Literature DB >> 20953431

Anticancer Potentials of Root Extract of Polygala senega and Its PLGA Nanoparticles-Encapsulated Form.

Saili Paul1, Soumya Sundar Bhattacharyya, Naoual Boujedaini, Anisur Rahman Khuda-Bukhsh.   

Abstract

Ethanolic extract of Polygala senega (EEPS) had little or no cytotoxic effects on normal lung cells, but caused cell death and apoptosis to lung cancer cell line A549. In the present paper, ethanolic root extract of P. senega (EEPS) was nanoencapsulated (size: 147.7 nm) by deploying a biodegradable poly-(lactic-co-glycolic) acid (PLGA). The small size of the NEEPS resulted in an enhanced cellular entry and greater bioavailability. The growth of cancer cells was inhibited better by NEEPS than EEPS. Both EEPS and NEEPS induced apoptosis of A549 cells, which was associated with decreased expression of survivin, PCNA mRNA, and increased expression of caspase-3, p53 mRNAs of A549 cells. The results show that the anticancer potential of the formulation of EEPS-loaded PLGA nanoparticles was more effective than EEPS per se, probably due to more aqueous dispersion after nanoencapsulation. Therefore, nanoencapsulated ethanolic root extract of P. senega may serve as a potential chemopreventive agent against lung cancer.

Entities:  

Year:  2010        PMID: 20953431      PMCID: PMC2952309          DOI: 10.1155/2011/517204

Source DB:  PubMed          Journal:  Evid Based Complement Alternat Med        ISSN: 1741-427X            Impact factor:   2.629


1. Introduction

There are more than 170 000 new cases of lung cancer every year in the United States, which is the leading cause of cancer death both in the United States [1] and throughout the world. Many plant extracts show immunopotentiating and antitumor properties [2, 3]. Ethanolic extract of Polygala senega is used as an expectorant to treat cough, sore throat, bronchitis, and asthma [4, 5] and as an antihypoglycemic agent [6]. The saponins of P. senega are used as vaccine adjuvants to increase specific immune responses [7]. P. senega was tested as anti-inflammatory properties on RAW 264.7 macrophage cell lines [8]. P. senega has poor water solubility that prevents aquatic dispersion making its potential rather restricted because of its lesser bioavailability. Therefore, we have examined if suitable nanoencapsulation of the ethanolic extract could enhance its bioavailability by enhancing its cellular uptake. In the present paper, we have encapsulated ethanolic plant extract of P. senega and then compared the anticancer potentials of both ethanolic extract of P. senega (EEPS) and the nanoencapsulated form (NEEPS) against a lung cancer cell line A549. We have employed the technology used earlier to nanoencapsulate a homeopathic mother tincture of Gelsemium sempervirens [9]. In this study, biodegradable nanoparticles made from Poly (d,l-lactide-co-glycolic acid) (PLGA), which have been extensively used as drug delivery systems for a variety of drugs [10, 11], were chosen as carriers. Polymeric nanoparticles show advantages with respect to other drug delivery systems, such as, more stability during storage [12]. Moreover, these colloidal systems, after intravenous administration, may extravasate solid tumors, where the capillary endothelium is defective [13, 14]. In the last two decades, PLGA has attracted considerable attention and interest due to its excellent biocompatibility and biodegradability [9, 10]. Current literature is replete with studies investigating hydrophobic drug incorporation into PLGA nanoparticles [15, 16]. It is relatively easy to entrap hydrophobic drugs into PLGA nanoparticles for their hydrophobic nature.

2. Materials

2.1. Source of the Ethanolic Extract of P. senega (EEPS)

Ethanolic extract of root of P. senega is used as a homeopathic mother tincture. In the present paper, homeopathic mother tincture of P. senega was procured from Dr. Wilmar Schwabe India Private Limited, A-36, Sector 60, Noida, India. 100 mL of the mother tincture of P. senega (48% ethanol) was initially evaporated using rotary evaporator at 40°C and dried in vacuum desiccator. This dried extract of ethyl P. senega (EEPS) was used for the present experiment.

2.2. Formation of Blank Nanoparticles and Drug-Loaded Nanoparticles

PLGA nanoparticles formation was performed under optimal conditions by solvent displacement technique of Fessi et al. [17]. In brief, first accurately weighed 50mg PLGA (purchased from Sigma Chemical Co. St. Louis, MO, USA) and 10 mg of dried drug were dissolved in 3 mL acetone. Next, the organic phase mixture was added dropwise (0.5 mL/min) into 20 mL aqueous solution containing stabilizer, 1% (polyoxyethylene-polyoxypropylene) (F68; w/v), and which was then stirred at 400 rpm by a laboratory magnetic stirrer at room temperature until complete evaporation of the organic solvent took place. The redundant stabilizer was removed from the nanoparticles by centrifugation at 25,000 g and 4°C for 30 minutes (REMI C 24 centrifuge, REMI Instruments Limited, India). The pellet was resuspended in Milli-Q water and washed three times. The obtained nanoparticles loaded suspensions were stored at 4°C until further use.

2.3. Surface Morphology

Scanning electron microscopy (SEM) was performed to evaluate the surface morphology of nanoparticles. Nanoparticles samples were dried for 24 hours before the analysis.

2.4. Particle Size Analysis and Zeta Potential Measurements

Dynamic light scattering (DLS) was used for measurement of average hydrodynamic diameters and polydispersity index (Pdi) (Malvern Zetasizer Nano-ZS, Malvern Instruments, UK). Each sample was analyzed in triplicate at 20°C at a scattering angle of 173. Pure water was used as a reference for dispersing medium. Zeta potential data were collected through electrophoretic light scattering at 25°C, 150 V, in triplicate for each sample (Malvern Zetasizer Nano-ZS, Malvern Instruments, UK), in pure water. The instrument was calibrated with Malvern-50 V standard before each analysis cycle.

2.5. Characterization by Atomic Force Microscopy

The surface properties of drug loaded nanoparticles were visualized by an atomic force microscope (Veeco di CP-11) under normal atmospheric condition. Explorer atomic force microscope was in tapping mode, using high-resonant-frequency (F0 = 241 kHz) pyramidal cantilevers with silicon probes having force constants of 41 N/m. Scan speeds were set at 2 Hz. The samples were diluted 10 times with distilled water and then dropped onto glass slides, followed by vacuum drying for 24 hours at 25°C. Height measurements were obtained using AFM image analysis software.

2.6. Entrapment Efficiency (EE, %)

The entrapment efficiency (EE, %) of EEPS loaded in PLGA nanoparticles was determined as follows: the nanoparticles were separated from the unentrapped free drug using NANOSEP (100 kD cut off) membrane filter and the amount of free drug in the filtrate was measured using spectrophotometer (SHIMADZU UV-1700). The EE (%) was calculated by EE (%) = ([Drug]tot [Drug]free)/[Drug]tot ×100.

2.7. Cell Culture

2.7.1. Reagents

Dulbecco's modified Eagle medium (DMEM), fetal bovine serum (FBS), penicillin, streptomycin, neomycin (PSN) antibiotic, trypsin, and ethylene diamine tetra acetic acid (EDTA) were purchased from Gibco BRL (Grand Island, NY, USA). Tissue culture plastic wares were obtained from BD Bioscience (USA). All organic solvents used were of HPLC grade. Propidium iodide, MTT (3-(4,5-Dimethyl-thiazol-2-yl)-2, S-diphenyltetrazolium bromide), and all other chemicals used were purchased from Sigma Chemical Co. (St. Louis, MO, USA).

2.7.2. Cell-Culture Procedure

The A549 cell line obtained from National Centre for Cell Science, Pune, India was grown at 37°C in 5% carbon dioxide atmosphere in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum and 1% antibiotic (PSN). For experimental studies, cells were grown to 80–90% confluence, harvested with ice-cold buffer saline (PBS) and plated at desired density and allowed to re-equilibrate for 24 hours before any treatment. Normal lung cells of mice were also cultured and exposed to both EEPS and NEEPS to test their cytotoxic effect, if any.

2.8. Treatment of Drug and Placebo (48% Ethanol)

Different amounts of EEPS, NEEPS, and blank nanoparticles (PLGA), namely, 20 μg/105 cells, 40 μg/105 cells, 80 μg/105 cells, 100 μg/105 cells, 160 μg/105 cells, and 200 μg/105 cells were poured into different wells. A well was also provided with the ethanol placebo (2 μl 48%) (“vehicle” of P. senega mother tincture). After 24 hours of treatment, different experiments were performed.

2.9. Cytotoxicity Determination by the MTT Assay

Viability of normal lung cells and A549 cells was determined by MTT assay after treatment of blank nanoparticles, EEPS and NEEPS [18]. Briefly, 0.6 × 104 cells/well were seeded into 96-well microtiter plates. Nanoparticle suspensions, EEPS and NEEPS, were serially diluted in DMEM/10% fetal bovine serum from 200 μg/mL to 20 μg/mL (total of six concentrations). These diluted materials were separately incubated with A549 cells and normal lung cells for 24 hours. Triplicate measurements were made for each concentration. At the end of the treatment, 20 μl of 2 mg/mL MTT (3, 5-dimethylthiazol-2-yl)-2, 5-dephenyltetrazolium bromide) was added to each well, and the plates incubated for 4 hours at 37°C. Finally, acidic isopropanol (100 μl) was added to each well, after which optical absorbance at 595 nm was read on a scanning multiwell spectrophotometer plate reader. The cell viability was expressed as Cell viability = Optical Density (OD) of drug treated samples/OD of control sample × 100.

2.10. EEPS Uptake in Cells by Fluorescence Method

The cellular uptake of EEPS and NEEPS in A549 cells was analyzed. In brief, cells were washed twice with PBS. The washed cells were resuspended in media and then incubated with EEPS and NEEPS for different time periods. Cells were then examined under a fluorescence microscope (Carl Zeiss, Germany). The percentage of fluorescence positive cells was measured using a software Motic image, China.

2.11. Apoptosis Analysis through Terminal Transferase dUTP Nick End Labeling (TUNEL) Assay

The DNA strand break analysis was made by labeling with Br-dUTP following the method of Darzynkiewicz et al. [19]. Briefly, 1-2 × 106 cells were suspended in 0.5 mL PBS. This suspension was transferred with a Pasteur pipette into a 5 mL polypropylene tube containing 4.5 mL of ice cold 1% formaldehyde in PBS. The tube was kept for 15 minutes on ice. The cells were centrifuged at 1200 g for 5 minutes; cell pellet was resuspended in 5 mL of PBS and was centrifuged again. The cell pellet was dissolved in 0.5 mL of PBS. The suspension was transferred with the help of Pasteur pipette to a tube containing 4.5 mL of ice-cold 70% ethanol. The cells were centrifuged at 1200 g for 3 minutes and ethanol was removed. Then, the cells were resuspended in 5 mL of PBS and were centrifuged again at 1200 g for 5 minutes. The pellet was finally suspended in 50 μl of a solution containing: 10 μl TdT 5X reaction buffer, 2.0 μl of Br-dUTP stock solution (0.5 μl (12.5 U) TdT, 5 μl CoCl2 solution, and 33.5 μl distilled H2O. Next, the cells were incubated in this solution for 40 minutes at 37°C; 1.5 mL of the rinsing buffer was added, and then centrifuged at 1200 g for 5 minutes. The cell pellet was resuspended in 100 μl of FITC- (or Alexa Fluor 488) conjugated anti-Br-dU mAb solution procured from Abcam USA (1 : 1000). Then, the cells were incubated at room temperature for 1 hour. 1 mL of PI staining solution was added. Finally, the cells were incubated for 30 minutes at room temperature, or 20 minutes at 37°C in the dark, and after incubation were analyzed by flow cytometry (Becton Dickinson, CA, USA).

2.12. Double Labeling of Cells with Annexin V-FITC and Propidium Iodide

Perturbation in the cellular membrane occurs during the early stages of apoptosis that leads to a redistribution of phosphatidylserine to the external side of the cell membrane. Annexin V selectively binds to phosphatidylserine and thus, enables the use of a fluorescence-labeled Annexin V to identify the cell undergoing apoptosis. The cells were also stained with Propidium iodide to distinguish early apoptotic cells from necrotic cells. 1 × 106 cells per sample were taken into small centrifuge tubes. Then, the cells were spun at 1200 g for 5 minutes and after that supernatants were discarded and pellet was washed with 500 μl binding buffer. The cells were harvested at 1200 g for 5 minutes, and cell pellet was resuspended in 80 μl binding buffer. 10 μl Annexin V-FITC and 10 μl of Propidium iodide labeling solutions were added, and the cell suspension was incubated for 15 minutes at room temperature in the dark. Then the solution was ready for analysis by flow cytometry.

2.13. DNA Laddering

The cells were harvested after different treatments into extraction buffer (10 mM Tris-HCl pH 7.4, containing 10 mM NaCl, 20 mM EDTA, and 1% Triton X-100) after 24 hours of treatment. Genomic DNA was isolated by digesting the cell extract with 10 μg/mL of proteinase K at 56°C for 8–12 hours. DNA was purified by phenol/chloroform, precipitated with ethanol and dissolved in Tris EDTA (TE). Integrity of DNA was analyzed by gel electrophoresis on 1% agarose gels followed by Ethidium bromide staining.

2.14. Hoechst 33258 Staining

To observe nuclear changes occurring during apoptosis, the chromatin-specific dye Hoechst 33258 was used [20]. Cultures were fixed for 5 minutes with 4% formaldehyde in PBS at 37°C and then permeabilized by treatment with a mixture of ethanol/acetic acid (3 : 1) for 10 minutes at 25°C. After being washed with PBS, the cells were stained with 1 μg/mL Hoechst 33258 in PBS for 10 minutes at room temperature and then washed again. Apoptosis was determined morphologically after staining the cells with Hoechst 33258 using fluorescence microscopy (Axiscope plus 2, Zeiss, Germany).

2.15. RNA Extraction and Quantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Analysis

The total RNA was extracted from the A549 cells using Trizol reagent according to the manufacturer's instructions. The RNA concentration was determined spectrophotometrically at 260 nm. The RNA was diluted to 2 μg/mL with water pretreated with diethylpyrocarbonate (DEPC), containing 1 U/μl RNase inhibitor. The following ingredients were placed into a tube: 1 μl RNA, 1 μl oligo (dT) 18, 1 μl reverse transcriptase, 2 μl 10 mM deoxynucleoside triphosphate (dNTP), 4 μl 5x buffer, and sterilized in distilled water up to a total volume of 20 μl. Then, the mixture was incubated at 37°C for 60 minutes. After reverse transcription, the sample was heated at 95°C for 5 minutes to denature the reverse transcriptase, and then stored at −20°C for PCR. The synthetic oligonucleotide primers used for RT-PCR (Table 1) were procured from Bangalore Genei, Bangalore, India and Bioserve Biotechnologies India Pvt. Ltd. β-actin was used as an internal standard to normalize all samples for potential variations in mRNA content. Single-stranded cDNA was used as template for PCR amplification by using Taq polymerase. After 5 minutes at 94°C, amplification was performed for all samples under the following conditions: 94°C for 30 seconds, 52°C for 30 seconds, and 72°C for 30 seconds for 35 cycles, with a final incubation at 72°C for 7 minutes. Following PCR, 5 μl samples aliquots were subjected to electrophoresis on 1% (w/v) agarose gel for 20–30 minutes and then stained with Ethidium bromide and photographed. The band density was measured using Ultra Lum digital imaging Gel Documentation System (USA) and analyzed by Total lab software (UK).
Table 1

Primer sequences of cancer-related genes (human origin) used in this study.

Primer namePrimer sequences
β-actinCatalogue number-117816,GeNei (purchased from Bangalore GeNei)
SurvivinF: ATGACGACCCCATGCAAA
R: AGGATTTAGGCCACTGCCTT
PCNACatalogue number-117813,GeNei (purchased from Bangalore GeNei
Caspase-3F: AGGCGGTTGTAGAAGTTAATAAAGGT
R: AGCGACTGGATGAACCAGGA
p53Catalogue number-117810,GeNei (purchased from Bangalore GeNei)

2.16. Statistical Analysis

Results were given as mean ± SE. Differences between the data of EEPS and NEEPS were calculated for statistical significance by following the Student's t-test method. P values less than  .05 to  .001 were considered significant.

3. Results

3.1. Characterization of PLGA-Encapsulated Drugs

The morphology of PLGA-encapsulated drug under scanning microscopy and atomic force microscopy with corresponding 3D image is shown in Figures 1(a)–1(c). PLGA-associated drug nanoparticles had 80% encapsulation efficiency. SEM was used to investigate the morphology of nanoparticles. As showed in Figure 1(a), the nanoparticles displayed a spherical shape. AFM image (Figures 1(b) and 1(c)) of NEEPS show nanoparticle surface without any noticeable pinholes or cracks. AFM also revealed that all nanoparticles were spherical in shape and below 150 nm in size.
Figure 1

(a) SEM image of nanoparticles of P. senega prepared from PLGA. (b, c) Surface topography of nanoparticles obtained by AFM.

3.2. Particle Size and Zeta-Potential Determination by DLS

DLS data showed that the mean diameter of PLGA encapsulated nanoparticles was 147.7 ± 4 nm with polydispersity index of 0.273 ± 0.012 (Figure 2(a)). The zeta potential of the drug encapsulated form was −31.6 ± 2.5 mV (Figure 2(b)). The nanoparticles size, as observed by AFM, correlated well with the size measured by DLS. Zeta potential of the nanoparticles was negative due to the presence of terminal carboxylic groups in the polymers. Miller [21] demonstrated that a high potential value of about −25 mV ensures a high-energy barrier that stabilizes the nanosuspension. Here also, PLGA particles seemed to possess the ideal surface charge, −31.6 mV for EEPS loaded nanoparticles.
Figure 2

(a) Average particle size obtained from DLS data for PLGA-encapsulated nanoparticle. (b) Zeta potential of PLGA-encapsulated nanoparticle.

3.3. Effects on Cell Viability

To determine the effects of blank nanoparticles, EEPS, and NEEPS on cell viability, the viability of the treated normal lung cells (Figure 3(a)) and A549 cells (Figure 3(b)) was measured by MTT assay. EEPS and NEEPS did not show any cytotoxic effect on normal lung cell. As compared to exposure of A549 cells for 24 hours to blank nanoparticles, the exposure of the cells to EEPS and NEEPS at different doses (20, 40, 80, 100, 160, and 200 μg/mL) significantly inhibited their viability (P < .05, P < .01, P < .001) in a dose-dependent manner (Figure 3(b)). The growth of the cells (68.65%) was inhibited by the EEPS treatments at dose 200 μg/mL. On the contrary, NEEPS at same dose inhibited the growth by 77.46% in A549 cells during the testing period. The effect was relatively strong in the NEEPS than in the EEPS.
Figure 3

Cell viability of blank nanoparticles, EEPS and NEEPS, with different concentrations against in normal lung cells (a) and A549 cell line (b) by MTT assay. *(P < .05), **(P < .01), ***(P < .001). The data represent the means ± SD (n = 3). Values of nanoparticles compared to its unencapsulated form. All results were expressed with vehicle control as 100%.

3.4. EEPS Uptake in Cells by Fluorescence Method

To check if the drug-loaded nanoparticles were internalized in cancer cells, the cellular uptake of NEEPS was evaluated on A549 cells at different time intervals. The data of the time taken by the EEPS and NEEPS have been presented in Figure 4(a). The data indicates that the rate of entry into the cells started increasing after 30 minutes onward for NEEPS and 45 minutes for EEPS. Therefore, NEEPS entered more rapidly than EEPS. The cells became saturated after 240 minutes in both capsulated and unencapsulated forms. In NEEPS-treated series, the percentages of fluorescence positive cells were higher (P < .05, P < .01, P < .001) as compared to EEPS-treated series at different time intervals (Figure 4(b)). 76.2%–80% of cells showed fluorescence after 2-3 hours of incubation with NEEPS.
Figure 4

(a) Cellular uptake of nanoparticles of ethanolic extract of P. senega and its unencapsulated form. A549 cells were incubated with NEEPS and EEPS at different time intervals and the cellular uptake (blue fluorescence) was monitored by fluorescence microscopy. (b) Percentages of cells exhibiting fluorescence at different exposures of EEPS and NEEPS, respectively. *(P < .05), **(P < .01), and ***(P < .001). The data were taken from six replicates.

3.5. Apoptosis Assay by TUNEL Method Using FACS

To investigate the effects of EEPS and NEEPS on the induction of apoptosis in A549 cells, flow cytometric measurement by TUNEL assay was used to quantify the percentages of apoptosis in the total cell population. Results of the TUNEL assay for determining the percentages of early and late apoptotic cells have been furnished in Figures 5(a) and 5(b). The data revealed that the PLGA-encapsulated NEEPS showed significantly greater apoptotic activities (P < .05, P < .001) than their unencapsulated forms at doses of 100 μg and 200 μg, respectively. The frequencies of early apoptotic cells were 27% and 43.46% at 100 and 200 μg doses, respectively, for EEPS, while these were 32% and 48.15%, respectively, for NEEPS. The late apoptotic cells in EEPS comprised 3.58% and 10.84%, respectively, for 100 and 200 μg, while in the NEEPS, these were 7.5% and 16.78%, respectively.
Figure 5

(a) EEPS and NEEPS induced apoptosis in A549 cells by TUNEL assay. Ten thousand events were collected and analysed for each sample. (i) A549 cells cultured in DMEM with 10% FBS for 24 hours. (ii)-(iii) Cells treated with two doses of EEPS (100 and 200 μg), and (iv)-(v) Cells treated with two doses of NEEPS (100 and 200 μg). The viable cells are located in the lower left corner (negative for both FITC and PI). Early apoptotic cells and late apoptotic cells are in the lower right corner and upper right corner (double positive), respectively. Necrotic cells lacking a cell membrane structure are in the upper left corner (PI positive). The numbers in the figure represent the percentage of the total cell population. (b) The histogram represents percentages of cell population (viable, early apoptotic, late apoptotic, and necrotic cells) in different series of TUNEL assay. Value represents mean ± SE (n = 3). Significant differences between EEPS and NEEPS are indicated by *(P < .05) and ***(P < .001).

3.6. Apoptosis Assay by Annexin V-FITC and PI Staining Methods Using FACS

To further investigate these findings, we performed Annexin V assay on A549 cell. Figures 6(a) and 6(b) show that treatment of A549 cell line with EEPS and NEEPS induces apoptosis. The FACS data of Annexin V-FITC staining have been presented in Figures 6(a) and 6(b). The data were in agreement with that of TUNEL assay using FACS, in respect of both EEPS and NEEPS. Thus, results of both TUNEL assay and Annexin V methods complemented each other and reaffirmed the greater apoptotic potential (P < .05, P < .01) of the PLGA-encapsulated nano forms than their unencapsulated forms, which also showed considerable apoptotic activities at the higher dose.
Figure 6

(a) EEPS and NEEPS induced apoptosis in A549 cells. Cells were harvested and stained with Annexin V-FITC and propidium iodide (PI). Ten thousand events were collected and analysed for each sample. (i) Control, (ii)-(iii) Cells treated with two doses of EEPS (100 and 200 μg), and (iv)-(v) Cells treated with two doses of NEEPS (100 and 200 μg). (b) Histogram represents percentages of cell population (viable, early apoptotic, late apoptotic, and necrotic cells) in different series by Annexin V-FITC assay. Values represent mean ± SE (n = 3). Significant differences between EEPS and NEEPS are indicated by *(P < .05) and **(P < .01).

3.7. DNA Ladder Assay

During the course of the above experiments, we noticed that many cells detached from the surface of the cell culture plate, suggesting some form of cell death. To investigate this, we treated A549 cells with 100 μg and 200 μg of EEPS and NEEPS and then, extracted their genomic DNA and analyzed it on agarose gels. Figure 7 shows that the DNA from control cells was intact, while the DNA from cells treated with EEPS and NEEPS exhibited a smear corresponding to a laddering of DNA.
Figure 7

Effect of EEPS and its nanoparticle on A549. A549 cells were treated with drugs for 24 hours. Genomic DNA was extracted and DNA was separated on 1% agarose gels and stained with Ethidium bromide. The first lane contains a standard DNA ladder, lane two contains DNA from untreated cells, lane three contains DNA from EEPS (100 μg), lane four contains DNA from EEPS (200 μg), lane five from nanoparticles (100 μg), and lane six from nanoparticles (200 μg) of P. senega-treated cells.

3.8. Hoechst 33258 Staining

Furthermore, we also observed the morphologic changes of the nucleus by Hoechst 33258 staining. In the control group, the nuclei of the A549 cells were round and homogeneously stained (Figure 8). However, EEPS- and NEEPS-treated A549 cells showed granular apoptotic bodies (nuclear condensation) (Figure 8). These results demonstrate that NEEPS induces greater apoptosis of A549 cells than EEPS.
Figure 8

Fluorescence photomicrographs of A549 cells with Hoechst 33258 staining. The assessment of nuclear morphology of the cell was performed after A549 cells were incubated for 24 hours with vehicle, with EEPS and NEEPS. →: nuclear condensation.

3.9. RT-PCR Data of Some Key Signal Proteins

mRNA level of caspase-3, survivin, PCNA, p53 in response to EEPS and NEEPS treatment was evaluated (Figures 9 and 10). For normalization of data, a house-keeping gene β-actin has also been considered. Survivin, a member of the IAP family, is a bifunctional protein that suppresses apoptosis and regulates cell division. 24 hours after the treatment with EEPS, the expression of survivin mRNA was detected by RT-PCR. The statistical analysis showed that the expression of survivin mRNA in A549 cells was down-regulated significantly by EEPS as compared with the control (Figures 9 and 10, Table 2). PCNA is usually regarded as a proliferation marker. Decreased expression upon drug treatment revealed the antiproliferative effect of EEPS and NEEPS. p53 has several target genes and it is quite well established that p53 plays an important role in cell cycle arrest and in apoptosis. The RT-PCR studies revealed significant overexpression of mRNA of p53 in EEPS- and NEEPS-administered groups, as compared to control (Figures 9 and 10). Caspases, the cytoplasmic aspartate-specific cysteine proteases, have been shown to play a central role in the apoptotic signaling pathway. Caspase-3, a member of the caspase family, was shown to play an essential role in apoptosis induced by a variety of stimuli. Finally, we examined whether caspase-3 expression was increased during EEPS-induced apoptosis in A549 cells. On further critical analysis of the data between EEPS and NEEPS, we found that the latter showed stronger effect (P < .05, P < .01, P < .001).
Figure 9

mRNA expression of survivin, PCNA, caspase-3, p53 analyzed by RT-PCR in EEPS- and NEEPS-treated cells as well as in control cells. β-actin was used as a loading control. Ln1-Control, Ln2- EEPS (100 μg), Ln3- EEPS (200 μg), Ln4- NEEPS (100 μg), and Ln5- NEEPS (200 μg).

Figure 10

Histogram represents data of band density of different mRNA expressions in EEPS- and NEEPS-treated cells along with control cells. *, **, and *** denote significant differences (P < .05 and P < .01, P < .001, resp.) between EEPS and NEEPS for both doses. Ln1-Control, Ln2- EEPS (100 μg), Ln3- EEPS (200 μg), Ln4- NEEPS (100 μg), and Ln5- NEEPS (200 μg). Band density was expressed as a mean ± SE of the three independent experiments.

Table 2

Band density of different mRNA expressions in different series. Band density was expressed as a mean ± SE of the three independent experiments. Significant differences between EEPS and NEEPS are indicated by *(P < .05), **(P < .01) and ***(P < .001).

Signalling moleculeBand density
Ln1 (Control)Ln2 (EEPS 100 μg)Ln3 (EEPS 200 μg)Ln4 (NEEPS 100 μg)Ln5 (NEEPS 200 μg)
β-actin3.52 ± 0.0153.54 ± 0.0353.5 ± 0.0523.48 ± 0.0323.52 ± 0.028
Survivin7.6 ± 0.216.8 ± 0.1255.8 ± 0.326.15 ± 0.185*4.2 ± 0.15*
PCNA8.25 ± 0.157.5 ± 0.126.25 ± 0.256.58 ± 0.15**4.85 ± 0.125**
Caspase-39.21 ± 0.1311.5 ± 0.1813.52 ± 0.1512.42 ± 0.12*15.4 ± 0.35**
p536.8 ± 0.747.2 ± 0.329.25 ± 0.158.85 ± 0.4*11.52 ± 0.16***

*P < .05, **P < .01, ***P < .001.

4. Discussion

The above results reveal that the NEEPS showed considerable inhibitory activity on cellular growth, more by apoptosis than by necrosis in the A549 cells; but interestingly, EEPS and NEEPS did not have much cytotoxicity when administered to normal lung cells in culture. Thus, both appeared to have an affinity of targeting the cancer cells and to kill them, while leaving the normal cells less affected. The principal active constituents of P. senega are saponin glycosides polygalic acid and senegin, which make up 5% and 4%, respectively, of the dried root [22]. Earlier studies have revealed P. senega to be immunostimulating but not tumoricidal [23, 24]. The findings of the present paper would suggest that they also have considerable anticancer potentials against lung cancer cells. However, the anticancer effect of any individual ingredient of the root extract has not yet been studied and may form the basis for future studies. Therefore, till such studies are conducted, the collective effect of all the ingredients in the root extract could currently be attributed for the anticancer potentials of EEPS. Further, the result of the present paper would reveal that the nanoencapsulation made the extract more potent as an anticancer agent. This could possibly be because it rendered the extract more water soluble and easy to enter the cell bringing with it the anticancer agent inside the cancer cell only to facilitate the cancer cell's death. In the current paper, we consciously used biodegradable nanoparticles formulation of plant extract based on poly (lactide-co-glycolide) technique using a stabilizer (Pluronic F-68), and tested its bioavailability and effects on cell growth. Although this approach has been used to encapsulate a wide variety of hydrophobic drugs including natural products such as curcumin [25, 26], coenzyme Q10 [27], and estradiol [28], to the best of our knowledge, only another plant extract (Gelsemium sempervirens) that is used as a homeopathic mother tincture has so far been successfully encapsulated by this method [9]. On treatment of aqueous solutions of PLGA with root extract, rapid formation of PLGA nanoparticles takes place at high concentrations and these are quite stable in nature. On the other hand, the use of metal nanoparticles has been made more frequently for various purposes. There are many reports in the literature on the biogenesis of silver nanoparticles using several plant extracts, particularly Neem leaf broth (Azadirachta indica) and geranium leaves (P. graveolens) [29, 30]. However, the synthesis of PLGA nanoparticles using plant extract has not yet been studied for a large number of natural compounds. The results of the present paper suggested that the higher dose was more efficient in inducing apoptosis as compared to the lower dose. Quantitative determination of apoptotic cells by TUNEL assay, Annexin V-FITC labeling method also indicated that NEEPS exhibited relatively higher inductive activity on apoptosis of A549 cells than EEPS. The expression of survivin is highly cancer-specific and is one of the top four transcripts uniformly up-regulated in human cancers, but not in the normal tissues [31]. The overexpression of survivin appears to correlate with aggressive tumor behavior and poor prognosis in nonsmall cell lung cancers [32] and hepatocellular carcinoma [33]. This finding also demonstrates that the apoptosis of A549 cells by EEPS and NEEPS is associated with the down-regulation of survivin, PCNA mRNA expression. Caspase-3, the ultimate executioner that is essential for the nuclear changes, associated with apoptosis [20]. In the present paper, we found that the EEPS and NEEPS-induced apoptosis of A549 was also related to the overexpression of caspase-3 and p53 (Figures 9 and 10). The molecular apoptotic pathway of NEEPS/EEPS-treated cells was found to be induced by activation of caspase-3 and p53 and suppression of survivin and PCNA expression. The entire process may be schematically represented as shown in Figure 11. Therefore, in our present formulation using a biodegradable nanoparticles-encapsulation of EEPS with PLGA, we were able to increase the bioavailability and thereby improve its overall inhibitory effects on cell proliferation.
Figure 11

A schematic diagram of possible molecular events in EEPS/NEEPS-induced apoptosis of cancer cell (A549).

Epidemiological data support the concept that naturally occurring anticancer agents in the human diet are safe, and nontoxic, and they have long lasting beneficial effects on human health [34, 35]. Therefore, P. senega and its nanoencapsulated form can be used as a safe dietary supplement that may act as a chemopreventive agent against lung cancer.

5. Conclusion

In conclusion, it has been demonstrated that homeopathic mother tincture of P. senega has an anticancer effect against lung cancer cells in vitro, and PLGA encapsulation helps it to enhance its cellular uptake and anticancer potentials, presumably by increasing drug bioavailability. This should stimulate further research on nano-encapsulation of homeopathic mother tinctures, as also medicinal herbal extracts, particularly with suspected anticancer potentials, to examine whether this would prove to be a novel approach for accelerating anticancer potentials for other cases as well.
  29 in total

1.  Analysis of human transcriptomes.

Authors:  V E Velculescu; S L Madden; L Zhang; A E Lash; J Yu; C Rago; A Lal; C J Wang; G A Beaudry; K M Ciriello; B P Cook; M R Dufault; A T Ferguson; Y Gao; T C He; H Hermeking; S K Hiraldo; P M Hwang; M A Lopez; H F Luderer; B Mathews; J M Petroziello; K Polyak; L Zawel; K W Kinzler
Journal:  Nat Genet       Date:  1999-12       Impact factor: 38.330

2.  Phase I/II study of stage III and IV non-small cell lung cancer patients taking a specific dietary supplement.

Authors:  A S Sun; O Ostadal; V Ryznar; I Dulik; J Dusek; A Vaclavik; H C Yeh; C Hsu; H W Bruckner; T M Fasy
Journal:  Nutr Cancer       Date:  1999       Impact factor: 2.900

3.  Hypoglycemic effect of the rhizomes of Polygala senega in normal and diabetic mice and its main component, the triterpenoid glycoside senegin-II.

Authors:  M Kako; T Miura; Y Nishiyama; M Ichimaru; M Moriyasu; A Kato
Journal:  Planta Med       Date:  1996-10       Impact factor: 3.352

4.  Development and characterization of PLGA nanospheres and nanocapsules containing xanthone and 3-methoxyxanthone.

Authors:  Maribel Teixeira; Maria J Alonso; Madalena M M Pinto; Carlos M Barbosa
Journal:  Eur J Pharm Biopharm       Date:  2005-04       Impact factor: 5.571

5.  Encapsulated plant extract (Gelsemium sempervirens) poly (lactide-co-glycolide) nanoparticles enhance cellular uptake and increase bioactivity in vitro.

Authors:  Soumya Sundar Bhattacharyya; Saili Paul; Anisur Rahman Khuda-Bukhsh
Journal:  Exp Biol Med (Maywood)       Date:  2010-06

6.  Relationship between expression of Smac and Survivin and apoptosis of primary hepatocellular carcinoma.

Authors:  Shi-Ting Bao; Shui-Qing Gui; Mu-Sheng Lin
Journal:  Hepatobiliary Pancreat Dis Int       Date:  2006-11

Review 7.  Nanoparticles in cancer therapy and diagnosis.

Authors:  Irène Brigger; Catherine Dubernet; Patrick Couvreur
Journal:  Adv Drug Deliv Rev       Date:  2002-09-13       Impact factor: 15.470

8.  Design of curcumin-loaded PLGA nanoparticles formulation with enhanced cellular uptake, and increased bioactivity in vitro and superior bioavailability in vivo.

Authors:  Preetha Anand; Hareesh B Nair; Bokyung Sung; Ajaikumar B Kunnumakkara; Vivek R Yadav; Rajeshwar R Tekmal; Bharat B Aggarwal
Journal:  Biochem Pharmacol       Date:  2009-09-06       Impact factor: 5.858

9.  Analysis of apoptosis by cytometry using TUNEL assay.

Authors:  Zbigniew Darzynkiewicz; Dariusz Galkowski; Hong Zhao
Journal:  Methods       Date:  2008-03       Impact factor: 3.608

10.  Polymeric nanoparticle-encapsulated curcumin ("nanocurcumin"): a novel strategy for human cancer therapy.

Authors:  Savita Bisht; Georg Feldmann; Sheetal Soni; Rajani Ravi; Collins Karikar; Amarnath Maitra; Anirban Maitra
Journal:  J Nanobiotechnology       Date:  2007-04-17       Impact factor: 10.435

View more
  7 in total

1.  Enhanced Anticancer Activity of Hymenocardia acida Stem Bark Extract Loaded into PLGA Nanoparticles.

Authors:  Oluwasegun Adedokun; Epole N Ntungwe; Cláudia Viegas; Bunyamin Adesina Ayinde; Luciano Barboni; Filippo Maggi; Lucilia Saraiva; Patrícia Rijo; Pedro Fonte
Journal:  Pharmaceuticals (Basel)       Date:  2022-04-26

Review 2.  Integrative nanomedicine: treating cancer with nanoscale natural products.

Authors:  Iris R Bell; Barbara Sarter; Mary Koithan; Prasanta Banerji; Pratip Banerji; Shamini Jain; John Ives
Journal:  Glob Adv Health Med       Date:  2014-01

Review 3.  Medicinal Plants and Other Living Organisms with Antitumor Potential against Lung Cancer.

Authors:  Luara de Sousa Monteiro; Katherine Xavier Bastos; José Maria Barbosa-Filho; Petrônio Filgueiras de Athayde-Filho; Margareth de Fátima Formiga Melo Diniz; Marianna Vieira Sobral
Journal:  Evid Based Complement Alternat Med       Date:  2014-07-24       Impact factor: 2.629

4.  Applying Box-Behnken Design for Formulation and Optimization of PLGA-Coffee Nanoparticles and Detecting Enhanced Antioxidant and Anticancer Activities.

Authors:  Nouran S Sharaf; Amro Shetta; Jailan E Elhalawani; Wael Mamdouh
Journal:  Polymers (Basel)       Date:  2021-12-31       Impact factor: 4.329

5.  Biosynthesis and immobilization of biofunctional allophycocyanin.

Authors:  Yingjie Chen; Shaofang Liu; Yulin Cui; Peng Jiang; Huaxin Chen; Fuchao Li; Song Qin
Journal:  Evid Based Complement Alternat Med       Date:  2011-08-10       Impact factor: 2.629

Review 6.  Nanotechnology-based drug delivery systems and herbal medicines: a review.

Authors:  Bruna Vidal Bonifácio; Patricia Bento da Silva; Matheus Aparecido Dos Santos Ramos; Kamila Maria Silveira Negri; Taís Maria Bauab; Marlus Chorilli
Journal:  Int J Nanomedicine       Date:  2013-12-09

Review 7.  Development of botanicals to combat antibiotic resistance.

Authors:  Pooja D Gupta; Tannaz J Birdi
Journal:  J Ayurveda Integr Med       Date:  2017-08-30
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.