Literature DB >> 21249150

Cross-regulation between oncogenic BRAF(V600E) kinase and the MST1 pathway in papillary thyroid carcinoma.

Seong Jin Lee1, Min Hee Lee, Dong Wook Kim, Seongeun Lee, Songmei Huang, Min Jeong Ryu, Yong Kyung Kim, Sung Jin Kim, Soung Jung Kim, Jung Hwan Hwang, Sangphil Oh, Heeyeong Cho, Jin Man Kim, Dae-Sik Lim, Young Suk Jo, Minho Shong.   

Abstract

BACKGROUND: The BRAF(V600E) mutation leading to constitutive signaling of MEK-ERK pathways causes papillary thyroid cancer (PTC). Ras association domain family 1A (RASSF1A), which is an important regulator of MST1 tumor suppressor pathways, is inactivated by hypermethylation of its promoter region in 20 to 32% of PTC. However, in PTC without RASSF1A methylation, the regulatory mechanisms of RASSF1A-MST1 pathways remain to be elucidated, and the functional cooperation or cross regulation between BRAF(V600E) and MST1,which activates Foxo3,has not been investigated. METHODOLOGY/PRINCIPAL
FINDINGS: The negative regulators of the cell cycle, p21 and p27, are strongly induced by transcriptional activation of FoxO3 in BRAF(V600E) positive thyroid cancer cells. The FoxO3 transactivation is augmented by RASSF1A and the MST1 signaling pathway. Interestingly, introduction of BRAF(V600E)markedly abolished FoxO3 transactivation and resulted in the suppression of p21 and p27 expression. The suppression of FoxO3 transactivation by BRAF(V600E)is strongly increased by coexpression of MST1 but it is not observed in the cells in which MST1, but not MST2,is silenced. Mechanistically, BRAF(V600E)was able to bind to the C-terminal region of MST1 and resulted in the suppression of MST1 kinase activities. The induction of the G1-checkpoint CDK inhibitors, p21 and p27,by the RASSF1A-MST1-FoxO3 pathway facilitates cellular apoptosis, whereas addition of BRAF(V600E) inhibits the apoptotic processes through the inactivation of MST1. Transgenic induction of BRAF(V600E)in the thyroid gland results in cancers resembling human papillary thyroid cancers. The development of BRAF(V600E)transgenic mice with the MST1 knockout background showed that these mice had abundant foci of poorly differentiated carcinomas and large areas without follicular architecture or colloid formation.
CONCLUSIONS/SIGNIFICANCE: The results of this study revealed that the oncogenic effect of BRAF(V600E) is associated with the inhibition of MST1 tumor suppressor pathways, and that the activity of RASSF1A-MST1-FoxO3 pathways determines the phenotypes of BRAF(V600E) tumors.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21249150      PMCID: PMC3020965          DOI: 10.1371/journal.pone.0016180

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Activating mutations in the BRAF gene are found at high frequency in various human cancers, and BRAFV600E is the most common of these activating mutations, especially in papillary thyroid cancer, where it is found at a frequency of 40–70% [1], [2], [3]. In BRAFV600E-positive thyroid cancer cell lines and BRAFV600E transgenic mice, this mutation is responsible for tumor initiation, transformation, growth, proliferation and dedifferentiation [4], [5], [6]. Research into the molecular mechanisms of BRAFV600E-positive tumors has revealed that the missense valine to glutamic acid mutation increases kinase activity, promoting the constitutive activation of MEK-ERK signaling [7], [8], [9], [10], [11] and enhancing ERK-dependent transcriptional output [12], [13]. However, other signaling pathways except MEK-ERK [14], [15]regulated in BRAFV600E tumors are not fully characterized [16]. Moreover, tumor suppressor systems which may be controlled by BRAFV600E in thyroid cancer remain to be identified. The tumor suppressor gene RASSF1A (Ras association domain family 1A) is epigenetically inactivated through de novo promoter methylation in the early stages of thyroid tumorigenesis [17], [18]. Interestingly, RASSF1A has recently been described as an important activator of MST1, which in turn phosphorylates and promotes the nuclear translocation of the forkhead transcription factor FKHRL1 (FoxO3), inducing cell death [19], [20], [21]. This suggests that FoxO3 transactivation could be induced by the RASSF1A-MST1 pathway and function as a tumor suppressor system in response to specific oncogenic signals, such as BRAFV600E. However, promoter hypermethylation of RASSF1A could only be detected in a relatively small percentage of PTC (20 to 32%) [18], [22]. These observations predict that novel RASSF1A-MST1-FoxO3 pathways regulated by BRAFV600E might function during the development of PTC whichdoes nothave RASSF1Apromoter methylation. FoxO3 transactivation is effectively inhibited by RET/PTC (rearranged in transformation/papillary thyroid carcinomas) kinase [23], the gene rearrangement of which is the most common rearrangement in papillary thyroid cancer. The inactivation of FoxO3 could therefore be a signature molecular event that should also occur in BRAFV600E thyroid tumors. Several molecular mechanisms which are possibly regulated by BRAFV600E may control FoxO3 activity in thyroid cancer. First, as RET/PTC kinase inhibits FoxO3 transactivation through an Akt/PKB dependent pathway, BRAFV600E might also activate Akt/PKB signaling pathway [24]. Second, the constitutive activation of ERK by BRAFV600E could inhibit FoxO3 activation via the ubiquitin-proteasome pathway [25]. Finally, BRAFV600E could act through crosstalk with the RASSF1A-MST1-FoxO3 pathway. Based on these hypotheses, we decided to investigate the regulation of the MST1-FoxO3 pathway by BRAFV600E. This resulted in the identification of novel cross-talksignaling between BRAFV600E and MST1, thereby demonstrating the functional activity of the RASSF1A-MST1-FoxO3 tumor suppressor system. Furthermore, in vivo experiments showed that MST1 knockout mice exhibited more aggressive BRAFV600E tumor phenotypes.

Materials and Methods

Plasmids

The pCMV5-Myc-FoxO3 plasmid was purchased from Addgene (Addgene Inc., Cambridge, MA) and pcDNA3.1/CT-GFP-FoxO3 was constructed using the CT-GFP Fusion TOPO Expression Kit according to the manufacturer's protocol (Invitrogen, Carlsbad, CA). Expression vectors (pME18) for Flag epitope-tagged forms of human MST1, MST1-N (residues 1–326), MST1-C (residues 327–487), HA-RASSF1A and 3X-IRS reporters have been described previously [26], [27], [28], [29]. The cDNA for human BRAF was cloned into pLenti6/V5-DEST using the pDONR221 vector (Invitrogen). For the cloning of BRAF, PCR primers were designed as follows: sense, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAAGATGGCGGCGCTGAGCGGT-3′, and antisense, 5′- GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGTGGACAGGAAACGCCC-3′. To generate vectors for human BRAFV600E and BRAFG469A, the Site-Directed PCR Mutagenesis Kit (Stratagene, La Jolla, CA) was used to introduce the missense mutation into the wild-type BRAF sequence. SiRNAs for MST1 and RAF-1 were purchased from Invitrogen (Stealth RNAi, Invitrogen).

Cell culture and transfection

FRO cells and 293T cells were cultured in RPMI and DMEM supplemented with 10% fetal bovine serum [20], [30]. Cells (2×105/35 mm dish) were transfected with siRNA at a concentration of 50 nM using the HiPerfect Transfection Reagent (Qiagen, Valencia, CA) and/or with the indicated vectors using Fugen6 Transfection Reagent (Roche Applied Science, Indianapolis, IN). The MEK inhibitor (U0126) and PI3K inhibitors (Ly294002, Wortmannin) were purchased from Cell Signaling Technology (Beverley, MA).

Antibodies

Primary antibodies against p21, p27, phospho-ERK, total ERK, phospho-Akt, total Akt, MST1, Actin, FoxO3, Myc (Cell Signaling), BRAF (C-19, Santa Cruz Biotechnology, Santa Cruz, CA), RASSF1A (eBioscience, San Diego, CA) and Flag (Sigma, St Louis, MO) were purchased from the indicated companies.

Luciferase-based reporter assay

To assay the activity of FoxO3, 293T cells were transfected with 3X-IRS-Luc, or p27-Luc and pRL-SV40, which encodes Renilla luciferase (Promega, Madison, WI) using Lipofectamine in OptiMEM (Invitrogen). Luciferase levels were determined using the Dual Luciferase Assay Kit (Promega). Firefly and Renilla luciferase activities were measured sequentially from the same sample using a Fusion Alpha-Microplate Analyzer (Perkin Elmer, Waltham, MA). For each sample, firefly luciferase activity was normalized to Renilla luciferase activity.

Immunoprecipitation and Immunoblot analysis

All immunoprecipitation and immunoblotting procedures were performed at 4°C. Cells were washed twice with PBS and lysed in lysis buffer containing protease inhibitors. Lysates were centrifuged at 14,000 g for 15 min at 4°C. For the IP analysis, lysates were precleared with protein A/G beads (Santa Cruz Biotechnology) for 30 min, and supernatants were incubated with the indicated primary antibody for 3 h with agitation. Protein A/G beads were then added to the mixture and incubated for at least 2 h at 4°C. Beads were washed with lysis buffer and the immunoprecipitates were subjected to immunoblotting. Cell lysates were separated by SDS-PAGE, and transferred to nitrocellulose membranes. Membranes were blocked with TBS containing 5% milk and 0.1% Tween20 for 1 h and then incubated overnight with primary antibody at 4°C. Membranes were washed in TBS/T and incubated with secondary antibodies conjugated to horseradish peroxidase (Cell Signaling) for 1 h at RT. Blots were developed using the LumiGLOChemiluminescent substrate (Cell Signaling).

Immunofluorescence staining

293T cells were grown on 6-well plates and transfected with the indicated plasmids using LipofectAmine (Invitrogen). Twenty-four hours after transfection, the cells were washed three times with PBS and fixed in 3.7% formaldehyde for 20 min. Cells were permeabilized with PBS containing 0.1% Triton X-100 and 0.1 M glycine at RT, incubated for 15 min, washed three times with PBS, and blocked with 3% BSA in PBS for 10 min at RT. Cells were incubated with primary anti-Myc and anti-Flag for 1 h at 37°C, washed three times with PBS, and incubated for 1 h at 37°C with Cy5-conjugated anti-Rabbit and TRITC-conjugated anti-Mouse for Myc-BRAFV600E and Flag-MST1, respectively (Jackson ImmunoResearch Laboratories, West Grove, PA). Cells were observed with a CellomicsArrayScanV HCS reader (Thermo Scientific, Pittsburgh, PA).

In vitro kinase assay of MST1

MST1 was immunoprecipitated from cell lysates and the washed precipitates were incubated for 30 minutes at 30°C with 1 µg histone H2B (Roche) in 25 µL kinase assay buffer comprised of 40 mM HEPES-NaOH (pH 7.4), 20 mM MgCl2, 1 mM DTT, phosphatase inhibitor mixture, 10 µM unlabeled ATP, and 1 µCi [γ-32P]ATP. The reaction was terminated by the addition of Laemmli sample buffer and phosphorylated proteins were detected by SDS-PAGE followed by autoradiography.

Apoptosis Assay

Image based apoptosis assays were carried out using the APO-BrdU TUNEL Assay Kit (Invitrogen). Cells was transfected with FoxO3, MST1, and/or BRAFV600E, as indicated, and then stained with DAPI and terminal deoxynucleotidyltransferase–mediated dUTP nick end labeling (TUNEL) reagents.The proportion of apoptotic cells was determined asthe percentage of TUNEL-positive cells among all DAPI-stainedcells.

Mouse Experiments and Histology

The strategy and methods used for the generation of thyroid specific transgenic BRAFV600E FVB/N mice with a bovine thyroglobulin promoter have been described previously [4]. A detailed explanation of how MST1 null mice are generated is described in a recent paper from our group [31]. The MST1-null mice appeared to have normal reproductive capacity when compared with wild-type mice. Tg-BRAFV600E mice were crossed with MST1-null mice to obtain Tg-BRAFV600E/MST1-null mice and Tg-BRAFV600E littermates. These mice were sacrificed at 16 weeks and their thyroids were removed after genotyping. Thyroid tissues were fixed in 10% formalin and embedded in paraffin. Five µM-thick sections were prepared and stained with H&E. Immunohistochemical analysis of paraffin embedded thyroid tissue was also performed using anti-cyclin D1 rabbit monoclonal antibody (92G2, Cell Signaling). ImageJ (http://rsbweb.nih.gov/ij/) for microscopy was used to estimate areas without follicular architecture or colloid formation in thyroid tissues. Tg-BRAFV600E/MST1 null mice (n = 10) and Tg-BRAFV600E littermates (n = 10) were collected and three sections of each mouse were used for immunohistochemical and imageJ analysis. Differences in the number of undifferentiated foci and areas without follicular architecture or colloid formation between both groups were assessed by the Mann-Whitney U-test. All animal experiments were approved by the Institutional Animal Care and Use Committee of the Chungnam National University School of Medicine (Approval ID; 2009-3-25).

Statistical Analysis

Results were expressed as the means ± standard deviations. Statistical differences between two groups were analyzed by the Mann-Whitney U test. Differences were considered to be significant at P<0.05.All statistical analyses were performed using SPSS Version 16.0 for Windows (SPSS Inc., Chicago, IL).

Results

BRAFV600E suppresses p21 and p27 induction by RASSF1A in FRO cells

To confirm that RASSF1A induces FoxO3 transactivation, RASSF1A was transiently transfected into FRO cells harboring the BRAF mutated alleles and then p21 and p27, the known transcriptional targets of FoxO3, were assessed by immunoblotting [30]. As shown in Fig 1A, endogenous RASSF1A was not detected, which is compatible with previous reports showing hypermethylation of RASSF1A in undifferentiated thyroid cancer cell lines [17], [32]. Fig. 1A shows the RASSF1A-induced dose dependent increase in p21 and p27, which suggests that RASSF1A might be linked with FoxO3 transactivation. To investigate the possible crosstalk between RASSF1A and BRAFV600E, the effect of BRAFV600E on RASSF1A-mediated p21 and p27 induction was evaluated. Interestingly, BRAFWT did not affect the induction of p21 and p27 by RASSF1A, whereas BRAFV600E effectively decreased p21 and p27 (Fig. 1B), suggesting that oncogenic BRAFV600E can regulate the RASSF1A-FoxO3 signaling pathway. As BRAFV600E can inhibit FoxO3 transactivation via the ERK or Akt/PKB signaling pathways, a MEK inhibitor (UO126) and PI3K inhibitors (Wortmannin, LY294002) were used to block these pathways and observe the effect of BRAFV600E on RASSF1A-induced FoxO3 transactivation. As shown in Fig. 1C, the BRAFV600E-mediated suppression of p21 and p27 induction by RASSF1A was not reversed by the MEK inhibitor U0126 or the PI3K inhibitors Wortmannin and LY294002, showing that BRAFV600E inhibits the RASSF1A-induced p21 and p27 upregulation independently from the ERK and PI3K-Akt/PKB signaling pathways. Recently, RASSF1A was shown to interact with MST1 via its SARAH domain and increase MST1 kinase activity [20], suggesting that RASSF1A-MST1-FoxO3 might be operational in response to oncogenic signals. To verify this hypothesis, MST1 expression was silenced using siRNA, and the RASSF1A induction of p21 and p27 was assessed. Fig. 1D shows that RASSF1A did not induce p21 and p27 expression in siMST1-treated cells, indicating that MST1 plays an important role in the p21 and p27 induction by RASSF1A.
Figure 1

BRAFV600E suppresses p21 and p27 induction by RASSF1A in FRO cells.

(a) FRO Cells were transfected with HA-RASSF1A as indicated and incubated for 24 h. Total lysates were analyzed for p21 and p27 expression by Western blot analysis. (b) Lysates from FRO cells co-transfected with vectors for HA-RASSF1A and BRAF (wild type or the V600E mutant), as indicated, were subjected to Western blot analysis. (c) FRO cells transiently transfected with BRAFV600E and RASSF1A were incubated with MEK (U0126, 10 µM) or PI3K (wortmannin, 1 µM, Ly294002, 10 µM) inhibitors for 12 h as indicated. The lysates were subjected to western blot analysis with primary antibodies as indicated. (d) FRO cells co-transfected with RASSF1A (0.5 µg/well) and SiMST1 (20 µM/well Stealth™ RNA) were incubated for 24 hrs as indicated. Abbreviations: CTL; control.

BRAFV600E suppresses p21 and p27 induction by RASSF1A in FRO cells.

(a) FRO Cells were transfected with HA-RASSF1A as indicated and incubated for 24 h. Total lysates were analyzed for p21 and p27 expression by Western blot analysis. (b) Lysates from FRO cells co-transfected with vectors for HA-RASSF1A and BRAF (wild type or the V600E mutant), as indicated, were subjected to Western blot analysis. (c) FRO cells transiently transfected with BRAFV600E and RASSF1A were incubated with MEK (U0126, 10 µM) or PI3K (wortmannin, 1 µM, Ly294002, 10 µM) inhibitors for 12 h as indicated. The lysates were subjected to western blot analysis with primary antibodies as indicated. (d) FRO cells co-transfected with RASSF1A (0.5 µg/well) and SiMST1 (20 µM/well Stealth™ RNA) were incubated for 24 hrs as indicated. Abbreviations: CTL; control.

BRAFV600E represses FoxO3 transactivation by the RASSF1A-MST1 signaling pathway

The transcriptional activity of FoxO3 is regulated by posttranslational modifications such as phosphorylation, acetylation, nitrosylation and sumoylation [33], [34], [35].Among these modifications, the MST1-mediated serine 207 phosphorylation of FoxO3 is critical for its nuclear translocation [19], [36]. To investigate whether the RASSF1A-MST1 signal increased FoxO3 transactivation, a 3XIRS reporter system was used, consisting of a 3XIRS promoter construct containing three insulin response sequences/FoxO response elements (CAAAA[C/T]AA, the 3XIRS promoter) [26], [29]. Transient expression of MST1 significantly increased 3XIRS reporter activities in a dose-dependent manner (Fig. S1). Evaluation of the effect of RASSF1A on FoxO3 reporter activity showed that RASSF1A remarkably increased 3XIRS reporter activity (Fig. 2A). Moreover, this RASSF1A-induced FoxO3 reporter activation was completely abolished by MST1 silencing, indicating that RASSF1A effectively increased FoxO3 transactivation through a MST1-dependent pathway (Fig. 2B).
Figure 2

BRAFV600E represses FoxO3 transactivation induced by RASSF1A-MST1 signal.

293T cells were transfected as indicated and luciferase-based reporter assays were conducted to observe 3XIRS reporter activity. For each sample, firefly luciferase activity was normalized to Renilla luciferase activity and expressed as the relative-fold change compared to basal luciferase activity. (a) Co-transfection with 3X-IRS Luc (100 ng/well), FoxO3 (0.5 µg/well), and RASSF1A (0.5 µg/well) was performed as indicated, and incubation lasted for 24 h. Total lysates were immunoblotted with anti-Myc, anti-HA, or anti-Actin antibodies. (b) Co-transfection with 3XIRS Luc (100 ng/well), FoxO3 (0.5 µg/well), RASSF1A (0.5 µg/well), and SiMST1 (20 µM/well Stealth™ RNA) was performed as indicated, and incubation lasted for 24 h. Total lysates were immunoblotted with anti-Myc, anti-HA, anti-MST, or anti-Actin antibodies. (c) Co-transfection with 3X-IRS Luc (100 ng/well), FoxO3 (0.5 µg/well), RASSF1A (0.5 µg/well), and BRAFV600E (0.5 µg/well) was performed as indicated, and incubation lasted for 24 hours. Total lysates were immunoblotted with anti-Myc, anti-HA, anti-BRAF, or anti-Actin antibodies. (d) Co-transfection with 3X-IRS Luc (100 ng/well), MST1(0.5 µg/well), and BRAFV600E (0.5 µg/well) was performed as indicated, and incubation lasted for 24 hours. All data are presented as mean±SD. Total lysates were immunoblotted with anti-Flag, anti-BRAF, or anti-Actin antibodies. (e) BRAFV600E inhibits MST1-induced nuclear translocation of FoxO1. 293T cells were cultured in a six-well dish until they reached 80% confluence and co-transfected with FoxO3-GFP (0.5 µg/well), Flag-MST1 (0.5 µg/well), and Myc-BRAFV600E (0.5 µg/well) as indicated. Twenty-four hours after transfection, the cells were fixed and incubated with antibodies against Myc or Flag, washed, and incubated with Cy5-conjugated anti-Rabbit for Myc-BRAFV600E and TRITC-conjugated anti-Mouse for Flag-MST1. (f) Fluorescence was observed using a Cellomics ArrayScanV HCS reader. To calculate FoxO3 distribution, at least one thousand cells in each experiment were counted and analyzed by Cellomics BioApplication. All data are presented as mean±SD: (*) P<0.01 between two groups, Abbreviations: CTL; control.

BRAFV600E represses FoxO3 transactivation induced by RASSF1A-MST1 signal.

293T cells were transfected as indicated and luciferase-based reporter assays were conducted to observe 3XIRS reporter activity. For each sample, firefly luciferase activity was normalized to Renilla luciferase activity and expressed as the relative-fold change compared to basal luciferase activity. (a) Co-transfection with 3X-IRS Luc (100 ng/well), FoxO3 (0.5 µg/well), and RASSF1A (0.5 µg/well) was performed as indicated, and incubation lasted for 24 h. Total lysates were immunoblotted with anti-Myc, anti-HA, or anti-Actin antibodies. (b) Co-transfection with 3XIRS Luc (100 ng/well), FoxO3 (0.5 µg/well), RASSF1A (0.5 µg/well), and SiMST1 (20 µM/well Stealth™ RNA) was performed as indicated, and incubation lasted for 24 h. Total lysates were immunoblotted with anti-Myc, anti-HA, anti-MST, or anti-Actin antibodies. (c) Co-transfection with 3X-IRS Luc (100 ng/well), FoxO3 (0.5 µg/well), RASSF1A (0.5 µg/well), and BRAFV600E (0.5 µg/well) was performed as indicated, and incubation lasted for 24 hours. Total lysates were immunoblotted with anti-Myc, anti-HA, anti-BRAF, or anti-Actin antibodies. (d) Co-transfection with 3X-IRS Luc (100 ng/well), MST1(0.5 µg/well), and BRAFV600E (0.5 µg/well) was performed as indicated, and incubation lasted for 24 hours. All data are presented as mean±SD. Total lysates were immunoblotted with anti-Flag, anti-BRAF, or anti-Actin antibodies. (e) BRAFV600E inhibits MST1-induced nuclear translocation of FoxO1. 293T cells were cultured in a six-well dish until they reached 80% confluence and co-transfected with FoxO3-GFP (0.5 µg/well), Flag-MST1 (0.5 µg/well), and Myc-BRAFV600E (0.5 µg/well) as indicated. Twenty-four hours after transfection, the cells were fixed and incubated with antibodies against Myc or Flag, washed, and incubated with Cy5-conjugated anti-Rabbit for Myc-BRAFV600E and TRITC-conjugated anti-Mouse for Flag-MST1. (f) Fluorescence was observed using a Cellomics ArrayScanV HCS reader. To calculate FoxO3 distribution, at least one thousand cells in each experiment were counted and analyzed by Cellomics BioApplication. All data are presented as mean±SD: (*) P<0.01 between two groups, Abbreviations: CTL; control. Because BRAFV600E inhibited RASSF1A-induced p21 and p27 upregulation, the effect of BRAFV600E on FoxO3 transactivation by RAASF1A was assessed. As shown in Fig. 2C, BRAFV600E abrogated the RASSF1A-induced FoxO3 transactivation. Furthermore, MST1-induced FoxO3 transactivation was also repressed by BRAFV600E, indicating that BRAFV600E inhibits the RASSF1A-MST1-FoxO3 pathway (Fig. 2D). Because the transcriptional activity of FoxO3 depends on its nuclear translocation, a FoxO3-GFP vector was constructed to confirm the data obtained with the 3XIRS reporter by immunofluorescence imaging. As shown in Fig. 2E, GFP-fluorescence was predominantly observed in the cytoplasm in control samples; introduction of MST1 caused a shift in GFP-fluorescence detection to the nucleus. When BRAFV600E was co-transfected with MST1, nuclear GFP fluorescence was barely detected. Interestingly, BRAFV600E was exclusively localized in the cytoplasm (blue), MST1 showed dominant cytoplasmic localization (red), and merged images revealed a combined color (lilac) that suggests the co-localization of BRAFV600E and MST1. To quantify FoxO3-fluorescence, the nuclear GFP-fluorescence signal intensity was analyzed using the BioApplication of CellomicsArrayScan, following the manufacturer's protocol. In agreement with the immunofluorescence images, MST1 increased intensity of the nuclear GFP-fluorescence signal, and BRAFV600E inhibited the nuclear detection of GFP-fluorescence (Fig. 2F). Furthermore, we performed fractionation assay to define the subcellular localization of FoxO3-GFP and observed that MST1 increased nuclear FoxO3-GFP and BRAFV600E could reverse this MST1-induced FoxO3 nuclear localization (Fig. S2).Taken together, these results indicate that BRAFV600E inhibits nuclear translocation of FoxO3 and suggest that this inhibition might be mediated by direct interaction between BRAFV600E and MST1.

BRAFV600E represses FoxO3 transactivation via MST1 kinase-dependent pathway

RAF-1 is an homologue of BRAF that interacts with MST2, suppressing MST2-mediated apoptosis [37], [38], which may be important for the regulation of certain biological processes [39]. In our study, however, FoxO3 inhibition by BRAFV600E was not altered by RAF-1 silencing (Fig. S3). Furthermore, this inhibitory effect of BRAFV600E was not reversed by the inhibition of MEK or PI3-kinase (Fig. S4), confirming that BRAFV600E is able to suppress FoxO3 transactivation through a mechanism independent from MEK/ERK and PI3-kinase signaling. The inhibition of RASSF1A or MST1-induced FoxO3 transactivation and nuclear translocation by BRAFV600Eled to the hypothesis that BRAFV600E might regulate FoxO3 transactivation via a MST1-dependent pathway. To verify this hypothesis, reporter experiments were carried out in siMST1-treated cells. Remarkably, following knockdown of MST1, FoxO3 could not induce full activation of the 3XIRS reporter and BRAFV600E no longer had an effect on FoxO3 induced activation of 3XIRS reporter (Fig. 3A). These observations suggest that MST1 plays a role in FoxO3 transactivation and that BRAFV600E inhibits FoxO3 transactivation by suppressing MST1 activity. The reporter assay was also used to test whether there is signal-crosstalk between MST1 and BRAFV600E on FoxO3 transactivation. As expected, BRAFV600E inhibited MST1-induced 3XIRS reporter activation in a dose-dependent manner and MST1 abolished the inhibitory effect of BRAFV600E on FoxO3 transactivation (Fig. 3B & 3C). These reporter assays indicated that increased levels of MST1 could prevent BRAFV600E-induced FoxO3 inactivation. Taken together, these data suggest that the cross-regulation between BRAFV600E and MST1 determines the degree of FoxO3 transactivation.
Figure 3

BRAFV600E and MST1 kinases competitively regulate FoxO3 transactivation.

(a∼c) Co-transfection with 3X-IRS Luc (100 ng/well), FoxO3 (0.5 µg/well), BRAFV600E (indicated amount/well), MST1 (indicated amount/well), and/or SiMST1 (20 µM/well Stealth™ RNA) was performed as indicated. Twenty-four hours after transfection, a luciferase-based reporter assay was conducted. Total lysates were immunoblotted with anti-Myc, anti-HA, anti-MST1, anti-BRAF, anti-Flag, or anti-Actin antibodies. All data are presented as mean±SD: (*) P<0.01 between two groups, Abbreviations: CTL; control.

BRAFV600E and MST1 kinases competitively regulate FoxO3 transactivation.

(a∼c) Co-transfection with 3X-IRS Luc (100 ng/well), FoxO3 (0.5 µg/well), BRAFV600E (indicated amount/well), MST1 (indicated amount/well), and/or SiMST1 (20 µM/well Stealth™ RNA) was performed as indicated. Twenty-four hours after transfection, a luciferase-based reporter assay was conducted. Total lysates were immunoblotted with anti-Myc, anti-HA, anti-MST1, anti-BRAF, anti-Flag, or anti-Actin antibodies. All data are presented as mean±SD: (*) P<0.01 between two groups, Abbreviations: CTL; control.

BRAFV600E shows mutation-specific binding with the C-terminal of MST1 and inhibits MST1 kinase activity in vitro

Because immunofluorescence images and reporter assays suggested that BRAFV600E and MST1 might be colocalized and have competitive effects on FoxO3 transactivation, immunoprecipitation (IP) assays were carried out to define the direct interaction of BRAFV600E and MST1. As shown in Fig. 4A, BRAFV600E was co-precipitated with Flag-tagged MST1 in lysates from 293T cells transfected with BRAFV600E and Flag-tagged MST1 and vice versa. To verify the region of MST1 important for the interaction with BRAFV600E, IP assays using MST1 deletion constructs, such as MST1 N-terminal (residues 1–326) and C-terminal (327–487) constructs (Fig. 4B), were carried out. These IP assays consistently demonstrated that BRAFV600E binds to the C-terminal region of MST1 (Fig. 4C), which contains of regulatory binding domain with the Sav/RASSF1/Hpo (SARAH) domain of RASSF1A [40], [41], [42]. To verify theBRAFV600Emutation specific binding with MST1, we performed additional IP assays using BRAFWT and BRAFV600E constructs. Furthermore, as shown in Fig. 4D, BRAFV600Ewas consistently co-precipitated with Flag-tagged MST1 whereas wild-type BRAF did not. Taken together, these results show that BRAFV600E can bind to the C-terminal domain of MST1 via mutation-specific protein-protein interaction. Because RASSF1A also binds to the C-terminal domain of MST1 and increases MST1 kinase activity, the interaction between BRAFV600E and MST1 might affect MST1 kinase activity by interrupting the heterotypic interaction of MST1 with RASSF1A. To verify this, the effect of BRAFV600E on the kinase activity of MST1 was examined in vitro using 293T cells, which were transfected with Flag-MST1 and BRAFV600E as indicated. The immunoprecipitates obtained with an antibody to Flag were used to assay for MST1 kinase activity using histone H2B as a substrate. As seen in Fig. 4E, the expression of BRAFV600E completely abolished MST1 kinase activity. These data suggest that BRAFV600E can negatively regulate MST1 kinase through direct interaction with its C-terminus.
Figure 4

BRAFV600E directly binds to the C-terminal domain of MST1 and represses MST1 kinase activity in vitro.

(a–d) Co-transfection with BRAFV600E (1 µg/well), BRAFWT (1 µg/well), Flag-MST1 (1 µg/well), Flag-MST1-N (1 µg/well), and Flag-MST1-C (1 µg/well) was performed as indicated. Twenty-four hours after transfection, cells were lysed and the lysates were used for immunoprecipitation analyses with the indicated primary antibodies. The immunoprecipitates were separated by SDS-PAGE and subjected to immunoblotting with anti-Flag or anti-BRAF antibodies. (e) Co-transfection with BRAFV600E (1 µg/well) and Flag-MST1 (indicated amount/well) was performed. Twenty-four hours after transfection, immunoprecipitation of MST1 from cell lysates was performed and the washed precipitates were incubated for 30 minutes at 30°C with 1 µg histone H2B in 25 µL kinase assay buffer. The reaction was terminated by the addition of Laemmli sample buffer and phosphorylated proteins were detected by SDS-PAGE followed by autoradiography.

BRAFV600E directly binds to the C-terminal domain of MST1 and represses MST1 kinase activity in vitro.

(a–d) Co-transfection with BRAFV600E (1 µg/well), BRAFWT (1 µg/well), Flag-MST1 (1 µg/well), Flag-MST1-N (1 µg/well), and Flag-MST1-C (1 µg/well) was performed as indicated. Twenty-four hours after transfection, cells were lysed and the lysates were used for immunoprecipitation analyses with the indicated primary antibodies. The immunoprecipitates were separated by SDS-PAGE and subjected to immunoblotting with anti-Flag or anti-BRAF antibodies. (e) Co-transfection with BRAFV600E (1 µg/well) and Flag-MST1 (indicated amount/well) was performed. Twenty-four hours after transfection, immunoprecipitation of MST1 from cell lysates was performed and the washed precipitates were incubated for 30 minutes at 30°C with 1 µg histone H2B in 25 µL kinase assay buffer. The reaction was terminated by the addition of Laemmli sample buffer and phosphorylated proteins were detected by SDS-PAGE followed by autoradiography.

BRAFV600E generates an anti-apoptotic effect via repression of p21 and p27 induction

FoxO3 acts as a cell-cycle regulator by inducing the transcription of genes such as p21 and p27 [43], the promoters of which contain IRS elements. The results of the assessment of the regulatory effect of BRAFV600E on the p27 reporter are shown in Fig. 5A. FoxO3 increased p27 reporter activity and MST1 potentiated this FoxO3-induced p27 activation. In addition, MST1-FoxO3 mediated p27 reporter activation was abrogated by co-transfection with BRAFV600E. To confirm that BRAFV600E can affect p27 reporter activity, the inhibitory effect of BRAFV600E on p21 and p27 induction was investigated by Western blot analysis (Fig. 5B). The results confirmed the MST1-FoxO3 induction of p21 and p27, which was almost completely reversed by BRAFV600E co-transfection. Notably, these two G1-checkpoint CDK inhibitors have been associated with the initiation and progression of human tumors because p21 and p27 bind and inhibit cyclin-CDK complexes, inducing cell cycle arrest and apoptosis. Therefore, the TUNEL assay was used to determine whether MST1-FoxO3 promotes apoptosis and if BRAFV600E reverses the MST1-FoxO3 effect (Fig. 5C). Transient co-expression of FoxO3 and MST1 increased the number of TUNEL positive 293T cells, but this number was decreased by the introduction of BRAFV600E (see also right panel of Fig. 5C for statistical analysis). These results imply that the MST1-FoxO3 pathway induction of G1-checkpoint CDK inhibitors promotes apoptosis, and oncogenic BRAFV600E inhibits the activity of these tumor suppressor systems through the regulation of MST1.
Figure 5

BRAFV600E affects FoxO3 mediated apoptotic gene expression.

(a) 293 cells were transiently transfected with p27-promoter-luc (0.1 µg/well) and Myc-FoxO3, and co-transfected with plasmids expressing Flag-MST1 as well as plasmids expressing BRAFV600E. After 24 h, cells were harvested and analyzed by Western blotting. (b) FRO cells were transiently transfected with Myc-FoxO3 and co-transfected with plasmids expressing Flag-MST1 or BRAFV600E as indicated.Total lysates were immunoblotted with the indicated antibodies. (c) MST1-FoxO-mediated apoptosis is reversed by BRAFV600E. 293T cells were transiently transfected with Myc-FoxO3 and co-transfected with Flag-MST1 as well as BRAFV600E as indicated. After 24 hours, FoxO3 and MST-expressing cells were fixed and were then stained by the TUNEL protocol. TUNEL-positive cells (green) exhibit condensed or fragmented DAPI-stained nuclei (blue), indicative of apoptosis. Quantification of the results is shown in the right panel. MST1 expression significantly increased apoptosis, which is reduced by expression of BRAFV600E. For each experiment at least 1000 cells were counted and analyzed by Cellomics'sbioapplication. All data are presented as mean±SD.

BRAFV600E affects FoxO3 mediated apoptotic gene expression.

(a) 293 cells were transiently transfected with p27-promoter-luc (0.1 µg/well) and Myc-FoxO3, and co-transfected with plasmids expressing Flag-MST1 as well as plasmids expressing BRAFV600E. After 24 h, cells were harvested and analyzed by Western blotting. (b) FRO cells were transiently transfected with Myc-FoxO3 and co-transfected with plasmids expressing Flag-MST1 or BRAFV600E as indicated.Total lysates were immunoblotted with the indicated antibodies. (c) MST1-FoxO-mediated apoptosis is reversed by BRAFV600E. 293T cells were transiently transfected with Myc-FoxO3 and co-transfected with Flag-MST1 as well as BRAFV600E as indicated. After 24 hours, FoxO3 and MST-expressing cells were fixed and were then stained by the TUNEL protocol. TUNEL-positive cells (green) exhibit condensed or fragmented DAPI-stained nuclei (blue), indicative of apoptosis. Quantification of the results is shown in the right panel. MST1 expression significantly increased apoptosis, which is reduced by expression of BRAFV600E. For each experiment at least 1000 cells were counted and analyzed by Cellomics'sbioapplication. All data are presented as mean±SD.

Loss of MST1 aggravates PTC phenotypes in thyroid-specific transgenic BRAFV600E mice

To validate the pathophysiological consequences of the interaction between BRAFV600E and MST1 in vivo, animal experiments using thyroid-specific transgenic BRAFV600E mice (Tg-BRAFV600E mice) and MST1 null mice were designed. Tg-BRAFV600E mice were crossed with MST1 null mice and the phenotypic differences between Tg-BRAFV600E/MST1 null mice and their Tg-BRAFV600E littermates were analyzed at 16 weeks [4]. The thyroid glands of MST1 null mice with wild-type BRAF were normal (data not shown). However, Tg-BRAFV600E/MST1 null mice showed aggressive PTC tumor phenotypes compared with their Tg-BRAFV600E littermates. Although the presence of lymph node metastasis was not observed in either of the two groups, Tg-BRAFV600E/MST1 null mice showed abundant foci of undifferentiated carcinomas and large areas without follicular architecture or colloid formation (Figure 6A–H). For the statistical analysis of these results, immunohistochemical staining of cyclin D1 was performed, which showed an intensive cyclin D1 staining area as undifferentiated foci (Fig. 6B&C, F–G). As shown in Figure 6D, the number of undifferentiated foci in female Tg-BRAFV600E/MST1 null mice was 3.3±0.86, but that of their Tg-BRAFV600E littermates was 1.05±0.51, reflecting a statistical difference between the two groups (P<0.001). Similarly, male Tg-BRAFV600E/MST1 null mice showed a higher number of undifferentiated foci than their Tg-BRAFV600E littermates (3.5±0.83and 1.35±0.67, respectively; P<0.001). The total area composed of sheets of spindle cells without follicular architecture or colloid formation was estimated and ImageJ (http://rsbweb.nih.gov/ij/) was used to quantify these areas and analyze the differences between Tg-BRAFV600E/MST1 null mice and their Tg-BRAFV600E littermates (Figure 6H). In female mice, Tg-BRAFV600E/MST1 null mice had a significantly larger area without follicular architecture or colloid formation than their Tg-BRAFV600E littermates (75.47±3.83% and 52.69±7.93%, respectively; P = 0.034). In male mice, Tg-BRAFV600E/MST1 null mice also showed a larger area without follicular architecture or colloid formation compared to their Tg-BRAFV600E littermates (70.02±3.68% and47.31±7.93%, respectively; P = 0.021). This in vivo study suggests that the direct interaction between BRAFV600E and MST1 could affect the behavior of papillary thyroid cancer. Another piece of evidence demonstrating the aggressive tumor phenotype in these Tg-BRAFV600E/MST1 null mice was the frequent presence of muscle invasion (Figure 6I–L), which was not observed in their Tg-BRAFV600E littermates.
Figure 6

Microscopic features of Tg-BRAFV600E/MST1 null mice.

Thyroid tissues were fixed in 10% formalin and embedded in paraffin. Five micrometer-thick sections were prepared and stained with H&E. At least five sections from each mouse were used for ImageJ analysis. Differences between Tg-BRAFV600E/MST1-null mice and Tg BRAFV600E littermates were assessed by Mann-Whitney U-test. All data are presented as mean±SD. (a) Representative figure from Tg-BRAFV600E littermates shows characteristic features of human PTC, including nuclear enlargement, crowding and overlapping (magnification ×10). (b&c) Representative immunohistochemical staining results with anti-cyclin D1 antibody in Tg-BRAFV600E littermates (b, magnification ×10; c, magnification ×100). Circled area shows intensive staining of cyclin D1 and is magnified in c. (d) Numbers of undifferentiated foci were calculated by counting the number of areas showing increased staining intensity of cyclin D1. (e) Representative image from a Tg-BRAFV600E/MST1 null mouse shows a limited area with follicle or colloid formation (e, magnification ×10). (f,g) Representative immunohistochemical staining results with anti-cyclin D1 antibody from a Tg-BRAFV600E/MST1 null mouse, suggesting abundant undifferentiated foci (f, magnification ×10; g, magnification ×100). Circled areas show increased staining intensity of cyclin D1 and are magnified in g. (h) ImageJ analysis of estimated areas without follicular architecture or colloid formation. Tg-BRAFV600E/MST1 null mice (n = 10) have larger areas than Tg-BRAFV600E littermates (n = 10). (i,j) Representative images from a Tg-BRAFV600E/MST1 null mouse show muscle invasion adjacent to the thyroid gland (f, magnification ×40, boxed area is magnified and shown in j (magnification ×100)). (k,l) Representative images from the other Tg-BRAFV600E/MST1 null mouse show aggressive invasion to muscle areas surrounding the upper pole of the thyroid gland (k, magnification ×40, boxed area is magnified and presented at l (magnification ×100)). Arrows indicate invasive front in each figure. All data are presented as means±SD: (*) P<0.01; (**) P<0.05 between two groups.

Microscopic features of Tg-BRAFV600E/MST1 null mice.

Thyroid tissues were fixed in 10% formalin and embedded in paraffin. Five micrometer-thick sections were prepared and stained with H&E. At least five sections from each mouse were used for ImageJ analysis. Differences between Tg-BRAFV600E/MST1-null mice and Tg BRAFV600E littermates were assessed by Mann-Whitney U-test. All data are presented as mean±SD. (a) Representative figure from Tg-BRAFV600E littermates shows characteristic features of human PTC, including nuclear enlargement, crowding and overlapping (magnification ×10). (b&c) Representative immunohistochemical staining results with anti-cyclin D1 antibody in Tg-BRAFV600E littermates (b, magnification ×10; c, magnification ×100). Circled area shows intensive staining of cyclin D1 and is magnified in c. (d) Numbers of undifferentiated foci were calculated by counting the number of areas showing increased staining intensity of cyclin D1. (e) Representative image from a Tg-BRAFV600E/MST1 null mouse shows a limited area with follicle or colloid formation (e, magnification ×10). (f,g) Representative immunohistochemical staining results with anti-cyclin D1 antibody from a Tg-BRAFV600E/MST1 null mouse, suggesting abundant undifferentiated foci (f, magnification ×10; g, magnification ×100). Circled areas show increased staining intensity of cyclin D1 and are magnified in g. (h) ImageJ analysis of estimated areas without follicular architecture or colloid formation. Tg-BRAFV600E/MST1 null mice (n = 10) have larger areas than Tg-BRAFV600E littermates (n = 10). (i,j) Representative images from a Tg-BRAFV600E/MST1 null mouse show muscle invasion adjacent to the thyroid gland (f, magnification ×40, boxed area is magnified and shown in j (magnification ×100)). (k,l) Representative images from the other Tg-BRAFV600E/MST1 null mouse show aggressive invasion to muscle areas surrounding the upper pole of the thyroid gland (k, magnification ×40, boxed area is magnified and presented at l (magnification ×100)). Arrows indicate invasive front in each figure. All data are presented as means±SD: (*) P<0.01; (**) P<0.05 between two groups.

Discussion

BRAFV600E constitutively activates the MEK-ERK signaling pathway, promoting ERK-dependent transcriptional activity, which regulates cell growth, cell proliferation, apoptosis evasion, replicative potential, angiogenesis, and tissue invasion [44], [45]. RASSF1A primarily interacts with small GTPases such as Ras to facilitate cell cycle arrest and apoptosis. Transcriptional silencing of RASSF1A by promoter methylation has been reported in many human cancers including thyroid cancer [46], [47]. However, epigenetic alteration has been regarded as a slow and time-consuming process for gene silencing, implying that tumor suppressors such as RASSF1A are inhibited to allow the initiation and maintenance of oncogenic processes necessary for the establishment of clinically significant thyroid cancers [48]. The results of the present study suggest that BRAFV600E tumors might regulate RASSF1A function via a novel mechanism. RASSF1A transfection induced p21 and p27 in a MST1-dependent manner, suggesting that the RASSF1A-MST1-FoxO3 pathway can induce cell cycle arrest. In addition, BRAFV600E suppressed the RASSF1A-MST1-mediated signal, inhibiting p21 and p27 induction, supporting the hypothesis of the present work. It has been suggested that BRAFV600E-activated ERK inhibits FoxO3 by murine double minute 2 (MDM2)-mediated degradation [25]. However, BRAFV600E did not alter HA-FoxO3 protein levels, as shown by Western blot analysis, and, interestingly, treatment with a MEK inhibitor did not abolish the BRAFV600E-mediated inactivation of FoxO3. In the present study, BRAFV600E did not induce phosphorylation of Akt/PKB and, furthermore, the addition of PI3 kinase inhibitors did not affect the inhibition of FoxO3 by BRAFV600E. Therefore, BRAFV600E did not affect FoxO3 transactivation by a PI3-Akt/PKB-dependent signaling pathway, whereas RET/PTC inactivates FoxO3 by Akt/PKB activation [23]. In addition, the silencing of RAF-1, which has been reported to bind with MST2, did not alter the inhibition of FoxO3 transactivation by BRAFV600E.Taken together,these data suggest that FoxO3 inactivation might be a common process in the carcinogenesis of PTC and that BRAFV600E inhibits FoxO3 transactivation through a MEK-ERK–, Akt/PKB–, or RAF-1–independent pathway. The results of the present study suggest the existence of a novel FoxO3 inhibitory mechanism that might operate in BRAFV600E-induced PTC. MST1 kinase had a counter-regulatory effect on FoxO3 activation and localization compared with Akt/PKB [49], [50]. In contrast to Akt/PKB, MST1 phosphorylation of FoxO3 promotes its nuclear translocation, thereby inducing cell death [19]. A novel inhibitory mechanism of FoxO3 transactivation might be operational in BRAFV600E-induced PTC, which led to the evaluation of BRAFV600E regulation of MST1-FoxO3 signaling pathways. A reporter assay revealed that MST1-induced FoxO3 transactivation was completely inhibited by co-transfection with BRAFV600E. In addition, over-expression of MST1 prevented BRAFV600E-induced FoxO3 inactivation. These data suggested that cross-regulation between MST1 and BRAFV600E might play a critical role in regulating FoxO3 transactivation. Supporting this idea, immunofluorescence studies revealed not only the BRAFV600E-mediated inhibition of MST1-induced FoxO3 nuclear translocation, but also a direct interaction between MST1 and BRAFV600E, which was confirmed through IP assays that demonstrated that BRAFV600E binds to the C-terminal dimerization domain of MST1. In fact, the dimerization domain of MST1/2 mediates MST1 kinase activity by interacting with binding partners such as RASSF1A and hWW45 [20], [51]. Because RASSF1A promotes MST1 activation and apoptosis via this hetero-dimerization, we postulated that the direct interaction of MST1 with BRAFV600E might affect MST1 kinase activity. Actually, our in vitro kinase assay clearly showed that MST1 kinase activity on histone H2B was markedly decreased by BRAFV600E. Another possible mechanism of MST1 regulation may be the inhibitory phosphorylation of MST1 by BRAFV600E. Prior research has shown that Akt/PKB can phosphorylate the Thr387 residue of MST1 and prevent its proteolytic activity, providing a mechanism for the Akt/PKB-mediated inactivation of MST1-FoxO3 pathways [50]. Although the BRAFV600E-induced MST1 phosphorylation was not assessed, it remains possible that BRAFV600E may phosphorylate and inactivate MST1 through direct interaction with the C-terminal domain of MST1. Few mouse models exist for the study of tumor suppressor systems in PTC. In the present study, a new in vivo model was generated to investigate the cross-regulation between BRAFV600E and MST1, and the results obtained with transgenic mice were consistent with the in vitro generated data. Although MST1 knockout mice did not show any thyroid gland pathological changes compared to wild-type mice, Tg-BRAFV600E/MST1 null mice showed an aggressive phenotype, supporting the hypothesis that MST1 might have a modifying effect on BRAFV600E-induced carcinogenesis. Although the lack of an appropriate antibody for the specific immunohistochemical detection of serine 207 residue in FOXO3 phosphorylated by MST1 kinaseprevented the detection of FoxO3 activity modified by MST1, these results, coupled with the results of in vitro assays, suggest that BRAFV600E may alleviate the tumor suppressor function of RASSF1A-MST1 and vice versa. In conclusion, the present study suggests that a direct interaction between oncogenic BRAFV600E and MST1 kinase plays a crucial role in determining tumor behavior in PTC. This novel interaction might provide advanced insight into the pathogenesis of the disease, and form the basis for novel drug development for the treatment of BRAFV600E-induced PTC. In light of this, it will be important to delineate the precise regulatory mechanism of the RASSF1A-MST1 pathway and verify the action of BRAFV600E on this signal pathway in human PTC. MST1 significantly increases 3XIRS reporter activities. (A) 293T cells were cultured in 12 well dishes until they reached 80% confluence, and co-transfected with 3XIRS Luc (100 ng/well), FoxO3 (0.5 µg/well), and MST1 (0.5 µg/well) as indicated for 24 hours. To verify transfection efficacy, total lysates were immunoblotted with anti-HA, anti-Flag, and anti-Actin antibodies. (B) Cells were co-transfected with 3XIRS Luc (100 ng/well), FoxO3 (0.5 µg/well), and MST1 (indicated amount/well). Total lysates were immunoblotted with anti-HA, anti-Flag, and anti-Actin antibodies. For each sample, firefly luciferase activity was normalized to Renilla luciferase activity and expressed as relative-fold change compared to basal luciferase activity. All data are presented as mean±SD: (*) P<0.01 between two groups. (TIF) Click here for additional data file. BRAFV600E inhibits MST1-induced nuclear translocation of FoxO1. 293T cells were cultured in a six-well dish until they reached 80% confluence and co-transfected with FoxO3-GFP (0.5 µg/well), Flag-MST1 (0.5 µg/well), and Myc-BRAFV600E (0.5 µg/well) as indicated. Twenty-four hours after transfection, the cells were prepared for subcellular fractionation using the Nuclear/Cytosol Fractionation kit (BioVision, Inc. CA). The markers, origin recognition complex subunit 1 (ORC1) and β-tubulin, were used to verify the identity and purity of the nuclear and cytosolic fractions, respectively. Based on these markers, a good overall yield was obtained without mixing of the fractions. (TIF) Click here for additional data file. BRAFV600E mediated FoxO3 inhibition was not altered by RAF-1. 293T cells were cultured in 12 well dishes until they reached 80% confluence and co-transfected with 3XIRS Luc (100 ng/well), FoxO3 (0.5 µg/well), BRAFV600E (0.5 µg/well), and SiRAF-1 (20 µM/well Stealth™ RNA) for 24 h as indicated. Total lysates were immunoblotted with anti-HA, anti-BRAF, anti-RAF-1, and anti-Actin antibodies. For each sample, firefly luciferase activity was normalized to Renilla luciferase activity and expressed as relative-fold change compared to basal luciferase activity. All data are presented as mean±SD: (*) P<0.01 between two groups. (TIF) Click here for additional data file. BRAFV600E suppresses FoxO3 transactivation via a MEK/ERK-, PI3 kinase-independent pathway. 293T cells were cultured in 12 well dishes until they reached 80% confluence, and co-transfected with 3XIRS Luc (100 ng/well), FoxO3 (0.5 µg/well), and BRAFV600E (0.5 µg/well) as indicated for 24 h. MEK inhibitor (lane 3, U0126 20 µM/well) and PI3 kinase inhibitors (lane 4, Wortmannin 200 nM/well, and lane 5, LY294002 20 µM/well) were added. Total lysates were immunoblotted with anti-HA, anti-BRAF, anti-pERK, anti-ERK, anti-pAkt/PKB, anti-Akt/PKB, and anti-Actin antibodies. For each sample, firefly luciferase activity was normalized to Renilla luciferase activity and expressed as relative fold change compared to basal luciferase activity. All data are presented as mean±SD. Abbreviations: U0, U0126; WT, Wortmannin; LY, LY294002; and Con, control. (TIF) Click here for additional data file.
  51 in total

1.  Regulation of FoxO activity by CBP/p300-mediated acetylation.

Authors:  Lars P van der Heide; Marten P Smidt
Journal:  Trends Biochem Sci       Date:  2005-02       Impact factor: 13.807

Review 2.  Stressing the role of FoxO proteins in lifespan and disease.

Authors:  Armando van der Horst; Boudewijn M T Burgering
Journal:  Nat Rev Mol Cell Biol       Date:  2007-06       Impact factor: 94.444

3.  Akt phosphorylates MstI and prevents its proteolytic activation, blocking FOXO3 phosphorylation and nuclear translocation.

Authors:  Sung-Wuk Jang; Seung-Ju Yang; Shanthi Srinivasan; Keqiang Ye
Journal:  J Biol Chem       Date:  2007-08-28       Impact factor: 5.157

Review 4.  Structure/function relationships underlying regulation of FOXO transcription factors.

Authors:  T Obsil; V Obsilova
Journal:  Oncogene       Date:  2008-04-07       Impact factor: 9.867

Review 5.  Taming the Hippo: Raf-1 controls apoptosis by suppressing MST2/Hippo.

Authors:  Eric O'Neill; Walter Kolch
Journal:  Cell Cycle       Date:  2005-03-08       Impact factor: 4.534

6.  The Salvador partner Hippo promotes apoptosis and cell-cycle exit in Drosophila.

Authors:  Sophie Pantalacci; Nicolas Tapon; Pierre Léopold
Journal:  Nat Cell Biol       Date:  2003-09-21       Impact factor: 28.824

Review 7.  BRAF mutation in papillary thyroid cancer: pathogenic role, molecular bases, and clinical implications.

Authors:  Mingzhao Xing
Journal:  Endocr Rev       Date:  2007-10-16       Impact factor: 19.871

8.  Identification of direct transcriptional targets of (V600E)BRAF/MEK signalling in melanoma.

Authors:  Leisl M Packer; Philip East; Jorge S Reis-Filho; Richard Marais
Journal:  Pigment Cell Melanoma Res       Date:  2009-08-04       Impact factor: 4.693

9.  Highly methylated genes in colorectal neoplasia: implications for screening.

Authors:  Hongzhi Zou; Jonathan J Harrington; Abdirashid M Shire; Rafaela L Rego; Liang Wang; Megan E Campbell; Ann L Oberg; David A Ahlquist
Journal:  Cancer Epidemiol Biomarkers Prev       Date:  2007-12       Impact factor: 4.254

10.  Mutations of the BRAF gene in human cancer.

Authors:  Helen Davies; Graham R Bignell; Charles Cox; Philip Stephens; Sarah Edkins; Sheila Clegg; Jon Teague; Hayley Woffendin; Mathew J Garnett; William Bottomley; Neil Davis; Ed Dicks; Rebecca Ewing; Yvonne Floyd; Kristian Gray; Sarah Hall; Rachel Hawes; Jaime Hughes; Vivian Kosmidou; Andrew Menzies; Catherine Mould; Adrian Parker; Claire Stevens; Stephen Watt; Steven Hooper; Rebecca Wilson; Hiran Jayatilake; Barry A Gusterson; Colin Cooper; Janet Shipley; Darren Hargrave; Katherine Pritchard-Jones; Norman Maitland; Georgia Chenevix-Trench; Gregory J Riggins; Darell D Bigner; Giuseppe Palmieri; Antonio Cossu; Adrienne Flanagan; Andrew Nicholson; Judy W C Ho; Suet Y Leung; Siu T Yuen; Barbara L Weber; Hilliard F Seigler; Timothy L Darrow; Hugh Paterson; Richard Marais; Christopher J Marshall; Richard Wooster; Michael R Stratton; P Andrew Futreal
Journal:  Nature       Date:  2002-06-09       Impact factor: 49.962

View more
  21 in total

1.  BRAFV600E mutation and papillary thyroid cancer: chicken or egg?

Authors:  Mingzhao Xing
Journal:  J Clin Endocrinol Metab       Date:  2012-07       Impact factor: 5.958

2.  H-ras Inhibits the Hippo Pathway by Promoting Mst1/Mst2 Heterodimerization.

Authors:  Sonali J Rawat; Daniela Araiza-Olivera; Luis E Arias-Romero; Olga Villamar-Cruz; Tatiana Y Prudnikova; Heinrich Roder; Jonathan Chernoff
Journal:  Curr Biol       Date:  2016-05-26       Impact factor: 10.834

3.  RASSF6 exhibits promoter hypermethylation in metastatic melanoma and inhibits invasion in melanoma cells.

Authors:  Jessica J Mezzanotte; Victoria Hill; M Lee Schmidt; Thoraia Shinawi; Stella Tommasi; Dietmar Krex; Gabriele Schackert; Gerd P Pfeifer; Farida Latif; Geoffrey J Clark
Journal:  Epigenetics       Date:  2014-11       Impact factor: 4.528

Review 4.  Molecular pathogenesis and mechanisms of thyroid cancer.

Authors:  Mingzhao Xing
Journal:  Nat Rev Cancer       Date:  2013-03       Impact factor: 60.716

5.  Analysis on the metabolite composition of serum samples from patients with papillary thyroid carcinoma using nuclear magnetic resonance.

Authors:  Wen-Xin Zhao; Bo Wang; Li-Yong Zhang; Shou-Yi Yan; Ying-Hong Yang
Journal:  Int J Clin Exp Med       Date:  2015-10-15

Review 6.  Ras signaling through RASSF proteins.

Authors:  Howard Donninger; M Lee Schmidt; Jessica Mezzanotte; Thibaut Barnoud; Geoffrey J Clark
Journal:  Semin Cell Dev Biol       Date:  2016-06-08       Impact factor: 7.727

Review 7.  Mitochondrial Energy Metabolism and Thyroid Cancers.

Authors:  Junguee Lee; Joon Young Chang; Yea Eun Kang; Shinae Yi; Min Hee Lee; Kyong Hye Joung; Kun Soon Kim; Minho Shong
Journal:  Endocrinol Metab (Seoul)       Date:  2015-06

Review 8.  Resistance to Targeted Therapy and RASSF1A Loss in Melanoma: What Are We Missing?

Authors:  Stephanie McKenna; Lucía García-Gutiérrez
Journal:  Int J Mol Sci       Date:  2021-05-12       Impact factor: 5.923

9.  Epigenetic silencing of RASSF1A deregulates cytoskeleton and promotes malignant behavior of adrenocortical carcinoma.

Authors:  Reju Korah; James M Healy; John W Kunstman; Annabelle L Fonseca; Amir H Ameri; Manju L Prasad; Tobias Carling
Journal:  Mol Cancer       Date:  2013-08-05       Impact factor: 27.401

10.  The role of the hippo pathway in melanocytes and melanoma.

Authors:  Ji Eun Kim; Graeme J Finlay; Bruce C Baguley
Journal:  Front Oncol       Date:  2013-05-16       Impact factor: 6.244

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.