Literature DB >> 20945070

Differential expression of presynaptic genes in a rat model of postnatal hypoxia: relevance to schizophrenia.

J U Sommer1, A Schmitt, M Heck, E L Schaeffer, M Fendt, M Zink, K Nieselt, S Symons, G Petroianu, A Lex, M Herrera-Marschitz, R Spanagel, P Falkai, P J Gebicke-Haerter.   

Abstract

Obstetric complications play a role in the pathophysiology of schizophrenia. However, the biological consequences during neurodevelopment until adulthood are unknown. Microarrays have been used for expression profiling in four brain regions of a rat model of neonatal hypoxia as a common factor of obstetric complications. Animals were repeatedly exposed to chronic hypoxia from postnatal (PD) day 4 through day 8 and killed at the age of 150 days. Additional groups of rats were treated with clozapine from PD 120-150. Self-spotted chips containing 340 cDNAs related to the glutamate system ("glutamate chips") were used. The data show differential (up and down) regulations of numerous genes in frontal (FR), temporal (TE) and parietal cortex (PAR), and in caudate putamen (CPU), but evidently many more genes are upregulated in frontal and temporal cortex, whereas in parietal cortex the majority of genes are downregulated. Because of their primary presynaptic occurrence, five differentially expressed genes (CPX1, NPY, NRXN1, SNAP-25, and STX1A) have been selected for comparisons with clozapine-treated animals by qRT-PCR. Complexin 1 is upregulated in FR and TE cortex but unchanged in PAR by hypoxic treatment. Clozapine downregulates it in FR but upregulates it in PAR cortex. Similarly, syntaxin 1A was upregulated in FR, but downregulated in TE and unchanged in PAR cortex, whereas clozapine downregulated it in FR but upregulated it in PAR cortex. Hence, hypoxia alters gene expression regionally specific, which is in agreement with reports on differentially expressed presynaptic genes in schizophrenia. Chronic clozapine treatment may contribute to normalize synaptic connectivity.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20945070      PMCID: PMC2965359          DOI: 10.1007/s00406-010-0159-1

Source DB:  PubMed          Journal:  Eur Arch Psychiatry Clin Neurosci        ISSN: 0940-1334            Impact factor:   5.270


Introduction

In addition to genetic predisposition, the neurodevelopmental hypothesis of schizophrenia includes a number of environmental factors like obstetric and birth complications with ensuing consequences on the pathophysiology of the disease. Hence, the risk of schizophrenia increases with the number and severity of hypoxia-associated obstetric complications [5, 6, 22]. However, the pathogenetic implications of obstetric complications are unclear. The neurodevelopmental hypothesis of schizophrenia suggests that the onset of abnormal brain development and neuropathology occurs perinatally, whereas symptoms of the disease appear in early adulthood [32]. Schizophrenia patients show deficits in attention and processing of sensory information. A reliable test of sensorimotor gating in vertebrates is prepulse inhibition (PPI) of the acoustic startle reflex, which is disrupted in schizophrenia patients and restored by antipsychotics, mainly clozapine [2]. Several cortical brain regions and striatum are involved in PPI-modulating circuitry [30]. We previously reported on a PPI deficit in rats exposed to neonatal hypoxia appearing only during adulthood. This deficit was prevented and restored after chronic clozapine treatment [12]. In our animal model of chronic neonatal hypoxia, rats exhibited increased gene expression of the N-methyl-D-aspartate (NMDA) receptor subunit NR1 in hippocampal and cortical subregions [28], which suggests an involvement of the NMDA receptor in the pathophysiology of hypoxia-induced alterations. In schizophrenia, there is indeed strong support for disturbances of the glutamatergic and gamma-amino-butyric acid (GABA)ergic microcircuitry, mainly affecting the expression of presynaptic vesicle proteins including synaptosome-associated protein 25 (SNAP-25) and syntaxin, which form the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complex [9, 10, 15, 20, 29]. Complexin (CPX) 1 and complexin 2 operate in synaptic vesicle exocytosis by stabilizing the SNARE complex [4]. Neuropeptide Y (NPY) and neurexins (NRXN) play a role in cell adhesion and are hypothesized to play a role in the pathophysiology of schizophrenia [14, 20, 23, 26]. There is only little information about the influence of antipsychotic treatment on gene expression, as has been shown for NPY and CPX in normal rats [8, 16]. Thus, the present study investigates on the impact of neonatal hypoxia and long-term treatment with the antipsychotic clozapine on the expression of presynaptic genes in different cortical and subcortical brain regions in an animal model. Furthermore, correlations between differentially expressed genes and PPI deficits have been evaluated.

Materials and methods

Animals

A total of 12 Sprague–Dawley rats (Animal Facility, Department of Animal Physiology, University of Tübingen) were used for the experiments. The rats were housed in groups of 3 animals under a 12-h light/dark cycle with food and drinking water available ad libitum. The experiments were carried out in accordance with the international ethical guidelines for the care and use of laboratory animals for experiments (declaration of Helsinki, NIH guidelines) and were approved by the local animal care committee (Regierungspräsidium Tübingen, ZP 3/02).

Neonatal hypoxia

Chronic hypoxia (11% O2, 89% N2) was imposed from postnatal day (PD) 4–8 on six animal pups and their mothers by placing them in an air-tight plastic chamber for a period of 6 h per day. The six other pups were subjected to identical handling conditions and were placed in identical chambers but with regular oxygen concentrations (21% O2 = normoxia) [12, 28].

Clozapine treatment

Between PD 120 and PD 150, half of the rats were being orally treated over a period of 4 weeks with 45 mg/kg/day clozapine (Novartis Pharma AG, Basel, Switzerland) [12].

Test on prepulse inhibition and tissue preparation

The startle magnitude was measured as described in [12]. Since a deficit in prepulse inhibition had been shown to surface on postnatal days 120 and 150, animals were killed at postnatal day 150. Brains were removed and immersed in −78°C cold isopentane and stored at −80°C until further use. Slices of 120 um thickness were cut on a cryostat and used to excise respective brain regions according to the atlas of Paxinos and Watson [25] using a micropunching tool. Resultant, cylindrical tissue blocks were collected on dry ice and stored at −80°C until further processing.

Molecular investigations

RNA isolation and reverse transcription

One milliliter of Trizol was added to excised tissue, and tissue was homogenized by 30 strokes of trituration. After addition of 200 ul chloroform, the solution was transferred to Phase-Lock tubes (Eppendorf) for phase separation. Aqueous supernatants were purified and concentrated by RNeasy mini columns (Qiagen). Quality control was performed by OD measurements in a NanoDrop ND-1000 spectrophotometer (260/280 nm >1.8) and by electrophoretic separation using an Agilent 2100 Bioanalyzer (R.I.N. values >7.0). Reverse transcription of purified total RNA was carried out using oligo-dT primers with T7 promoter sequence and Superscript II (Invitrogen).

In vitro transcription and labeling

Reverse-transcribed cDNAs were treated with RNAse and with DNA polymerase to obtain double-stranded DNA. Purified DNA was used for amplification reactions using RNAMaxx High Yield Transcription Kit (Stratagene) with T7 polymerase. Typically, this in vitro transcription resulted in 40- to 50-fold amplification of mRNA/cDNA. Subsequently, cRNA was reverse-transcribed. Labeled DNA was purified and dried.

Preparation of DNA (“glutamate”) Chips

The chips represent a hypothesis driven selection of 340 cDNA sequences of genes related to glutamatergic and GABAergic neurotransmission and synaptic vesicle proteins (Online Resource 1a–f), obtained from clones purchased from Deutschen Ressourcenzentrum für Genomfoschung (RZPD, Berlin). The cDNA-inserts of bacterial clones were PCR-amplified directly from aliquots of bacterial cultures grown overnight (LB medium, containing antibiotic selection). After electrophoretic quality control, PCR mixtures were dried, resuspended in betaine-containing spotting buffer [7], and spotted on amino silane slides (Nexterion, PeqLab), using a MicroGrid II Arrayer. Each DNA was double-spotted, and each array was spotted three times on the same slide. The following control DNAs were used: salmon sperm DNA, human COT-1 DNA, 4 Arabidopsis thaliana DNAs (for spike-ins), spotting buffer, water, and a series of DNAs derived from artificial genes (library of random external controls = LOREC) [19]. Altogether, a chip contained 4,608 spots, including markers at the array corners to facilitate finding the correct orientation after scanning. After spotting, DNAs were UV-cross-linked with a radiation of 250 mJ/cm2. Then, they were baked at 80°C for 2 h and stored at RT.

Hybridization and scanning of slides

Spotted slides were sequentially washed in 1% SDS solution in distilled water, immersed in 95°C distilled water, and incubated in 55°C prehybridization solution for 45 min. Then, they were washed in distilled water, in isopropanol (20 s, each), and dried by a stream of nitrogen or air. Hybridizations were done in SlideHyb Glass Array Hybridization buffer #1 (Ambion) overnight at 56°C. All subsequent washing steps at increasing stringency were performed in the dark. Scanning was carried out in a Packard ScanArray 5,000 scanner. Each slide was scanned twice at laser strengths of 90 and 100% to obtain a larger spectrum of fluorescence intensities.

Data processing

Data quality was assessed by a number of procedures, including visual inspection of intensities, MA-plots, and correlation analysis of replicates. Within-array normalization was performed according to locally weighted scatterplot smoothing (LOESS) method [34]. Only rank-invariant probes were used for model generation during this procedure [27]. For between-array normalization, scaling [34] was used. After assessing normal distribution of replicate spots using the Kolmogorov–Smirnov test, replicates were pooled by their arithmetic means. To identify differentially expressed genes, two-tailed t-tests and the RankProduct (RP) [3] method were used. The false discovery rate (FDR) method was employed to avoid accumulation of alpha-error. Corrected P-values <0.05 were considered significant. To limit the number of differentially expressed genes, only those were used which were found by both t-test and RP methods. Finally, to profile overall regulation, only genes that were differentially regulated in at least two regions were selected for further analyses.

Quantitative real-time PCR (qRT-PCR)

Quantitative RT-PCR was carried out in 384-well plates in an ABI Prism 7900 HT Fast Real-Time PCR cycler (Applied Biosystems, Foster City, Ca., USA). The primer pairs used for the respective genes are listed in Table 1. Beta actin was used as a reference (“house-keeping”) gene.
Table 1

Primers used in qRT-PCR

Sequences reading from 5′ -end
GeneForward primerReverse primer
CPLX1GCAGGGCATACGAGATAAGTTGGTGGGGTCAGTGATGGCAGTA
NPYCGCTCTGCGACACTACATCTCAGGGCTGGATCTCTTG
NRXN1AGGGCGTCAGCTCACAATCTTCAATCTGCCGAGCCTGGGTATGGT
SNAP25AGTGGCGTTTGCTGAATGACTGCTGGTATGACTTAATCTTGACA
STX1ATGTCCCGAAAGTTTGTGGCGTTCTCGGTAGTCT
Primers used in qRT-PCR

Results

Microarray experiments

After statistical evaluations of the 768 genes spotted on the glass slides by Students t tests, many of them turned out to be significantly regulated. Table 2 provides an overview of differentially expressed genes in frontal (FR), parietal (PAR), and temporal (TE) cortex as well as in caudate putamen (CPU). At first sight, there are apparently large regional differences in terms of up- or downregulation, i.e. many more genes are upregulated in FR [44 vs. 4 (ratio11)] and in TE [51 vs. 22 (ratio 2.32)] compared with PAR [10 vs. 33 (ratio 0.3)]. A more balanced situation seems to occur in CPU.
Table 2

Differentially expressed genes in some regions of normoxic and hypoxic rat brains

CPUFRPARTE
Genelist t-test fdr correctionGenelist t-test fdr correctionGenelist t-test fdr correctionGenelist t-test fdr correction
The factor “hypoxia” regulated the following genes in comparison with “normoxia”The factor “hypoxia” regulated the following genes in comparison with “normoxia”The factor “hypoxia” regulated the following genes in comparison with “normoxia”The factor “hypoxia” regulated the following genes in comparison with “normoxia”
UPDOWNUPDOWNUPDOWNUPDOWN
ATF2ATF2CAPN2ADCY3
ATF4AURKBCAPONADCY6
ATP2A2CALM2CASKATP2A2
CPX1CAP2EAAT3BDNF
CPX2CAPN8GABBR1BNPI
GAP43CPX1GAPDHCAPN2
GAPDHDEAD BOXGNA12CAPN6
GATA4DLGAP2LOC294679CASQ2
GRM2DUSP1LOC362704CPX1
ITPR1FYNMAPK3DAT1
MARK1GAPDHPIPSEAAT3
MPPS7GNAOPLD2ERK7
MYD116MAPK14PLEKHC1GABRG3
NM_017261MAPK3POU3F4GAD67
NOS2MRPS7PPP1R14AGADD45A
NRXN1NELL2PPP2R2CGAP43
PKN1NPYPPP5CGATA4
PLD1NOS2-1149PREFOLDIN5GNAO
PLEKHC1NRXN1PRKCZGPSM1
PPM1BPACSIN2PTPRAGRM8
PPP1CCPIM3PTPRRID3
PPKCCPLATRAB14ITPR3
PTP4A1PPP1R14BRAB3ALOC294679
PTPRAPPP1R14CRAB3BLOC362704
PTPRNPTP4A2RN.25045MGC105762
PTPRN2PTPRDRN.28284NPY
RAB10PTPRNSHANK1NR2F2
RN.28284PTPRN2SLC2A1NRXN3
SACM1LRAB3ASLC6A12NUP54
SLC1A3SLC1A3SLKPIPS
SLC1A3SLC6A12SRCPLD2
SLC1A6SNAP25STAT3PNOC
SLC32A1SOD1SYT1-1511PPM1G
SNAP25SQSTM1TRANSC.LOCUSPPP1R10
STAT3SRCPPP2R2C
SYN1STK39PPP2R5B
VAMP2STX1APPP4R1
TRANSC.LOCUSPPP5C
PRKCH
PRKCZ
RAB10
RGS3
RN.137813
RN.15926
RN.7389
SLC1A6
SLC32A1
SLC6A12
SMAGP
SNAP25
SP1
SQSTM1
STAT3
STK6
STX1A
SYN1
SYN2
TCF12
VAMP1

Many more genes are upregulated in frontal (FR) and temporal (TE) cortex compared with parietal (PAR) cortex

Differentially expressed genes in some regions of normoxic and hypoxic rat brains Many more genes are upregulated in frontal (FR) and temporal (TE) cortex compared with parietal (PAR) cortex

Clozapine treatment and qRT-PCR results

To obtain a clearer picture, the focus was laid upon genes primarily being expressed presynaptically. Those were further investigated by qRT-PCR in the four brain regions in normoxic and hypoxic animals treated with clozapine (Table 3).
Table 3

“Clozapine”-induced effects in normoxic and hypoxic animals (empty = no effect)

NormoxicHypoxic
RegionGenReg.-Dir. P-valueRegionGenReg.-Dir. P-value
CPUCPX1CPUCPX1up0.026
FRCPX1down0.043FRCPX1
PARCPX1PARCPX1up0.012
TECPX1TECPX1
CPUNPYCPUNPY
FRNPYFRNPY
TENPYTENPY
CPUNRXN1CPUNPY
FRNRXN1FRNRXN1
PARNRXN1PARNRXN1
TENRXN1TENRXN1
CPUSNAP25CPUNRXN1
FRSNAP25FRSNAP25
PARSNAP25PARSNAP25
TESNAP25TESNAP25
FRSTX1Adown0.015FRSNAP25
PARSTX1Aup0.048PARSTX1Aup0.002
TESTX1ATESTX1A
Clozapine”-induced effects in normoxic and hypoxic animals (empty = no effect) Evidently, CPX1 is upregulated in frontal and temporal cortex as well as in caudate putamen, but not in parietal cortex in hypoxic animals (Table 2). Treatment with clozapine resulted in an upregulation also in parietal cortex. NPY was upregulated by hypoxia in frontal but downregulated in temporal cortex. Neurexin1 was upregulated in both frontal cortex and CPU in hypoxic animals. SNAP25 was also upregulated in frontal cortex but downregulated in CPU. Additionally, it was upregulated in temporal cortex. Another counterregulation was observed with syntaxin1A in frontal and temporal cortex (Table 2). Interestingly, in parietal cortex, where hypoxia had no effect, STX1A was upregulated by clozapine (Table 3).

Discussion

Complexin1

Upregulation of CPX1 upon postnatal hypoxia in frontal, temporal cortex, and CPU has not been reported yet (Fig. 1). In the light that clozapine additionally upregulated the gene in parietal cortex, it may be assumed that hypoxia-induced upregulation may be a compensatory mechanism to ensure proper vesicular transmitter release. Associations of complexins with schizophrenia have been repeatedly reported [9, 10, 13]. A recent report comes to the conclusion that complexins facilitate neurotransmitter release [33]. Specifically, it has been suggested that CPX1 downregulation during perinatal hypoxia in GABAergic neurons facilitates glutamate release and loss of overstimulated neurons—which subsequently results in reduced glutamatergic projections [24]. The upregulation of CPX1 in parietal cortex by clozapine is supported by the findings of Eastwood [8]. Our results showing the very strong correlation of CPX1 with PPI in hypoxia-treated animals (Table 4) support the view that this gene/protein is a key player in the development of Schizophrenia-like symptoms.
Fig. 1

Hypoxia- and clozapine-mediated differential regulation of presynaptic transcripts in some rat brain regions. Triple arrows : : chip results; dotted arrows : : qRT-PCR results

Table 4

Correlations of qRT-PCR expression data with prepulse inhibition (PPI)

GeneRegionEntityNormoxiaNormoxiaNormoxiaHypoxiaHypoxia
EntityWithout ClozapineWith ClozapineWithout ClozapineWith Clozapine
N rho P N rho P N rho P N rho P N rho P N rho P
CPX1CPU230.350.1112−0.380.236−0.89 0.02 60.030.9651012−0.380.23
NPYTE230.10.65120.0001.00060.89 0.02 6−0.310.5450.30.62120.0001.000
NRXN1CPU230.070.77120.70.0160.6000.2160.660.1650.20.75120.7 0.01
SNAP25FR200.020.9390.020.974−1.000 0.000 50.10.875−0.30.6290.020.97

Levels of gene expression in individual animals were correlated with the performance shown in the behavioral testing of prepulse inhibition (PPI). Four out of the five genes investigated turned out to show significant correlations (P-value smaller than 0.05) in specific brain regions under specific conditions. As shown in the table, in normoxic, non-medicated animals, PPI negatively correlates with complexin 1 level in CPU (P = 0.02) and SNAP25 (P < 0.01) level in the frontal cortex. A positive correlation between PPI and neuropeptide Y can be seen in the temporal cortex (P = 0.02). In contrast, in caudate putamen of hypoxic animals, complexin 1 shows a positive correlation with PPI. A comparable correlation is found also in CPU of clozapine-treated hypoxic animals with neurexin1 (P = 0.01)

Hypoxia- and clozapine-mediated differential regulation of presynaptic transcripts in some rat brain regions. Triple arrows : : chip results; dotted arrows : : qRT-PCR results Correlations of qRT-PCR expression data with prepulse inhibition (PPI) Levels of gene expression in individual animals were correlated with the performance shown in the behavioral testing of prepulse inhibition (PPI). Four out of the five genes investigated turned out to show significant correlations (P-value smaller than 0.05) in specific brain regions under specific conditions. As shown in the table, in normoxic, non-medicated animals, PPI negatively correlates with complexin 1 level in CPU (P = 0.02) and SNAP25 (P < 0.01) level in the frontal cortex. A positive correlation between PPI and neuropeptide Y can be seen in the temporal cortex (P = 0.02). In contrast, in caudate putamen of hypoxic animals, complexin 1 shows a positive correlation with PPI. A comparable correlation is found also in CPU of clozapine-treated hypoxic animals with neurexin1 (P = 0.01)

Neurexin1

Neurexins and neuroligins are emerging as central organizing molecules for excitatory glutamatergic and inhibitory GABAergic synapses. They function as cell adhesion molecules, bridging the synaptic cleft. Neurexin 1beta and neuroligin normally form trans-synaptic complexes [1]. Finally, there is a recent report showing that disruption of the neurexin 1 gene is associated with schizophrenia [26]. Preconditioning ischemia can downregulate the increased neurexin–neuroligin1PSD-95 interaction induced by ischemia injury and exerts a neuroprotective effect. These results indicate that the neurexin-neuroligin1 is an important signaling module in hypoxic injury and a novel possible target in therapeutics of brain ischemia [21].

SNAP25

Recent genetic studies implicate alterations in SNAP-25 gene structure, expression, and/or function in contributing directly to neuropsychiatric and neurological disorders. Protein-by-protein analyses indicated a significant reduction in SNAP-25 immunoreactivity in the schizophrenia non-suicide group [11, 15]. In another study, however, there were no differences in the immunoreactivity of proteins measured in schizophrenic patients. Apparently prefrontal cortical dysfunction in schizophrenia may exist without gross changes in the abundance of many synaptic proteins [13]. There were significant decreases in tissue levels of these proteins in prefrontal cortex of schizophrenic patients relative to controls, whereas the mRNAs encoding these proteins were not decreased [18]. Normal levels of SNAP-25 are noted in schizophrenia patients in Brodman area 17, decreased levels in areas 10 and 20, and an elevated level in area 9 [31]. In comparison with our results (Fig. 1), those findings strongly support the notion that regionally distinct expressions prevail and have always to be taken into consideration.

NPY

Regionally different gene expression of NPY is observed also in our report (Fig. 1). Patients with schizophrenia showed deficits in NPY mRNAs [14, 23]. Olanzapine and clozapine administration acutely decreased NPY mRNA levels in the nucleus accumbens, striatum, and anterior cingulate cortex of rats [16, 20]. The proportion of NPY neurons in the upper cortical layers was low, but it was high in the deep white matter in the disorganized and paranoid form [17].

Syntaxin 1

This presynaptic protein is another good example for regionally different gene expression. It is upregulated in FR but downregulated in TE, whereas there is no change in CPU and PAR by hypoxia treatment. Clozapine upregulates its expression in PAR but downregulates it in FR (Fig. 1). From literature reports, we know that there were significant negative correlations between age and mRNA levels of syntaxin 1A in schizophrenic patients. They were increased in the younger (58–79 years) subgroup of schizophrenic patients—which suggests that they reflect overall neurodevelopmental abnormalities in synaptic connectivity in the temporal cortex of schizophrenic patients [29].

Conclusions

Presynaptic proteins have been reported to be differentially regulated in schizophrenia. In our animal model of perinatal hypoxia, alterations in presynaptic genes in adulthood during the time period of behavioral deficits have been shown and may be involved in the pathophysiology leading to schizophrenia symptoms. However, we focused only on genes of the glutamatergic system, and all conclusions are limited to this domain. Our results reveal that chronic clozapine treatment may differentially influence gene expression and in this way contribute to the treatment of symptoms. Animal models of risk factors of schizophrenia are warranted to elucidate disease mechanisms and specific effects of antipsychotic treatment in disease states. Below is the link to the electronic supplementary material. Supplementary material 1 (PDF 437 kb)
  31 in total

Review 1.  Altered complexin expression in psychiatric and neurological disorders: cause or consequence?

Authors:  Nils Brose
Journal:  Mol Cells       Date:  2008-02-29       Impact factor: 5.034

2.  Alterations in synaptic proteins and their encoding mRNAs in prefrontal cortex in schizophrenia: a possible neurochemical basis for 'hypofrontality'.

Authors:  C N Karson; R E Mrak; K O Schluterman; W Q Sturner; J G Sheng; W S Griffin
Journal:  Mol Psychiatry       Date:  1999-01       Impact factor: 15.992

Review 3.  Obstetric complications and congenital malformation in schizophrenia.

Authors:  T F McNeil; E Cantor-Graae; B Ismail
Journal:  Brain Res Brain Res Rev       Date:  2000-03

4.  Synaptic pathology in the anterior cingulate cortex in schizophrenia and mood disorders. A review and a Western blot study of synaptophysin, GAP-43 and the complexins.

Authors:  S L Eastwood; P J Harrison
Journal:  Brain Res Bull       Date:  2001-07-15       Impact factor: 4.077

5.  Altered levels of the synaptosomal associated protein SNAP-25 in schizophrenia.

Authors:  P M Thompson; A C Sower; N I Perrone-Bizzozero
Journal:  Biol Psychiatry       Date:  1998-02-15       Impact factor: 13.382

6.  Expression of complexin I and II mRNAs and their regulation by antipsychotic drugs in the rat forebrain.

Authors:  S L Eastwood; P W Burnet; P J Harrison
Journal:  Synapse       Date:  2000-06-01       Impact factor: 2.562

7.  Alterations in GABA-related transcriptome in the dorsolateral prefrontal cortex of subjects with schizophrenia.

Authors:  T Hashimoto; D Arion; T Unger; J G Maldonado-Avilés; H M Morris; D W Volk; K Mirnics; D A Lewis
Journal:  Mol Psychiatry       Date:  2007-05-01       Impact factor: 15.992

8.  Reduced neuropeptide Y mRNA levels in the frontal cortex of people with schizophrenia and bipolar disorder.

Authors:  J Kuromitsu; A Yokoi; T Kawai; T Nagasu; T Aizawa; S Haga; K Ikeda
Journal:  Brain Res Gene Expr Patterns       Date:  2001-08

9.  Molecular determinants of dysregulated GABAergic gene expression in the prefrontal cortex of subjects with schizophrenia.

Authors:  Nikolaos Mellios; Hsien-Sung Huang; Stephen P Baker; Marzena Galdzicka; Edward Ginns; Schahram Akbarian
Journal:  Biol Psychiatry       Date:  2009-01-01       Impact factor: 13.382

10.  Behavioural alterations in rats following neonatal hypoxia and effects of clozapine: implications for schizophrenia.

Authors:  M Fendt; A Lex; P Falkai; F A Henn; A Schmitt
Journal:  Pharmacopsychiatry       Date:  2008-07       Impact factor: 5.788

View more
  15 in total

1.  Effects of haloperidol and clozapine on synapse-related gene expression in specific brain regions of male rats.

Authors:  Martina von Wilmsdorff; Fabian Manthey; Marie-Luise Bouvier; Oliver Staehlin; Peter Falkai; Eva Meisenzahl-Lechner; Andrea Schmitt; Peter J Gebicke-Haerter
Journal:  Eur Arch Psychiatry Clin Neurosci       Date:  2018-02-05       Impact factor: 5.270

2.  SNAP-25a/b Isoform Levels in Human Brain Dorsolateral Prefrontal Cortex and Anterior Cingulate Cortex.

Authors:  Peter M Thompson; Dianne A Cruz; Elizabeth A Fucich; Dianna Y Olukotun; Masami Takahashi; Makoto Itakura
Journal:  Mol Neuropsychiatry       Date:  2015-12-01

Review 3.  SNARE complex in developmental psychiatry: neurotransmitter exocytosis and beyond.

Authors:  Renata Basso Cupertino; Djenifer B Kappel; Cibele Edom Bandeira; Jaqueline Bohrer Schuch; Bruna Santos da Silva; Diana Müller; Claiton Henrique Dotto Bau; Nina Roth Mota
Journal:  J Neural Transm (Vienna)       Date:  2016-02-08       Impact factor: 3.575

4.  IsoDOT Detects Differential RNA-isoform Expression/Usage with respect to a Categorical or Continuous Covariate with High Sensitivity and Specificity.

Authors:  Wei Sun; Yufeng Liu; James J Crowley; Ting-Hued Chen; Hua Zhou; Haitao Chu; Shunping Huang; Pei-Fen Kuan; Yuan Li; Darla R Miller; Ginger D Shaw; Yichao Wu; Vasyl Zhabotynsky; Leonard McMillan; Fei Zou; Patrick F Sullivan; Fernando Pardo-Manuel de Villena
Journal:  J Am Stat Assoc       Date:  2015-11-07       Impact factor: 5.033

5.  GABAergic Abnormalities Associated with Sensorimotor Cortico-striatal Community Structural Deficits in ErbB4 Knockout Mice and First-Episode Treatment-Naïve Patients with Schizophrenia.

Authors:  Chengcheng Zhang; Peiyan Ni; Yikang Liu; Yang Tian; Jinxue Wei; Bo Xiang; Liansheng Zhao; Xiaojing Li; Xiaohong Ma; Wei Deng; Wanjun Guo; Rongjun Ni; Yamin Zhang; Qiang Wang; Hailiang Huang; Nanyin Zhang; Tao Li
Journal:  Neurosci Bull       Date:  2019-08-06       Impact factor: 5.203

6.  Transcriptome sequencing revealed significant alteration of cortical promoter usage and splicing in schizophrenia.

Authors:  Jing Qin Wu; Xi Wang; Natalie J Beveridge; Paul A Tooney; Rodney J Scott; Vaughan J Carr; Murray J Cairns
Journal:  PLoS One       Date:  2012-04-27       Impact factor: 3.240

7.  Structural synaptic elements are differentially regulated in superior temporal cortex of schizophrenia patients.

Authors:  Andrea Schmitt; Fernando Leonardi-Essmann; Pascal F Durrenberger; Sven P Wichert; Rainer Spanagel; Thomas Arzberger; Hans Kretzschmar; Mathias Zink; Mario Herrera-Marschitz; Richard Reynolds; Moritz J Rossner; Peter Falkai; Peter J Gebicke-Haerter
Journal:  Eur Arch Psychiatry Clin Neurosci       Date:  2012-03-23       Impact factor: 5.270

8.  Increased cell proliferation in the rat anterior cingulate cortex following neonatal hypoxia: relevance to schizophrenia.

Authors:  Evelin L Schaeffer; Franziska Kühn; Angelika Schmitt; Wagner F Gattaz; Oliver Gruber; Thomas Schneider-Axmann; Peter Falkai; Andrea Schmitt
Journal:  J Neural Transm (Vienna)       Date:  2012-07-19       Impact factor: 3.575

9.  Convergent functional genomics of schizophrenia: from comprehensive understanding to genetic risk prediction.

Authors:  M Ayalew; H Le-Niculescu; D F Levey; N Jain; B Changala; S D Patel; E Winiger; A Breier; A Shekhar; R Amdur; D Koller; J I Nurnberger; A Corvin; M Geyer; M T Tsuang; D Salomon; N J Schork; A H Fanous; M C O'Donovan; A B Niculescu
Journal:  Mol Psychiatry       Date:  2012-05-15       Impact factor: 15.992

10.  Pathophysiology of perinatal asphyxia: can we predict and improve individual outcomes?

Authors:  Paola Morales; Diego Bustamante; Pablo Espina-Marchant; Tanya Neira-Peña; Manuel A Gutiérrez-Hernández; Camilo Allende-Castro; Edgardo Rojas-Mancilla
Journal:  EPMA J       Date:  2011-07-26       Impact factor: 6.543

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.