygotes with both Gal4 and UAS eResults with all three UAS-dpld lines The dominant effect of heterozygous dappled on plasmatocyte number is also rescued by adding dappled expression to blood cells. Hemocyte counts of dappled heterozygotes with hemese-Gal4 driving UAS-dpld had, on average, reduced numbers of hemocytes, compared with control dappled heterozygotes (Fig. 6). The number of lamellocytes in heterozygotes was also reduced on average, but with the small number and variability in lamellocytes, was not significantly different (Fig. 6). These results do not necessarily rule out other tissues as important for the dappled mutant blood cell phenotypes, but rather emphasize that the level of dappled expression in the blood cells regulates number and differentiation.
Fig. 6

Rescue of dappled heterozygote phenotype by expression of wild-type dappled in hemocytes. The dappled heterozygotes with UAS-dpld driven by hemese-Gal4 (Bal/dpld UAS-dpld) were compared with controls without UAS and Gal4 (Bal/dpld and Bal/+). Counts were normalized across three experiments to the percentage of Bal/dpld. Plasmatocyte counts (a) are significantly reduced in rescued larvae compared with Bal/dpld (P < 0.05), but not compared with Bal/+ (P > 0.05). Lamellocyte counts (b) are reduced on average in rescued larvae, but not to a significant extent (P > 0.05, compared with both Bal/dpld and Bal/+). N ≥ 15 per genotype for each experiment

Rescue of dappled heterozygote phenotype by expression of wild-type dappled in hemocytes. The dappled heterozygotes with UAS-dpld driven by hemese-Gal4 (Bal/dpld UAS-dpld) were compared with controls without UAS and Gal4 (Bal/dpld and Bal/+). Counts were normalized across three experiments to the percentage of Bal/dpld. Plasmatocyte counts (a) are significantly reduced in rescued larvae compared with Bal/dpld (P < 0.05), but not compared with Bal/+ (P > 0.05). Lamellocyte counts (b) are reduced on average in rescued larvae, but not to a significant extent (P > 0.05, compared with both Bal/dpld and Bal/+). N ≥ 15 per genotype for each experiment Expression of wild-type dappled in blood cells did not rescue the mutant lethality. In contrast, ubiquitous expression of wild-type dappled completely rescued the mutant lethality, producing normal adults with no tumors (Table 2). These results are consistent with the aberrant tissue morphology of lethal dappled (Rodriguez et al. 1996) and establish the importance of dappled transcript levels for normal function in other tissues.
Table 2

Hemocyte expression of dappled is insufficient for rescue of lethality

Expression type Gal4; UAS Percentage (n) survival of adultsa Total N
Controlb Rescue testc
Ubiquitous daughterless-Gal4; UAS-dpld 84.6% (1503)15.4% (273)1776
Blood cells hemese-Gal4; UAS-dpld 100% (1086)0% (0)1086

aAdults are progeny from crosses of w; CyO/dpldEJL;TM3,Sb or UAS-dpld/UAS-dpld females with w/Y; CyO/Df1888;TM3,Sb/Gal4 males

b CyO/dpldEJL or CyO/Df(2R)ST1 with Gal4 or UAS. 85% of the total progeny are expected to be in this category

c dpldEJL/Df(2R)ST1 with both Gal4 and UAS. 15% of the total progeny are expected to be in this category

Hemocyte expression of dappled is insufficient for rescue of lethality aAdults are progeny from crosses of w; CyO/dpldEJL;TM3,Sb or UAS-dpld/UAS-dpld females with w/Y; CyO/Df1888;TM3,Sb/Gal4 males b CyO/dpldEJL or CyO/Df(2R)ST1 with Gal4 or UAS. 85% of the total progeny are expected to be in this category c dpldEJL/Df(2R)ST1 with both Gal4 and UAS. 15% of the total progeny are expected to be in this category

Effect of dappled on Hematopoietic Waves During Development

The dappled nodules form early in larval development, which is more consistent with an increase of plasmatocytes from the first hematopoietic wave (embryonic origin) rather than the second hematopoietic wave (lymph gland origin at the end of the third instar). As noted above, plasmatocytes in dappled tumors express the hemese-Gal4 driver, which does not express in the lymph glands, further indicating an early developmental origin for these cells. Additionally, the lymph glands appear normal, at least at a gross level, and only one dappled enhancer trap expresses in the lymph glands (Rodriguez et al. 1996). We analyzed 1 kb of the dappled upstream region for potential binding by blood cell, lymph gland, and other transcription factors using the Transfac database (Wingender 2008) provided by Biobase Biological Databases (http://www.biobase-international.com/index.php?id=home). Among the transcription factor binding sites are many that are predicted to be T cell factor/pan binding sites (Brunner et al. 1997), consistent with blood cell expression, and tinman/Nkx2.5 binding sites (Kimbrell et al. 2002), suggesting lymph gland expression (Table 3).
Table 3

Predicted T cell factor/pangolin and Nkx 2.5/tinman sites

T cell factor/pangolin
 −730(+) 1.000 0.994 gcgtaTCAAAagcaca TCF
 −687(−) 0.964 0.946 gcttagTTTGTtgtta TCF
 −611(−) 0.928 0.919 gactgtTTTTAttgaa TCF
 −440(−) 0.928 0.929 atacatTTTTAttaat TCF
 −430(+) 0.928 0.922 attaaTGAAAtggtct TCF
 −408(−) 0.957 0.938 aataaaTTTGCttacg TCF
 −395(−) 0.964 0.948 acgaatTTTGTttgta TCF
 −383(−) 0.928 0.922 tgtacaTTTCAtttga TCF
 −170(+) 0.964 0.944 tgtaaACAAAttataa TCF
Nkx 2.5/tinman
 −939(−) 0.801 0.786 tgattgAAGTTggcaa NKX2.5
 −935(+) 0.869 0.828 tgAAGTT NKX2.5
 −923(−) 0.869 0.870 AACTTaa NKX2.5
 −896(+) 1.000 0.859 cccgtCACTTgaatta NKX2.5
 −894(+) 1.000 0.971 cgtCACTTga NKX2.5
 −891(−) 1.000 1.000 CACTTga NKX2.5
 −795(+) 0.844 0.805 taggcCACTCcaggat NKX2.5
 −780(+) 0.800 0.819 tgcCAATTgc NKX2.5
 −761(−) 0.869 0.823 AACTTac NKX2.5
 −711(+) 1.000 0.741 gccgtCACTTatcaat NKX2.5
 −709(+) 1.000 0.906 cgtCACTTat NKX2.5
 −706(−) 1.000 0.939 CACTTat NKX2.5
 −677(+) 0.801 0.732 ttgttAACTTgaattg NKX2.5
 −672(−) 0.869 0.884 AACTTga NKX2.5
 −551(+) 0.869 0.828 tgAAGTC NKX2.5
 −429(−) 0.788 0.751 ttaatgAAATGgtctg NKX2.5
 −377(+) 0.800 0.815 tttCATTTga NKX2.5
 −374(−) 0.783 0.808 CATTTga NKX2.5
 −235(+) 0.833 0.818 tgatcCACTAtacaat NKX2.5
 −145(+) 0.869 0.823 atAAGTT NKX2.5

Predicted by Transfac Professional Match 2009.3, provided by Biobase Biological Databases

Predicted T cell factor/pangolin and Nkx 2.5/tinman sites Predicted by Transfac Professional Match 2009.3, provided by Biobase Biological Databases We tested for dappled effects in both hematopoietic waves by counting plasmatocytes at a time in development when cells of both hematopoietic waves are present. Cells of the two waves were differentiated by (1) using hemese-Gal4 to drive UAS-GFP in cells from the first wave of development, so that first-wave cells fluoresced green, and (2) staining all hemocytes with monochlorobimane dye, so that the second-wave hemocytes fluoresced blue but not green. The developmental stage selected to have both sets of hemocytes was white prepupae, age 0–3 h postformation as white prepupae. These results show that heterozygosity of dappled increases the number of plasmatocytes from both hematopoietic waves (Table 4).
Table 4

Hemocyte number differs by sex during development in wild type and dappled

GenotypeSexNumber of hemocytes (±95% confidence interval)
Average for embryonic originAverage for lymph gland originTotal cells
Wild typeMale3380 (±753)4610 (±942)7990 (±1237)
Female5413 (±1492)6956 (±1505)12369 (±2109)
P, male vs. female<0.01<0.001<0.01
dpld a Male6455 (±1128)6675 (±1268)13130 (±1716)
Female8628 (±1879)8987 (±1374)17615 (±3013)
P, male vs. female<0.05<0.01<0.01
Wild type vs. dpld a P, male vs. male<0.001<0.01<0.001
P, female vs. female<0.01<0.05<0.01

a dpld heterozygotes, dpldEJL/+

Hemocyte number differs by sex during development in wild type and dappled a dpld heterozygotes, dpldEJL/+ Mutation of dappled affects both sexes similarly, and our results show both sexes together (Figs. 4, 5, 6). Similar numbers of the sexes are needed per sample, however, as the sexes differ in the number of hemocytes. For the experiment depicted in Table 4, we separated the sexes in order to demonstrate this finding and test for a sex difference in the second hematopoietic wave as well. The results are that in both wild type and dappled there is a significant difference between males and females in the number of hemocytes for both hematopoietic waves.

Curcumin Enhancement of the dappled Melanotic Phenotype

Cytochrome b5 is widely studied for its effects on drug metabolism, and conversely, various drugs are investigated for alteration of cytochrome b5 levels (El-Lakkany et al. 2004; Juvonen et al. 1992; Portoles et al. 1989; Schenkman and Jansson 1999; Sheweita 2004; Yamaori et al. 2003; Yamazaki et al. 2002). We hypothesized that modulation of the dappled phenotype could be used as an in vivo assay for cytochrome b5 related effects of endogenous and xenobiotic compounds. We are therefore screening compounds with a known connection to cytochrome P450s and/or anti-inflammatory and anticarcinogenic properties for enhancement or suppression of the dappled melanotic phenotype. Initial studies with aspirin and the corticosteroid dexamethasone are negative (data not shown), whereas curcumin, the active ingredient in the spice turmeric, has consistently shown an enhancement of the melanotic phenotype (Table 5; Fig. 7). Adult dappled mutants that have been raised (egg to adult) on curcumin-supplemented food have an enhanced melanotic phenotype, showing more and/or larger melanotic tumors (Table 5). The enhanced phenotype of the dappled mutants is already evident in the larval stages (Fig. 7). Adult dappled heterozygotes, however, do not develop a melanotic phenotype when raised on curcumin (Table 5). Since both the heterozygotes and heteroallelic mutants have some reduction in dappled transcript levels, the effects of curcumin may depend on the exact amount of cytochrome b5 protein that is produced.
Table 5

Curcumin enhances the melanotic tumor phenotype of dappled

DietPercentage of adultsa with melanotic tumors
Genotypeb (N)Melanotic nodule severity (%)c
Balancer dpld 123456
Normal0% (373)90.3% (154)0.63.959.125.31.39.7
Curcumin supplement0% (762)87.1% (310)1.626.856.11.31.312.9

aAdults are progeny from crosses between w; CyO/dpldMLB and w; CyO/dpldEJL

b“Balancer” indicates heterozygous CyO/dpldMLB or EJL. “dpld” indicates transheterozygous dpldMLB/dpldEJL

cSeverity decreases left to right. Category 1 is defined as multiple small nodules; 2, single large or >1 typical nodule; 3, typical nodule; 4, small nodule; 5, very small nodule; 6, no nodule

Fig. 7

Curcumin enhances the dappled melanotic phenotype. The dappled mutants on the left (a, c, and e) were raised on curcumin-supplemented food. Those on the right (b and d) were raised on normal food. f Free-floating melanotic tumors from a curcumin-fed adult. (Color figure online)

Curcumin enhances the melanotic tumor phenotype of dappled aAdults are progeny from crosses between w; CyO/dpldMLB and w; CyO/dpldEJL b“Balancer” indicates heterozygous CyO/dpldMLB or EJL. “dpld” indicates transheterozygous dpldMLB/dpldEJL cSeverity decreases left to right. Category 1 is defined as multiple small nodules; 2, single large or >1 typical nodule; 3, typical nodule; 4, small nodule; 5, very small nodule; 6, no nodule Curcumin enhances the dappled melanotic phenotype. The dappled mutants on the left (a, c, and e) were raised on curcumin-supplemented food. Those on the right (b and d) were raised on normal food. f Free-floating melanotic tumors from a curcumin-fed adult. (Color figure online)

Discussion

We have identified dappled as a member of the conserved, ubiquitous cytochrome b5 family. The complexities of cytochrome b5 function, through its participation in electron transfer in multiple biochemical reactions, are reflected in the difficulties and limited study of its genetics in higher organisms. Characterizations in humans have shown that cytochrome b5 mutation causes methemoglobinemia, which interferes with the balance between hemoglobin and methemoglobin, thus affecting oxygenation and inflammation (Hegesh et al. 1986; Umbreit 2007). Mutation of cytochrome b5 reductase also causes methemoglobinemia and is more common (Davis et al. 2004). In addition, one case of cytochrome b5 methemoglobinemia may also have been associated with hormonal defects (Giordano et al. 1994). With the exception of a porcine mutation associated with an altered androstenone level (Lin et al. 2005), cytochrome b5 mutations in other organisms have not been identified. In mice, cytochrome b5 deletion is also lethal, but experiments with a tissue-specific knockout have allowed liver function to be addressed (Finn et al. 2008). With our studies of dappled, Drosophila now provides a tractable genetic model for the study of cytochrome b5 in blood cells and other tissues. Hemocytes are particularly sensitive to mutation of dappled and show that cytochrome b5 functions to produce normal differentiation and numbers of hemocytes. Mutation of one copy of dappled results in a significant increase in the number of circulating hemocytes, and mutation of both copies results in the formation of melanotic nodules. The formation of dappled melanotic nodules is a Class 2 reaction in the classification of Watson et al. (1991), in which Class 2 represents alteration of immune cells and Class 1 represents normal immune cells responding to other cell types that are aberrant. The dominant effect on blood cell number emphasizes that wild-type levels of cytochrome b5 are needed for full normal functions. In humans, levels of cytochrome b5 have been implicated as important with respect to xenobiotic metabolism and health. Kurian et al. (2007) hypothesized that functionally significant genetic variability in cytochrome b5 occurs in individuals without clinical symptoms. They investigated processing of hydroxylamines, which are oxidative products of arylamine drugs and environmental carcinogens, by the mutant cytochrome b5 of one heterozygous individual and found, in vitro, altered affinity for hydroxylamine substrates and dramatically reduced cytochrome b5 expression (Kurian et al. 2007). Expression of wild-type dappled in hemocytes rescued both the increase in blood cell number and the formation of melanotic nodules. The driver used was hemese-Gal4, which is active in circulating plasmatocytes and sessile hemocytes, but not the lymph glands (Markus et al. 2009; Zettervall et al. 2004). Interestingly, the sessile hemocytes are a newly discovered hematopoietic site and appear to be the main developmental origin of lamellocytes (Markus et al. 2009). This site of expression may be the key factor in rescuing the dappled melanotic nodule phenotype. Rescue of the plasmatocyte increase in dappled heterozygotes is expected to result from the hemese-Gal4 expression in circulating blood cells of the first hematopoietic wave, both because of the age of the larvae (prerelease of lymph gland cells) and because hemese-Gal4 does not express in lymph glands. However, dappled also increased the number of hemocytes from the second hematopoietic wave. Hemocytes from both developmental origins, embryonic and lymph gland, require dappled in order to be produced in normal amounts. It is an interesting question as to whether the plasmatocyte increase in dappled mutants can be independently controlled in the first and second hematopoietic waves. Does the increase in plasmatocytes indicate overproliferation or less apoptosis? Since dappled encodes a cytochrome b5, the obvious choice would be apoptosis rather than overproliferation. There are two problems with this choice: it is mitochondrial cytochrome b5 that is established in the canonical cytochrome C signaling apoptotic pathway, and the use of that pathway by Drosophila is controversial (Kornbluth and White 2005; Means and Hays 2007; Oberst et al. 2008; Ow et al. 2008). Microsomal cytochrome b5, however, has also been suggested to be involved in cytochrome C mediated apoptosis (Davydov 2001), and Drosophila may have its own version of apoptotic signaling that uses the dappled cytochrome b5. Further, blood cells are well described for their role in response to apoptotic cells, but the role of their own apoptosis in development and infection is not clear (Bruckner et al. 2004; Crozatier and Meister 2007; Lemaitre and Hoffmann 2007). The sensitivity of hemocytes (compared with other cell types) to dappled mutation may result from blood cell mitotic cell division continuing during development (Crozatier and Meister 2007). There are many potential mechanisms for dappled to affect overproliferation, especially given the increasingly complex functions of plasmatocytes (Charroux and Royet 2009). One option consistent with cytochrome b5 function, and potentially the dappled effects on fertility, is that hormonal signaling of hematopoiesis is affected. In that case, however, rescue of the dappled blood cell phenotype would be predicted by adding back wild-type dappled expression in the steroid-producing ring gland (Gilbert 2004) rather than hemocytes. Alternatively, dappled expression could rescue a steroid-processing step in the hemocytes. An intriguing option is that cytochrome b5 has a new, previously unidentified role in blood cell signaling pathways, for example, through JAK/Stat or JNK. More specifically, a candidate to mediate the effects of dappled is TNF-receptor associated factor 6 (Traf6), which is predicted from protein studies to interact with cytochrome b5 (Drosophila Interactions Database, http://www.droidb.org). Among its activities, Traf6 is an upstream activator of nuclear factor-kappaB, and mutants are immune response defective (Cha et al. 2003; Wu and Arron 2003). Cytochrome b5 involvement with Traf6 is a testable hypothesis through analysis of genetic interaction between dappled and Traf6 mutants. Our results with curcumin demonstrate that screening of endogenous and xenobiotic compounds for effects on the dappled phenotypes can be done as an in vivo approach for analysis of cytochrome b5. Curcumin is widely studied for its potential as a nutritional pharmaceutical (Duvoix et al. 2005; Jagetia and Aggarwal 2007). Among its many activities, which are mainly anti-inflammatory and anticancer, curcumin inhibits cytochrome P450s, down-regulates NFkB, and affects apoptosis and the cell cycle (Alpers 2008; Appiah-Opong et al. 2007; Kwon et al. 2007; Sa and Das 2008). Curcumin enhanced the melanotic phenotype of dappled mutants. This effect of curcumin is consistent with NFkB involvement, but there are other alternatives, in particular, cytochrome P450 processing in the fat body. Mutation of dappled showed similar effects in females and males, but an unexpected consequence of our studies is the finding that females and males differ significantly in the number of circulating blood cells. In humans, a difference between the sexes in the numbers of blood cell types is well established, but the effects are unclear (Blum and Pabst 2007; Huppert et al. 1998; Reichert et al. 1991). In both humans and Drosophila, there are differences in the immune responses between the sexes that affect health (Dale et al. 2006; Marriott and Huet-Hudson 2006; Shames 2002; Taylor and Kimbrell 2007; Ye et al. 2009; Zandman-Goddard et al. 2007), and the blood cell number differential may be part of mediating the immune response differences. Recently, Drosophila hemocytes have been shown to directly signal immune induction of the fat body, and a reduced number of hemocytes resulted in less immune induction (Shia et al. 2009). In Drosophila, the increase in hemocytes of dappled and females may result in higher immune induction, which may or may not provide a healthier condition. For example, human females typically have a more robust immune response but also a higher incidence of autoimmune disorders (Dale et al. 2006; Zandman-Goddard et al. 2007). Cytochrome b5 expression is critical for survival, and its importance to hemocytes and additional tissues is emphasized by the finding that ubiquitous, but not hemocyte, expression of wild-type dappled rescued lethality. The functions of cytochrome b5 are open for testing in a wide range of tissue types using dappled. In all respects, genetic interaction and drug screens for suppressors and enhancers of dappled will be useful ways to discern the many roles of cytochrome b5 function.
  84 in total

Review 1.  Interactions between cytochrome P450 and cytochrome b5.

Authors:  J B Schenkman; I Jansson
Journal:  Drug Metab Rev       Date:  1999-05       Impact factor: 4.518

2.  Melanotic mutants in Drosophila: pathways and phenotypes.

Authors:  Svetlana Minakhina; Ruth Steward
Journal:  Genetics       Date:  2006-07-02       Impact factor: 4.562

Review 3.  Tumor-suppressor genes, hematopoietic malignancies and other hematopoietic disorders of Drosophila melanogaster.

Authors:  E Gateff
Journal:  Ann N Y Acad Sci       Date:  1994-04-15       Impact factor: 5.691

Review 4.  The many roles of cytochrome b5.

Authors:  John B Schenkman; Ingela Jansson
Journal:  Pharmacol Ther       Date:  2003-02       Impact factor: 12.310

5.  The PDGF/VEGF receptor controls blood cell survival in Drosophila.

Authors:  Katja Brückner; Lutz Kockel; Peter Duchek; Carlos M Luque; Pernille Rørth; Norbert Perrimon
Journal:  Dev Cell       Date:  2004-07       Impact factor: 12.270

6.  Sessile hemocytes as a hematopoietic compartment in Drosophila melanogaster.

Authors:  Róbert Márkus; Barbara Laurinyecz; Eva Kurucz; Viktor Honti; Izabella Bajusz; Botond Sipos; Kálmán Somogyi; Jesper Kronhamn; Dan Hultmark; István Andó
Journal:  Proc Natl Acad Sci U S A       Date:  2009-03-04       Impact factor: 11.205

7.  Drosophila homolog of the human S6 ribosomal protein is required for tumor suppression in the hematopoietic system.

Authors:  K L Watson; K D Konrad; D F Woods; P J Bryant
Journal:  Proc Natl Acad Sci U S A       Date:  1992-12-01       Impact factor: 11.205

Review 8.  Gender and autoimmunity.

Authors:  Gisele Zandman-Goddard; Elena Peeva; Yehuda Shoenfeld
Journal:  Autoimmun Rev       Date:  2006-11-13       Impact factor: 9.754

9.  The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes.

Authors:  A C Spradling; D Stern; A Beaton; E J Rhem; T Laverty; N Mozden; S Misra; G M Rubin
Journal:  Genetics       Date:  1999-09       Impact factor: 4.562

10.  Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.

Authors:  A H Brand; N Perrimon
Journal:  Development       Date:  1993-06       Impact factor: 6.868

View more
  4 in total

Review 1.  As the fat flies: The dynamic lipid droplets of Drosophila embryos.

Authors:  Michael A Welte
Journal:  Biochim Biophys Acta       Date:  2015-04-13

2.  Perturbation of IIS/TOR signaling alters the landscape of sex-differential gene expression in Drosophila.

Authors:  Rita M Graze; Ruei-Ying Tzeng; Tiffany S Howard; Michelle N Arbeitman
Journal:  BMC Genomics       Date:  2018-12-10       Impact factor: 3.969

3.  An alternative CYB5A transcript is expressed in aneuploid ALL and enriched in relapse.

Authors:  Lorenz Bartsch; Michael P Schroeder; Sonja Hänzelmann; Lorenz Bastian; Juan Lázaro-Navarro; Cornelia Schlee; Jutta Ortiz Tanchez; Veronika Schulze; Konstandina Isaakidis; Michael A Rieger; Nicola Gökbuget; Cornelia Eckert; Hubert Serve; Martin Horstmann; Martin Schrappe; Monika Brüggemann; Claudia D Baldus; Martin Neumann
Journal:  BMC Genom Data       Date:  2022-04-18

4.  Cytochrome b5 protects photoreceptors from light stress-induced lipid peroxidation and retinal degeneration.

Authors:  Xinping Chen; Hana Hall; Jeffrey P Simpson; Walter D Leon-Salas; Donald F Ready; Vikki M Weake
Journal:  NPJ Aging Mech Dis       Date:  2017-12-04
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.