| Literature DB >> 20945070 |
J U Sommer1, A Schmitt, M Heck, E L Schaeffer, M Fendt, M Zink, K Nieselt, S Symons, G Petroianu, A Lex, M Herrera-Marschitz, R Spanagel, P Falkai, P J Gebicke-Haerter.
Abstract
Obstetric complications play a role in the pathophysiology of schizophrenia. However, the biological consequences during neurodevelopment until adulthood are unknown. Microarrays have been used for expression profiling in four brain regions of a rat model of neonatal hypoxia as a common factor of obstetric complications. Animals were repeatedly exposed to chronic hypoxia from postnatal (PD) day 4 through day 8 and killed at the age of 150 days. Additional groups of rats were treated with clozapine from PD 120-150. Self-spotted chips containing 340 cDNAs related to the glutamate system ("glutamate chips") were used. The data show differential (up and down) regulations of numerous genes in frontal (FR), temporal (TE) and parietal cortex (PAR), and in caudate putamen (CPU), but evidently many more genes are upregulated in frontal and temporal cortex, whereas in parietal cortex the majority of genes are downregulated. Because of their primary presynaptic occurrence, five differentially expressed genes (CPX1, NPY, NRXN1, SNAP-25, and STX1A) have been selected for comparisons with clozapine-treated animals by qRT-PCR. Complexin 1 is upregulated in FR and TE cortex but unchanged in PAR by hypoxic treatment. Clozapine downregulates it in FR but upregulates it in PAR cortex. Similarly, syntaxin 1A was upregulated in FR, but downregulated in TE and unchanged in PAR cortex, whereas clozapine downregulated it in FR but upregulated it in PAR cortex. Hence, hypoxia alters gene expression regionally specific, which is in agreement with reports on differentially expressed presynaptic genes in schizophrenia. Chronic clozapine treatment may contribute to normalize synaptic connectivity.Entities:
Mesh:
Substances:
Year: 2010 PMID: 20945070 PMCID: PMC2965359 DOI: 10.1007/s00406-010-0159-1
Source DB: PubMed Journal: Eur Arch Psychiatry Clin Neurosci ISSN: 0940-1334 Impact factor: 5.270
Primers used in qRT-PCR
| Sequences reading from 5′ -end | ||
|---|---|---|
| Gene | Forward primer | Reverse primer |
| CPLX1 | GCAGGGCATACGAGATAAGT | TGGTGGGGTCAGTGATGGCAGTA |
| NPY | CGCTCTGCGACACTACAT | CTCAGGGCTGGATCTCTTG |
| NRXN1 | AGGGCGTCAGCTCACAATCTTCAA | TCTGCCGAGCCTGGGTATGGT |
| SNAP25 | AGTGGCGTTTGCTGAATGAC | TGCTGGTATGACTTAATCTTGACA |
| STX1A | TGTCCCGAAAGTTTGTG | GCGTTCTCGGTAGTCT |
Differentially expressed genes in some regions of normoxic and hypoxic rat brains
| CPU | FR | PAR | TE | ||||
|---|---|---|---|---|---|---|---|
| Genelist | Genelist | Genelist | Genelist | ||||
| The factor “hypoxia” regulated the following genes in comparison with “normoxia” | The factor “hypoxia” regulated the following genes in comparison with “normoxia” | The factor “hypoxia” regulated the following genes in comparison with “normoxia” | The factor “hypoxia” regulated the following genes in comparison with “normoxia” | ||||
| UP | DOWN | UP | DOWN | UP | DOWN | UP | DOWN |
| ATF2 | ATF2 | CAPN2 | ADCY3 | ||||
| ATF4 | AURKB | CAPON | ADCY6 | ||||
| ATP2A2 | CALM2 | CASK | ATP2A2 | ||||
| CPX1 | CAP2 | EAAT3 | BDNF | ||||
| CPX2 | CAPN8 | GABBR1 | BNPI | ||||
| GAP43 | CPX1 | GAPDH | CAPN2 | ||||
| GAPDH | DEAD BOX | GNA12 | CAPN6 | ||||
| GATA4 | DLGAP2 | LOC294679 | CASQ2 | ||||
| GRM2 | DUSP1 | LOC362704 | CPX1 | ||||
| ITPR1 | FYN | MAPK3 | DAT1 | ||||
| MARK1 | GAPDH | PIPS | EAAT3 | ||||
| MPPS7 | GNAO | PLD2 | ERK7 | ||||
| MYD116 | MAPK14 | PLEKHC1 | GABRG3 | ||||
| NM_017261 | MAPK3 | POU3F4 | GAD67 | ||||
| NOS2 | MRPS7 | PPP1R14A | GADD45A | ||||
| NRXN1 | NELL2 | PPP2R2C | GAP43 | ||||
| PKN1 | NPY | PPP5C | GATA4 | ||||
| PLD1 | NOS2-1149 | PREFOLDIN5 | GNAO | ||||
| PLEKHC1 | NRXN1 | PRKCZ | GPSM1 | ||||
| PPM1B | PACSIN2 | PTPRA | GRM8 | ||||
| PPP1CC | PIM3 | PTPRR | ID3 | ||||
| PPKCC | PLAT | RAB14 | ITPR3 | ||||
| PTP4A1 | PPP1R14B | RAB3A | LOC294679 | ||||
| PTPRA | PPP1R14C | RAB3B | LOC362704 | ||||
| PTPRN | PTP4A2 | RN.25045 | MGC105762 | ||||
| PTPRN2 | PTPRD | RN.28284 | NPY | ||||
| RAB10 | PTPRN | SHANK1 | NR2F2 | ||||
| RN.28284 | PTPRN2 | SLC2A1 | NRXN3 | ||||
| SACM1L | RAB3A | SLC6A12 | NUP54 | ||||
| SLC1A3 | SLC1A3 | SLK | PIPS | ||||
| SLC1A3 | SLC6A12 | SRC | PLD2 | ||||
| SLC1A6 | SNAP25 | STAT3 | PNOC | ||||
| SLC32A1 | SOD1 | SYT1-1511 | PPM1G | ||||
| SNAP25 | SQSTM1 | TRANSC.LOCUS | PPP1R10 | ||||
| STAT3 | SRC | PPP2R2C | |||||
| SYN1 | STK39 | PPP2R5B | |||||
| VAMP2 | STX1A | PPP4R1 | |||||
| TRANSC.LOCUS | PPP5C | ||||||
| PRKCH | |||||||
| PRKCZ | |||||||
| RAB10 | |||||||
| RGS3 | |||||||
| RN.137813 | |||||||
| RN.15926 | |||||||
| RN.7389 | |||||||
| SLC1A6 | |||||||
| SLC32A1 | |||||||
| SLC6A12 | |||||||
| SMAGP | |||||||
| SNAP25 | |||||||
| SP1 | |||||||
| SQSTM1 | |||||||
| STAT3 | |||||||
| STK6 | |||||||
| STX1A | |||||||
| SYN1 | |||||||
| SYN2 | |||||||
| TCF12 | |||||||
| VAMP1 | |||||||
Many more genes are upregulated in frontal (FR) and temporal (TE) cortex compared with parietal (PAR) cortex
“Clozapine”-induced effects in normoxic and hypoxic animals (empty = no effect)
| Normoxic | Hypoxic | ||||||
|---|---|---|---|---|---|---|---|
| Region | Gen | Reg.-Dir. |
| Region | Gen | Reg.-Dir. |
|
| CPU | CPX1 | CPU | CPX1 | up | 0.026 | ||
| FR | CPX1 | down | 0.043 | FR | CPX1 | ||
| PAR | CPX1 | PAR | CPX1 | up | 0.012 | ||
| TE | CPX1 | TE | CPX1 | ||||
| CPU | NPY | CPU | NPY | ||||
| FR | NPY | FR | NPY | ||||
| TE | NPY | TE | NPY | ||||
| CPU | NRXN1 | CPU | NPY | ||||
| FR | NRXN1 | FR | NRXN1 | ||||
| PAR | NRXN1 | PAR | NRXN1 | ||||
| TE | NRXN1 | TE | NRXN1 | ||||
| CPU | SNAP25 | CPU | NRXN1 | ||||
| FR | SNAP25 | FR | SNAP25 | ||||
| PAR | SNAP25 | PAR | SNAP25 | ||||
| TE | SNAP25 | TE | SNAP25 | ||||
| FR | STX1A | down | 0.015 | FR | SNAP25 | ||
| PAR | STX1A | up | 0.048 | PAR | STX1A | up | 0.002 |
| TE | STX1A | TE | STX1A | ||||
Fig. 1Hypoxia- and clozapine-mediated differential regulation of presynaptic transcripts in some rat brain regions. Triple arrows : : chip results; dotted arrows : : qRT-PCR results
Correlations of qRT-PCR expression data with prepulse inhibition (PPI)
| Gene | Region | Entity | Normoxia | Normoxia | Normoxia | Hypoxia | Hypoxia | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Entity | Without Clozapine | With Clozapine | Without Clozapine | With Clozapine | |||||||||||||||
|
| rho |
|
| rho |
|
| rho |
|
| rho |
|
| rho |
|
| rho |
| ||
| CPX1 | CPU | 23 | 0.35 | 0.11 | 12 | −0.38 | 0.23 | 6 | −0.89 |
| 6 | 0.03 | 0.96 | 5 | 1 | 0 | 12 | −0.38 | 0.23 |
| NPY | TE | 23 | 0.1 | 0.65 | 12 | 0.000 | 1.000 | 6 | 0.89 |
| 6 | −0.31 | 0.54 | 5 | 0.3 | 0.62 | 12 | 0.000 | 1.000 |
| NRXN1 | CPU | 23 | 0.07 | 0.77 | 12 | 0.7 | 0.01 | 6 | 0.600 | 0.21 | 6 | 0.66 | 0.16 | 5 | 0.2 | 0.75 | 12 | 0.7 |
|
| SNAP25 | FR | 20 | 0.02 | 0.93 | 9 | 0.02 | 0.97 | 4 | −1.000 |
| 5 | 0.1 | 0.87 | 5 | −0.3 | 0.62 | 9 | 0.02 | 0.97 |
Levels of gene expression in individual animals were correlated with the performance shown in the behavioral testing of prepulse inhibition (PPI). Four out of the five genes investigated turned out to show significant correlations (P-value smaller than 0.05) in specific brain regions under specific conditions. As shown in the table, in normoxic, non-medicated animals, PPI negatively correlates with complexin 1 level in CPU (P = 0.02) and SNAP25 (P < 0.01) level in the frontal cortex. A positive correlation between PPI and neuropeptide Y can be seen in the temporal cortex (P = 0.02). In contrast, in caudate putamen of hypoxic animals, complexin 1 shows a positive correlation with PPI. A comparable correlation is found also in CPU of clozapine-treated hypoxic animals with neurexin1 (P = 0.01)