Literature DB >> 21152117

The glypican 3-hosted murine mir717 gene: sequence conservation, seed region polymorphisms and putative targets.

Tanja Kunej1, Dasa Jevsinek Skok, Simon Horvat, Peter Dovc, Zhihua Jiang.   

Abstract

Mir717 (mmu-mir-717) was first reported in mouse and resides in the intron 3 of glypican 3 (Gpc3) gene. Our present study revealed that this microRNA (miRNA) gene is conserved among 26 mammalian species and harbors polymorphic sites within the mature seed region in mice. Our finding represents a rare four layer genomic overlap consisting of growth associated quantitative trait locus (QTL), body mass associated Gpc3 gene, highly conserved miRNA gene and mature miRNA seed single nucleotide polymorphism (SNP) identified in the lean mouse strain 129/Sv. Additionally, genes potentially targeted by Mir717 include 91 genes associated with obesity and related phenotypes in mammals. Our analysis provides a basis for further experiments to causally connect the identified SNP and Mir717 gene itself to obesity regulation. Furthermore, our bioinformatics analysis now enables functional annotation of Mir717 orthologs in other species, thus determining the effect of its target genes on fat-related traits.

Entities:  

Keywords:  Mir717 (mmu-miR-717); Obesity; comparative genomics.; glypican 3 (Gpc3) gene; microRNA (miRNA)

Mesh:

Substances:

Year:  2010        PMID: 21152117      PMCID: PMC2999852          DOI: 10.7150/ijbs.6.769

Source DB:  PubMed          Journal:  Int J Biol Sci        ISSN: 1449-2288            Impact factor:   6.580


MicroRNA (miRNA) Mir717 (mmu-mir-717) was first reported in mouse, which is located in the intron 3 of the glypican 3 (Gpc3) host gene on X chromosome (http://www.mirbase.org/). The human miR-717 is also expressed, and plays important regulatory roles in renal osmoregulation 1. It has been shown that intronic miRNAs could be coordinately expressed with their host gene mRNA, implying that they might share a common transcriptional mechanism, however, anti-correlative miRNA/host gene expression have also been demonstrated 2-4. Glypican 3 is a member of the glypican-related integral membrane proteoglycan family. The protein binds to and inhibits the dipeptidyl peptidase activity of CD26, thus inducing apoptosis in certain cell types. In human, mutations in GPC3 gene cause the Simpson-Golabi-Behmel overgrowth syndrome 5, whereas Gpc3 knockout mice show increased body mass, renal dysplasia, and perinatal mortality 6. Additionally, a QTL for growth was also mapped to the region containing Gpc3 7. Therefore, the objectives of our present study were to 1) elucidate evolutionary conservation of Mir717 among the mammalian species, 2) identify genetic variants of the Mir717 in mice, and 3) identify potential target genes of Mir717, particularly those that are associated with obesity and related conditions 8. According to the miRBase 13.0 (http://microrna.sanger.ac.uk/) and Ensembl (http://www.ensembl.org/index.html) databases, the Mir717 resides within the intron 3 of the Gpc3 gene (Figure 1A). Orthologs of mouse Mir717 were retrieved from the Ensembl genome browser using “alignments / multispecies view / eutherian mammals” option. Multiple species sequence alignment was performed using the MultAlin program (http://bioinfo.genotoul.fr/multalin). Multiple alignment of known (mouse) and predicted Mir717 ortholog sequences showed a high level of conservation among 26 eutherian mammalian species (Figure 1B). So far, the Mir717 gene has been found to be expressed in the mouse and human only. Due to the high sequence conservation this region could now be analyzed by miRNA prediction algorithms and experimentally to functionally annotate the corresponding orthologous miRNA gene in other species. The mouse mature Mir717 differs from the corresponding rat and human sequences in only one and two nucleotides, respectively (Figure 1B). Seven species had 100% mature sequence similarity including human (Homo sapiens): chimpanzee (Pan troglodytes), orangutan (Pongo pygmaeus), macaque (Macaca mulatta), Philippine tarsier (Tarsius syrichta), cat (Felis catus) and European rabbit (Oryctolagus cuniculus) (Figure 1B).
Figure 1

Gene organization, comparative genomics, and genetic variability of the Mir717 gene. A: genomic organization of the Gpc3 with Mir717 in its intron 3. B: Mir717 alignment among 26 mammalian species, mature miRNA region is marked with the square. C: Mir717 genetic variability; location of the premature SNP rs30373504 (light blue arrow) and seed SNP rs30372501 (green arrow) polymorphic between the low fat and high fat mouse strains. Mature Mir717 is underlined.

Genetic variability of Mir717 in mouse was evaluated by sequencing PCR products (primers Mir717-F: CCAAATCACCACCTTTGTCC and Mir717-R: AGGAAGCTTGGAGGCAGATT). PCR was carried out in a total volume of 10 μl including ~50 ng of DNA, 1 x PCR buffer, 1 mM MgCl2, 200 µM dNTPs, 0.5 U Taq DNA polymerase (Applied Biosystems, Foster City, CA, USA) and 5 pmol of each primer using Applied Biosystems Gene Amp PCR System 9700 and conditions: 95oC for 10 min, 32 cycles of 94oC for 30 sec, 59oC for 30 sec and 72oC for 30 sec, followed by a further 5‑min extension at 72oC. PCR products were treated with ExoI and SAP enzymes (Fermentas) to remove primers before using a BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems). Capillary electrophoresis was performed on an ABI3130xl genetic analyzer. Sequencing of the 475 bp region flanking the Mir717 was performed with 2-3 mice per inbred strain: a DNA panel contained the “high growth” mouse mutant (genetic background of C57BL/6J) 9, DBA/2J from Harlan (Italy) and DNA from embryonic stem cell line HM1 isolated from 129/Sv strain 10. Analysis revealed an A>G substitution SNP within the mature Mir717 among these three strains at position 49775654 on Chromosome X (Ensembl release 60). The allele A was shared by high fat strains DBA/2J and C57BL/6J. Interestingly, the allele A is also present in 25 out of 26 compared mammalian species (Figure 1B), suggesting an important functional role of this site. However, the 129/Sv strain contained the allele G at the SNP site. As this line exhibits lower values for all obesity related traits (blood lipids, total body fat, weights of individual fat depots etc.; http://phenome.jax.org/) this SNP allele G could therefore be potentially associated with leanness in mice. However, to causally confirm this association, segregation analyses should be conducted between the lean line 129/Sv and other high fat strains sharing the SNP allele of C57BL/6J and DBA/2J. Bioinformatic analysis of Mir717 was performed using the Ensembl, MGI (http://www.informatics.jax.org/) and Patrocles (http://www.patrocles.org/) and revealed two SNPs in the Mir717. The pre-miRNA SNP (rs30373504) was monomorphic in our tested mouse population, but the polymorphic A>G SNP resided in the mature miRNA (rs30372501). This mature miRNA SNP (miR-SNP) is located within the “seed region”; defined as six or seven nucleotides between the nucleotides 2-7 or 2-8 of the miRNA 5' end that are responsible for mRNA binding 11 (Figure 1C). The term miR-SNP refers to the variation that occurs in the miRNA gene sequence, whereas miR-TS-SNP refers to the SNP that occurs in the miRNA target site (TS) 11. MiR-TS-SNPs have been associated with many diseases, including tumor susceptibility 12. Because one miRNA can have multiple targets, miR-SNPs would be expected to exhibit more profound and broader biological effects than miR-TS-SNPs 11. The causal effect of the seed miR-SNPs on phenotype variability has been shown recently - two groups discovered that miR-96 seed SNP was responsible for hearing loss in human and mouse 13,14. Our results further imply the importance of the seed SNP by linking our identified SNP to fat deposition traits. Additionally, we performed the search for the putative obesity associated Mir717 targets. Obesity genes were collected from the Human obesity gene map 15 (http://obesitygene.pbrc.edu), Rat genome database (RGD) (http://rgd.mcw.edu/), Mouse genome informatics (MGI) (http://www.informatics.jax.org) and Pubmed (http://www.ncbi.nlm.nih.gov/). The search for putative Mir717 targets was performed using DIANA - microT v3.0 target prediction tool (http://diana.cslab.ece.ntua.gr/), TargetScan, Release 5.1 software (http://www.targetscan.org/), MirGen (http://diana.pcbi.upenn.edu/cgi-bin/miRGen/v3/Targets.cgi), miRDB (http://mirdb.org/miRDB/), and PITA (http://genie.weizmann.ac.il/pubs/mir07/index.html). We compiled a total of 2610 genes potentially targeted by Mir717. The analysis revealed only eight targets discovered by all five tools and they are 2010002N04Rik, Camta1, Coq4, Dedd, Dixdc1, Spry1, Syp, and Tyro3. From the database searches of Human obesity gene map, RGD (rat), MGI (mouse) and Pubmed (cattle) 679 fat deposition related genes were collected. Comparison of Mir717 target genes to the obesity gene list revealed that 91 target genes were described previously as obesity related. Several miRNAs have been shown to play an essential role in adipogenesis, such as miR-27 16, miR-21 17, miR-27b 18, and miR-335 19. The SNP identified in our study is located in the seed region of the miRNA that has to be complementary to the mRNA in order to recognize the target. MiR-SNP could impact on the catalogue of miRNA targets, not only by disrupting the interaction of the mutant Mir717 with some target genes but also by creating illegitimate targets that are not targeted by the wild type Mir717. Our finding represents a four layer genomic overlap: growth associated QTL, body mass associated Gpc3 gene, highly conserved miRNA gene and seed miRNA SNP which is a relatively rare event. The analyzed Mir717 SNP should now be used in future crosses between the low fat strain 129/Sv and the high fat strains DBA/2J and C57BL/6J to test for direct associations of this marker with obesity/leanness related traits. Furthermore, our bioinformatics analysis also provides a basis for functional annotation of Mir717 orthologs in other species as well as identification of posttranscriptional regulation of fatness-related targets.
  19 in total

1.  Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes.

Authors:  Scott Baskerville; David P Bartel
Journal:  RNA       Date:  2005-03       Impact factor: 4.942

2.  Intronic microRNA: discovery and biological implications.

Authors:  Sung-Chou Li; Petrus Tang; Wen-Chang Lin
Journal:  DNA Cell Biol       Date:  2007-04       Impact factor: 3.311

3.  Lack of Socs2 expression causes the high-growth phenotype in mice.

Authors:  S Horvat; J F Medrano
Journal:  Genomics       Date:  2001-03-01       Impact factor: 5.736

Review 4.  The human obesity gene map: the 2005 update.

Authors:  Tuomo Rankinen; Aamir Zuberi; Yvon C Chagnon; S John Weisnagel; George Argyropoulos; Brandon Walts; Louis Pérusse; Claude Bouchard
Journal:  Obesity (Silver Spring)       Date:  2006-04       Impact factor: 5.002

5.  Mutations in GPC3, a glypican gene, cause the Simpson-Golabi-Behmel overgrowth syndrome.

Authors:  G Pilia; R M Hughes-Benzie; A MacKenzie; P Baybayan; E Y Chen; R Huber; G Neri; A Cao; A Forabosco; D Schlessinger
Journal:  Nat Genet       Date:  1996-03       Impact factor: 38.330

6.  A role of miR-27 in the regulation of adipogenesis.

Authors:  Qun Lin; Zhanguo Gao; Rodolfo M Alarcon; Jianping Ye; Zhong Yun
Journal:  FEBS J       Date:  2009-04       Impact factor: 5.542

7.  Tonicity-responsive microRNAs contribute to the maximal induction of osmoregulatory transcription factor OREBP in response to high-NaCl hypertonicity.

Authors:  Weifeng Huang; Huili Liu; Tao Wang; Tiantian Zhang; Juntao Kuang; Yu Luo; Stephen S M Chung; Li Yuan; James Y Yang
Journal:  Nucleic Acids Res       Date:  2010-09-17       Impact factor: 16.971

8.  Glypican-3-deficient mice exhibit developmental overgrowth and some of the abnormalities typical of Simpson-Golabi-Behmel syndrome.

Authors:  D F Cano-Gauci; H H Song; H Yang; C McKerlie; B Choo; W Shi; R Pullano; T D Piscione; S Grisaru; S Soon; L Sedlackova; A K Tanswell; T W Mak; H Yeger; G A Lockwood; N D Rosenblum; J Filmus
Journal:  J Cell Biol       Date:  1999-07-12       Impact factor: 10.539

9.  Regulatory variation at glypican-3 underlies a major growth QTL in mice.

Authors:  Fiona Oliver; Julian K Christians; Xiaojun Liu; Susan Rhind; Vinesh Verma; Claire Davison; Steve D M Brown; Paul Denny; Peter D Keightley
Journal:  PLoS Biol       Date:  2005-04-05       Impact factor: 8.029

10.  An ENU-induced mutation of miR-96 associated with progressive hearing loss in mice.

Authors:  Morag A Lewis; Elizabeth Quint; Anne M Glazier; Helmut Fuchs; Martin Hrabé De Angelis; Cordelia Langford; Stijn van Dongen; Cei Abreu-Goodger; Matias Piipari; Nick Redshaw; Tamas Dalmay; Miguel Angel Moreno-Pelayo; Anton J Enright; Karen P Steel
Journal:  Nat Genet       Date:  2009-04-12       Impact factor: 38.330

View more
  7 in total

1.  Genetic variants of the hypoxia-inducible factor 3 alpha subunit (Hif3a) gene in the Fat and Lean mouse selection lines.

Authors:  Špela Mikec; Martin Šimon; Nicholas M Morton; Santosh S Atanur; Janez Konc; Peter Dovč; Simon Horvat; Tanja Kunej
Journal:  Mol Biol Rep       Date:  2022-03-26       Impact factor: 2.742

2.  MicroRNAs-1614-3p gene seed region polymorphisms and association analysis with chicken production traits.

Authors:  Hong Li; Gui-Rong Sun; Ya-Dong Tian; Rui-Li Han; Guo-Xi Li; Xiang-Tao Kang
Journal:  J Appl Genet       Date:  2013-03-02       Impact factor: 3.240

3.  Pivotal role of the muscle-contraction pathway in cryptorchidism and evidence for genomic connections with cardiomyopathy pathways in RASopathies.

Authors:  Carlo V Cannistraci; Jernej Ogorevc; Minja Zorc; Timothy Ravasi; Peter Dovc; Tanja Kunej
Journal:  BMC Med Genomics       Date:  2013-02-14       Impact factor: 3.063

4.  Catalog of microRNA seed polymorphisms in vertebrates.

Authors:  Minja Zorc; Dasa Jevsinek Skok; Irena Godnic; George Adrian Calin; Simon Horvat; Zhihua Jiang; Peter Dovc; Tanja Kunej
Journal:  PLoS One       Date:  2012-01-27       Impact factor: 3.240

5.  Weight-reduction through a low-fat diet causes differential expression of circulating microRNAs in obese C57BL/6 mice.

Authors:  Ching-Hua Hsieh; Cheng-Shyuan Rau; Shao-Chun Wu; Johnson Chia-Shen Yang; Yi-Chan Wu; Tsu-Hsiang Lu; Siou-Ling Tzeng; Chia-Jung Wu; Chia-Wei Lin
Journal:  BMC Genomics       Date:  2015-09-16       Impact factor: 3.969

6.  Genome-wide and species-wide in silico screening for intragenic MicroRNAs in human, mouse and chicken.

Authors:  Irena Godnic; Minja Zorc; Dasa Jevsinek Skok; George Adrian Calin; Simon Horvat; Peter Dovc; Milena Kovac; Tanja Kunej
Journal:  PLoS One       Date:  2013-06-06       Impact factor: 3.240

7.  Obesity gene atlas in mammals.

Authors:  Tanja Kunej; Dasa Jevsinek Skok; Minja Zorc; Ana Ogrinc; Jennifer J Michal; Milena Kovac; Zhihua Jiang
Journal:  J Genomics       Date:  2013-12-01
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.