| Literature DB >> 21106109 |
Yuping Jia1, Yun Wang, Yan Chao, Yongzheng Jing, Zhifu Sun, Bing Luo.
Abstract
BACKGROUND: Epstein-Barr virus (EBV) has a biphasic infection cycle consisting of a latent and a lytic replicative phase. The product of immediate-early gene BRLF1, Rta, is able to disrupt the latency phase in epithelial cells and certain B-cell lines. The protein Rta is a frequent target of the EBV-induced cytotoxic T cell response. In spite of our good understanding of this protein, little is known for the gene polymorphism of BRLF1.Entities:
Mesh:
Substances:
Year: 2010 PMID: 21106109 PMCID: PMC3002924 DOI: 10.1186/1743-422X-7-341
Source DB: PubMed Journal: Virol J ISSN: 1743-422X Impact factor: 4.099
Figure 1Observed BRLF1 sequence variations in EBVaGC, NPC biopsies and TWs of healthy donors in Northern China. The numbers in the first row correspond to the amino acid positions and the numbers in the second correspond to the nucleotide positions, under which the B95-8 prototype amino acid and nucleotide sequences are listed. Different patterns are noted to the far left column, while the specimens showing identical sequences to each other are listed by a representative isolate in the second column. The following numbers separated by "/" denote the number of the identical sequences from EBVaGC, NPC and TW, respectively. Only sequences different from B95-8 are indicated. The small letters denote the nucleotide, and the amino acids are denoted by capital letters. The GD1 sequence was taken from EBV genomes AY961628 [25]. C666-1 and SNU-719 were two EBV-positive cell lines [26,27], whose sequences were obtained by using PCR-direct sequencing method.
Figure 2Phylogenetic tree drawn from the BRLF1 amino acid sequences of 21 representative isolates using neighbor-joining method. BRLF1 subtypes BR1-A, BR1-B, BR1-C and BR1-D were shown on the right. In this figure the conserved subtype BR1-E (represented by GC4) was not listed.
Distribution of BRLF1 subtypes in EBVaGCs, NPCs, and TWs
| BRLF1 subtypes | EBVaGC(n = 34) | NPC(n = 57) | TWs(= 28) |
|---|---|---|---|
| BR1-A | 13(38.2%) | 19(33.3%) | 19(67.8%) |
| BR1-B | 6(17.6%) | 4(7.0%) | 0 |
| BR1-C | 12(35.3%) | 30(52.7%) | 8(28.6%) |
| BR1-D | 0 | 4(7.0%) | 1(3.6%) |
| BR1-E | 3(8.9%) | 0 | 0 |
0.05; EBVaGC vs TW: χ2 = 2.70, P > 0.05; NPC vs TW: χ2 = 9.05, P < 0.01). In contrast, the transactivation domain was detected to have more AA mutations. Three residues, 377, 489, and 542, were the prevalent mutation loci. Mutation S→N at residue 542 affected most of the isolates (21 of 34 EBVaGCs, 50 of 57 NPCs, and all the TWs). The rest mutations in this domain affected the weaker accessory activating subregions (AA 352 to 410 and 450 to 500).
Distribution of AA mutations in Rta functional domains
| Functional domains | residues | EBVaGC(n = 34) | NPC(n = 57) | TWs(n = 28) |
|---|---|---|---|---|
| DNA binding | 273(R-M) | 17(50%) | 38(66.7%) | 9(32.1%) |
| 316(K-E) | 18(52.9%) | 38(66.7%) | 9(32.1%) | |
| Transactivation | 377(A-E) | 11(32.3%) | 20(35.1%) | 18(64.3%) |
| 489(Q-K) | 10(29.4%) | 11(19.3%) | 9(32.1%) | |
| 489(Q-R) | 16(47.1%) | 25(43.9%) | 15(53.6%) | |
| 542(S-N) | 21(61.8%) | 50(87.7%) | 28(100%) |
0.05; EBVaGC vs TW: χ2 = 6.29, 0.01
Distribution of AA mutations in Rta CTL epitopes
| HLA restriction | Rta residues | No. of isolates (%) | epitope sequence | ||
|---|---|---|---|---|---|
| EBVaGC | NPC | TW | |||
| B58 | 375-383 | 23(67.6) | 37(64.9) | 10(35.7) | N A A E P E Q P W |
| 11(32.4) | 20(35.1) | 18(64.3) | - - E - - - - - - | ||
| Cw4 | 393-407 | 34(100) | 53(92.9) | 27(96.4) | E R P I F P H P S K P T F L P |
| 0(0) | 4(7.1) | 1(3.6) | - - - - - - - - - - S - - F - | ||
| B61 | 529-543 | 13(38.2) | 7(12.3) | 0(0) | Q K E E A A I C G Q M D L S H |
| 21(61.8) | 50(87.7) | 28(100) | - - - - - - - - - - - - - N - | ||
Sequences listed are epitope sequences of B95-8 isolate. Only the mutant AAs of the specimens are shown, while the dash indicates the identical sequence to B95-8.
Sequence and coordinates of primers used in PCR and sequencing
| Primers | sequence(5'-3') | B95-8 coordinates |
|---|---|---|
| Splice1 | ||
| BRLF1-A1 | GGTGCAATGTTTAGTGAGTTAC | 103187 - 103208 |
| BRLF1-A2 | ACCAAGAGAGCGATGAGAGA | 104021 - 104002 |
| BRLF1-A3 | GGAGGCAGTTTTCAGAAGTGT | 103345 - 103365 |
| Splice2 | ||
| BRLF1-B1 | TTTGGCTGACACACCTCTCG | 103847 - 103866 |
| BRLF1-B2 | CCACCATAGGCACCGCTATG | 104783 - 104764 |
| BRLF1-B3 | CATACCTTCCCGGCTATCCCT | 103918 - 103938 |
| BRLF1-B4 | GTGTTCACCTATCCCGTCCTC | 104598 - 104578 |
| Splice3 | ||
| BRLF1-C1 | ACTTGGTTGACAGCAGGCA | 104409 - 104427 |
| BRLF1-C2 | GGTGGCTAGGTGGGAGGT | 105323 - 105306 |
| BRLF1-C3 | CAGAGCCCTGACATCCTTA | 104503 - 104521 |
| BRLF1-C4 | CACCACATCCCCCACTTC | 105274 - 105257 |